Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Articles in PresS. Am J Physiol Cell Physiol (March 26, 2003). 10.1152/ajpcell.00058.2003 Mechanism for the maintenance of splenic T lymphocyte functions in proestrus females following trauma-hemorrhage: Enhanced local synthesis of 17β-estradiol T. S. Anantha Samy, Rui Zheng, Takeshi Matsutani, Loring W. Rue, III, Kirby I. Bland and Irshad H. Chaudry Center for Surgical Research and Department of Surgery, University of Alabama School of Medicine, Birmingham, AL 35294. Running title: 17β-estradiol synthesis and cytokine release by T cells Please address correspondence, proofs and reprint request to: Dr. Irshad H. Chaudry Center for Surgical Research University of Alabama School of Medicine G094, Volker Hall 1670 University Boulevard Birmingham, AL 35294 Tel: 205-975-2195 Fax: 205-975-9719 E-mail: [email protected] Key words: Inflammation, immune suppression, steroid synthesis, T lymphocytes, cytokines. Copyright (c) 2003 by the American Physiological Society. 2 Abstract Trauma-hemorrhage and resuscitation (TH) produces profound immunodepression and enhances susceptibility to sepsis in males but not in proestrus females, suggesting gender dimorphism in the immune responses. However, the mechanism responsible for the maintenance of immune functions in proestrus females following TH is unclear. Splenic T lymphocytes express receptors for estrogen (ER), contain enzymes involved in estrogen metabolism and are the major source of cytokine production; the metabolism of 17β-estradiol was assessed in the splenic T lymphocytes of proestrus and ovariectomized mice by using appropriate substrates following TH. Analysis for aromatase and 17β-hydroxysteroid dehydrogenases indicated increased 17β-estradiol synthesis and low conversion into estrone in T lymphocytes of proestrus but not of ovariectomized mice. The effect of 17β-estradiol on T lymphocyte cytokine release was reliant upon ER expressions. This was apparent in the differences of ER expression, especially that of ER-β, and an association between increased 17β-estradiol synthesis and sustained release of IL-2 and IL-6 in T lymphocytes of proestrus females following TH. Since 17β-estradiol is able to regulate cytokine genes and the splenic T lymphocyte cytokine releases is altered following TH, continued synthesis of 17β-estradiol in proestrus females appears to be responsible for the maintenance of T lymphocyte cytokine release associated with the protection of immune functions following TH. 3 Introduction. The influence of gender on immune functions has been recognized for many years and, in general, women are known to develop enhanced humoral responses compared to men and are more prone to autoimmune diseases (9,11,20). Trauma-hemorrhage and resuscitation (TH) produce severe impairment of both immune and cardiovascular functions (51,56,57). Although depression of cellular immunity occurs very early following TH, the loss in immune functions persists for a prolong period, which may lead to subsequent sepsis with high mortality rates (43,56). The immune depression is pronounced in males and ovariectomized females (OVX) following TH compared to proestrus females (54,55). Moreover, immune functions in males and OVX females can be restored by the administration of 17β-estradiol (E2) following TH (16-18). Thus, gender dimorphism is obvious in the loss of immune functions following TH implicating a major role for sex steroid hormones (2,3). Steroid hormones regulate immune functions in vivo and the mechanisms involve not only the control of cytokine gene transcription by the classical steroid hormone-receptor complex, but also the tissue specific metabolism of sex steroids (12,21,24,29,33,36,47). Among the sex steroids, estrogen is demonstrated to protect immune functions following TH because proestrus females are not immunodepressed compared to male and OVX mice. Furthermore, the depressed immune functions in males and OVX females following TH can be normalized by parenteral E2 administration (16-18). Ovary is the primary site of estrogen synthesis in females and, in spite of that, the enzymes involved in estrogen metabolism are also present in peripheral tissues, including spleen and the T lymphocytes (21,36). The presence of steroidogenic enzymes especially in the T lymphocytes suggests a role for local synthesis of E2 for interaction with the estrogen receptor (ER) and the production of cytokines as needed. E2 is a highly potent 4 regulatory sex steroid involved in a variety of metabolic functions. Because of its regulatory role, E2 seldom accumulates in the cells and its synthesis is dependent on the tissue requirement. Thus, understanding the E2 metabolism in the T lymphocytes is desirable for determining the basis for change in the cytokine releases by these cells following TH. In this regard, the expression and analysis of enzymes involved in steroid metabolism is meaningful compared to active steroid quantification, since regulatory steroids have a short half-life and quantification of steroid at sub-picomole levels in the tissues or cells is ambivalent. We therefore measured the activity and expression of the enzymes involved in E2 metabolism in splenic T lymphocytes using relevant substrates. Since the promoter regions of the cytokine genes have response elements for ER binding (24,32,33,35), E2 synthesis in T lymphocytes was evaluated in conjunction with ER α and β expressions, and IL-2 and IL-6 release (the cytokines whose release are altered following TH) in proestrus and OVX mice following TH in the same cell preparations. The results indicated that continued synthesis of E2 in splenic T lymphocytes of proestrus females appears to be responsible for the maintenance of IL-2 and IL-6 release in those cells and probably one of the reasons why proestrus females are not immunodepressed following TH. 5 Material and Methods Chemicals. Analytical grade reagents were used in all experiments. Androstene-4-ene-3,17dione[1,2,6,7-3H], specific activity 74 Ci/mmol; androstene-4-ene-3,17 dione[4-14C], specific activity 54 Ci/mmol; testosterone[4-14C], 5α-dihydrotestosterone [4-14C], specific activity 57 Ci/mmol; 17β-estradiol[4-14C], specific activity 54 Ci/mmol; and estrone[4-14C], specific activity 56 Ci/mmol were bought from NEN Life Science Products, Boston, MA. The unlabeled steroids were from Sigma (St. Louis, MO). The oligonucleotide primers for PCR assay were synthesized at BRL Life Technologies, Inc. (Gaithersburg, MD). Mice. Inbred C3H/HeN female mice, 6-8 week old weighing 20-25 g, were obtained from Charles River Laboratories, Wilmington, MA. The animal experiments were conducted according to the guidelines established by the National Institutes of Health and the protocols approved by the University of Alabama at Birmingham Institutional Animal Care and Use Committee. Experimental groups. Proestrus female mice that showed a large number of nucleated epithelial cells and few cornified cells in the vaginal smear were used in the experiments. The procedure described by Waynforth et al. (52) was followed for ovariectomy and two weeks after ovariectomy the animals were used in experiments. Animals were assigned to the following four groups (n=8 per group): female shams; females undergoing TH; OVX female shams; OVX females undergoing TH. Trauma-hemorrhage. The procedure for inducing trauma (i.e., midline laparotomy)-hemorrhage has been described in detail in our earlier publications (56,57). Briefly, after overnight fast, softtissue trauma was induced in mice by performing a 2-cm ventral midline laparotomy, which was 6 closed in two layers. Both femoral arteries were then catheterized and the animals were allowed to awaken. The animals were then bled rapidly to a mean arterial pressure of 30 mmHg, maintained at that pressure for 90 min and resuscitated with 4x the volume of shed blood with Ringer’s lactate solution. Sham-operated mice underwent the same anesthetic and surgical procedures, but neither hemorrhage nor resuscitation was carried out. The animals were sacrificed at 2 h after resuscitation and the spleens were removed for analysis. Preparation of T lymphocytes. The procedures for the preparation of splenocytes and enrichment of T lymphocytes have been described in an earlier publication (37,39). The purity of enriched lymphocytes was >95% and consisted of both CD4+ and CD8+ subsets. All analyses were carried out in the same population of T lymphocytes prepared from one mouse in each group or from pooled population of lymphocytes prepared from two mice in each group. Approximately 109 lymphocytes were used for preparation of homogenate in enzyme assays, 106 lymphocytes for mRNA expression by PCR analysis and 5x106 for bioassays. Enzyme assays. The modified assay procedures for 5α-reductase and for 17β-hydroxysteroid dehydrogenase oxidative and reductive activities have been described in detail previously (1,36,48). The assay mixtures after the enzyme reaction were extracted 5 times with methylene chloride and the steroids in the organic phase were analyzed by thin layer chromatography using the mobile phase of chloroform-ethyl acetate (3:1, v/v). The radioactivity of the separated steroids in the chromatographic plates was measured using InstantImager (Packard, Downers Grove, IL) and steroids were identified by comparison to the Rf values of standards. The aromatase activity was assayed by the procedure of Thompson and Siiteri (45). [3H]-androstenedione and [14C]-testosterone were used as substrates in these assays. For estimation of 3H20 release 1 ml of 10% activated charcoal with 1% dextran-T70 was added to the 7 assay mixture. After centrifugation at 10000 x g for 10 min, the radioactivity in 500 µl of supernatant was measured after addition of 5 ml liquid scintillation cocktail in the scintillation counter (Wallac, Gaithersburg, MD). For estimating [14C]- E2 conversion from [14C]- testosterone, the reaction mixture was extracted twice with two volumes of dichloromethane. After removal of the organic solvent, the residue was dissolved in 100 µl of methanol and subjected to TLC on silica gel plates with chloroform-ethyl acetate (3:1, v/v) as the mobile phase. The separated steroids in the chromatographic plates were measured for radioactivity with InstantImager. RT-PCR analysis. The RNA was prepared from T lymphocytes using the Atlas total RNA kit (Clontech, Palo Alto, CA) and purified by DNase treatment (1 unit/µl) for 30 min at 37o C. PolyA+ mRNA preparation and reverse-transcriptase (RT)-PCR reactions were carried out using the Access RT-PCR kit (Promega, Access RT-PCR System Kit, Madison, WI.). The primers used in PCR analysis (Table I) were chosen from the cDNA sequences of GeneBank and the software, www.genome.wi.mit.edu/genome_software/other/primer3.html, was used for the selection of primers. The PCR reactions were carried out in gradient Mastercycler (Eppendorf, Westbury, NY). The first cycle of reverse transcriptase reaction was carried out at 48o C for 45 min. The PCR cycle for amplification consisted of 30s denaturation at 94o C, followed by annealing at 60o C for 1 min and 2 min extension at 68o C. The final products were extended for 7 min at 68o C. Each enzyme was analyzed for amplification between 5 and 38 cycles. The number of amplification cycles for measuring expression differed considerably for each enzyme. Comparison of expressions between the sham and TH for each enzyme was made at the cycle where expression was nearly 50%. β-actin expression was used as the internal control. The PCR products were analyzed by electrophoresis on 1.5% agarose gels in 1x TAE buffer and visualized 8 by ethidium bromide staining under UV illumination. The intensity of cDNA bands was measured in the 500 Fluorescence Chemilimager (San Leandro, CA). Cytokine assays. The CTLL-2 cell line (TIB-214) for IL-2 assay and the hybrid cell line 7TD1 (CRL-1851) for IL-6 assay were obtained from the American Type Culture Collection (Rockville, MD). The bioassay procedures for IL-2 and IL-6 release in T cell culture supernatants have been described previously (57). The cells were stimulated with 10 µg/ml of anti-CD3 (BD Biosciences, San Jose, CA) in complete Click’s medium at 37oC for 36 h before the culture supernatants were assayed for the cytokine release. IL-2 activity in the T lymphocyte culture supernatants was determined by making serial dilutions of the supernatant (in 500 µl) to which CTLL-2 cells (1x105 cells/ml) were added. The cultures were incubated for 48 h at 37oC with 5% CO2. At the end of this time, 1µCi of 3H-thymidine (specific activity 6.7 Ci/mmol, New England Nuclear, Boston, MA) was added to each well and cultures were further incubated for 16 h. The cultures were then harvested with a multiple automated sample harvester (Skatron AS, Trombay, Norway) onto a glass fiber-filter mat and after during processed for liquid scintillation counting on Model 1205 Betaplate (Pharmacia/LKB Nuclear, Gaithersburg, MD). For the IL-6 assay, to the serial dilutions of the lymphocyte culture supernatant were added 100 µl of 7TD1 cells (5x105 cells/ml) and incubated for 72 h at 37oC in 5% CO2. At the end 20 µl of 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 5 mg/ml in RPMI1640 media) was added to each well and the plate was incubated for additional 4h. The MTT crystals that incorporated into the viable cells were dissolved by aspiration of the supernatant from each well and addition of 100 µl of isopropanol containing 0.04 M HCl. The absorbance of fluids in each well was measured at 620 nm using Bio-Tek automated microplate reader (Bio-Tek Instruments, Winooski, VT). Relative units of cytokine activity was computed by comparison of the curves 9 produced from dilution of the experimental samples to that generated by dilution of recombinant mouse IL-2 or IL-6 standards (R&D, Minneapolis, MN). Protein content. The protein content was determined by micro Bradford method (BioRad, Hercules, CA) with BSA as standard. Enzyme kinetics. Kinetic constants for steroid substrates were determined by Lineweaver-Burk analysis. Assays were carried out in triplicate using microsomal preparations of tissue homogenates. Ten concentrations of substrates between 1 and 200 µM were used for each steroid. Sigma Plot software version 2.0 (Jandel Scientific, San Rafael, CA) was used to generate hyperbolic functions and nonlinear regression plots. Statistical analysis. SigmaStat software version 2.0 (Jandel Scientific, San Rafael, CA) was used in nonlinear regression analysis. Data were analyzed by separate one-way ANOVA. When a significant F value was obtained, the effects were differentiated using Tukey’s test. Tests between effects were performed by Student’s t-test. Significance was achieved when p< 0.05. 10 Results 17β-estardiol synthesis. E2 is primarily synthesized from testosterone by aromatase. The activity of aromatase increased significantly in all the tissues and splenic T lymphocytes in proestrus females following TH (Figure 1A). Nonetheless, the increase in aromatase activity following TH in the tissues was not observed in OVX mice except in the adipose tissue where a significant increase in the activity was observed (Figure 1B). These results are in accordance with our earlier observation (36). E2 is also synthesized from androstenedione with E1 as the intermediate in the reaction. Two enzymes participate in this catalysis: aromatase for conversion of androstenedione to E1 and 17β-HSD for reduction of E1 to E2. The aromatase activity associated with androstenedione conversion to E1 in T lymphocytes of proestrus and OVX animals following TH is shown in Figures 1C and 1D. Aromatase activity in all the tissues was low with androstenedione as a substrate, compared to testosterone as the substrate, suggesting low conversion to E1 in all the tissues. The reduction of E1 to E2 is catalyzed by 17β-HSD and the activity of this enzyme in T lymphocytes is shown in Figures 2A and 2B. The 17β-HSD activities for conversion of E1 to E2 did not alter in the tissues and in T lymphocytes, following TH, in both the proestrus and OVX animals. Enzyme kinetics in T lymphocytes. The activity of enzymes involved in the metabolism of testosterone and E2 in the T lymphocytes of proestrus females, with pertinent substrates, is given in Table II. The catalytic efficiency of the enzymes, Vmax/Km, indicated that the production of E2 is from androstenedione through testosterone and not E1. Moreover, the analysis showed the presence of relatively low 5α-reductase activity, indicating less 5α-dihydrotestosterone (DHT) syntheses in the T lymphocytes of proestrus female mice. 11 Testosterone metabolism. Testosterone is synthesized from androstenedione by reductive catalysis. The activity of 17β-HSD associated in this catalysis in tissues of proestrus and OVX mice, following TH, is shown in Figures 2C and 2D. In proestrus females, significant increase in the activity was observed only in the ovary, spleen and T lymphocytes following TH (Figure 2C). The enzyme activity in adipose tissue was lower in OVX mice compared to proestrus females, and the enzyme activity did not change in this tissue in either group following TH (Figure 2D). 5α-reductase converts testosterone into DHT, which is a highly active androgen. There was no change in 5α-reductase activity of T lymphocytes or other tissues of both proestrus and OVX mice following TH (Figures 3A and 3B). Conversion to E1. E1 is an inactive estrogen because of low binding affinity to ER. The 17βHSD converts E2 into E1 by oxidative catalysis. Similar to reductase, the oxidation of E2 by this enzyme was low in the adrenal gland, ovary, adipose, spleen and T lymphocytes from proestrus females (Figures 3C and 3D). Trauma-hemorrhage and resuscitation did not alter the oxidative activity of the enzyme in any of the tissues, including T lymphocytes from the proestrus or OVX animals. Enzyme expression in T lymphocytes. The expression of 5α-reductase, aromatase and oxidative isomers II, IV and V of 17β-HSD in T lymphocytes of sham and trauma-hemorrhaged female mice is shown in Figure 4. The expression of aromatase did not change significantly following TH in proestrus females or in OVX mice. Likewise, the expression of the threE17β-HSD isomers was similar in both sham and trauma-hemorrhaged proestrus females but their expression was reduced in OVX females following TH. 5α-reductase expression was not different in proestrus or OVX mice following TH. 12 ER-α and ER-β expressions. The expression of ERs, α and β, in the splenic T lymphocytes from proestrus and OVX female mice, following TH are shown in Figure 5. The ER-β expression was low in OVX animals compared to ER-α expression. There was no change in the ER-α expression in the T lymphocytes of proestrus and OVX animals following TH. In contrast, in proestrus female ER-β expression decreased significantly following TH, whereas its expression significantly increased in OVX females under those same conditions. Cytokine expression and release. The expression of IL-2 and IL-6 in T lymphocytes of proestrus and OVX mice, following TH, is shown in Figure 6. The IL-2 expression was low in OVX females compared to proestrus females and TH did not alter IL-2 expression in either groups. Stimulation of T lymphocytes with Con A, however, resulted in a significant reduction in the IL2 release in OVX animals but not in proestrus females following TH. In contrast, IL-6 expression and release were different. Significant increase in IL-6 expression was observed in proestrus mice following TH, however, the expression decreased significantly in OVX animals. Moreover, Con A stimulation of T lymphocytes did not alter the release of IL-6 in T lymphocytes from proestrus females following TH, whereas, a three decrease in the IL-6 release was observed in OVX females under such conditions. 13 Discussion Estrogen is a key regulator of cell growth, differentiation and function in a wide variety of tissues. It plays an important role during pregnancy in the modulation of the maternal immune system to prevent rejection of the fetus. Estrogen modulation of the immune system is not restricted to pregnancy alone since its role also documented in many autoimmune disorders and in the outcome following TH (7,14,16,17,23,55). The majority of the estrogen effects are mediated by two distinct intracellular receptors, ER-α and ER-β, each encoded by unique genes (14,20,34). However, studies have also suggested that E2 interaction with other cell surface receptors including growth factor or dopamine receptors (13,19,30,47). Non-genomically estrogen is capable of regulating Ca++i mobilization and iNOS release in the cells (19,34). The major consequence of TH, besides impairment of the cardiovascular system, is severe depression of immune functions (51,56,57). The depression is profound in males but is not observed in proestrus females indicating sexual dimorphism in the immune response following TH. The divergent immune responses following TH in males and proestrus females is also manifested by the altered release of cytokines, IL-2 and IL-6, by the splenic T lymphocytes (2,3,16,54,55). Since T lymphocytes express receptors for E2 and are also capable of synthesizing E2 locally, the assessment of local active steroid synthesis in the release of cytokines by T lymphocytes becomes significant. Hence, the metabolism of E2 and its effect on the release of IL-2 and IL-6 was assessed in T lymphocytes of proestrus and OVX mice following TH. Enzyme kinetics shows that synthesis of E2 from androstenedione is via the formation of testosterone and not via E1. This study indicates a correlation between increased endogenous synthesis of E2, low conversion to E1 (Figure 7), and the persistent release of IL-2 and IL-6 in 14 the lymphocytes of proestrus female following TH. This is substantiated by: (a) the enhancement of aromatase activity, which leads to E2 synthesis in T lymphocytes after TH, unlike reduction in the enzyme activity in OVX females under the same conditions, (b) increased production of testosterone from catalytic reduction of androstenedione by 17β-HSD in proestrus animals following TH, whereas this enzyme activity was unchanged in OVX animals indicating sustained availability of testosterone for conversion to E2 by aromatase in proestrus animals, and (c) the comparatively low oxidative catalysis by 17β-HSD in both proestrus and OVX animals suggesting little or no conversion of E2 into E1. The expressions of 17β-HSD isomers were analyzed by routine RT-PCR analysis, which is not quantitative. Our aim was to determine whether different forms of the 17β-HSD isomers are expressed in T lymphocytes and if they are expressed, whether their expression is altered following TH. The enzyme expressions were therefore evaluated in the same T lymphocyte preparation that was used for enzyme assays, estrogen receptor expression as well as IL-2 and IL-6 expression and release. The results show changes in the expression of 17β-HSD isomers after ovariectomy and following TH. It is, however, necessary to quantify the 17β-HSD isomer expressions by a quantitative PCR procedure for meaningful association of the different isomers in the E2 metabolism in T lymphocytes. Testosterone is also the precursor of DHT. No change in the 5α-reductase activity, either after ovariectomy or following TH in proestrus and OVX females was evident indicating little change in the production of DHT in T lymphocytes. Since DHT is considered as an inhibitor of aromatase activity (6,41), an increase in its activity would have lowered E2 production. A significant observation of our study is the lack of correlation of aromatase expression in T lymphocytes with the enzyme activity in both proestrus and OVX animals. This, however, is 15 not surprising since E2 formation from testosterone is the result of a coupled reaction involving aromatase P450 and a flavoprotein NADPH-cytochrome P450 reductase (42) and the expression of aromatase alone was assessed in this study. Furthermore, this enzyme reaction requires NADPH as a cofactor. In this regard, our previous studies have indicated decreased splenocyte ATP levels and NAD:NADH ratio in tissues following hemorrhagic shock (25). This suggests that not only the expression but also the cofactor requirements are important for the assessment of aromatase activity. The predominant biological effects of E2 are mediated through two intracellular receptors, ER-α and ER-β, and our study shows that both the subtypes are present in the splenic T lymphocytes of female mice. However, their expression in response to TH is different. ER-α expression did not change after ovariectomy or following TH, whereas ER-β expression decreases significantly following ovariectomy. Moreover, expression of ER-β is significantly different in the proestrus and OVX animals after TH; its expression is decreased in proestrus and increased in OVX animals. The increased production of E2, attenuated expression of ER-β in the proestrus and the opposite effects in the OVX females following TH suggest that down regulation of ER-β may be a factor associated with the change in the cytokine releases by T lymphocytes. Since the T lymphocyte populations used in the experiments consisted of both CD4+ and CD8+ phenotypes (37), analysis of each phenotype for receptor expressions is needed for correlating the changes in receptor subtype expression to lymphocyte differentiation or functional changes, such as a particular cytokine release. The present study compared E2 synthesis with the in vitro stimulated release of IL-2 and IL-6 in the same cell preparations obtained from different groups. We selected the release of IL-2 and IL-6 in these studies since: (i) the alterations in the release of these cytokines is an indication 16 of the proinflammatory condition, i.e., Th1 to Th2 shift, and (ii) our earlier studies have demonstrated marked alterations in the release of these cytokines in OVX females but not in proestrus females following TH (16,55). Furthermore, the release of these cytokines can by restored by administration of E2 in OVX females during or immediately resuscitation (16). In the present study, we observed the expression and release of the pro inflammatory cytokines, IL-2 and IL-6, in T lymphocytes are also different in the proestrus and OVX animals and in response to TH. IL-2 expression, although low in OVX animals when compared to proestrus, did not change after TH in either group. In contrast, IL-6 expression was similar in both proestrus and OVX mice, but it was augmented in proestrus and markedly decreased in OVX mice following TH. The release of the cytokines, determined by bioassay in response to antiCD3 stimulation of T lymphocytes, was also different. The use of antiCD3 as a stimulant for T lymphocytes cytokine releases is evocative since Con A is primarily a mitogen associated with cell proliferation whereas antiCD3 is associated with the T lymphocyte functions. The release of IL-2 and IL-6 was similar in proestrus and OVX females in sham controls, but significantly decreased release of both cytokines was observed only in the OVX animals following TH. A distinct association between E2 synthesis and cytokine release in different groups is evident in this study. Increased E2 synthesis in T lymphocytes proestrus females following TH appears to be associated with sustained release of IL-2 and IL-6 in those animals since loss in E2 production is reflected by decreased release of these cytokines in the OVX females following TH. The cytokine releases in this study were determined in T lymphocyte preparation that contained CD4+ and CD8+ subsets. Analysis of cytokines expression and release in each T lymphocyte subsets is important for any meaningful correlation. 17 Substantial emphasis has been focused recently on the regulation of extra-gonadal biosynthesis of sex steroids. The local synthesis of active steroids in T lymphocytes is essential for carrying out of their specific functions, especially, the release of cytokines. The rate of formation of each steroid depends upon the level of expression of the specific androgen- and estrogen-synthesizing enzymes in the tissue. Moreover, local synthesis of active steroids is meaningful compared to availability in circulation, since the steroid can be synthesized as needed and catabolized immediately after fulfillment of tissue function. This is especially true for any regulatory molecule of which E2 is one. Our recent studies have shown augmented synthesis and decreased catabolism of DHT as the likely cause for loss of T lymphocyte functions in males following TH as reflected in the decreased release of IL-2 and IL-6 by T lymphocytes (58). In this study, we demonstrate enhanced synthesis of E2, which promotes the maintenance IL-2 and IL-6 release by T lymphocytes in proestrus mice following TH. Thus, both of our studies suggest an important role for steroid metabolizing enzymes in the release of cytokines by T lymphocyte following TH. Among the sex steroid metabolizing enzymes, the activities of 17βHSD isomers appears to be critical since they catalyzes both the oxidative and reductive reactions that are required for the synthesis of testosterone, DHT and E2 as well as their catabolism into inactive steroids (21,31). This enzyme is also involved in the formation of 5androstene-3β,17β-diol from dehydroepiandrosterone (DHEA), which has been shown to bind to the ER (21,27,40). In this regard, our previous studies have demonstrated that DHEA administration following TH restores immune functions in male mice and the effects appear to be mediated via the ER since Tamoxifen blocked the salutary effects of this adrenal steroid (4,5). Thus, being at the final steps of the formation and inactivation of active estrogens and androgens, 17β-HSD isomers play a unique role in the sex-steroid sensitive physiological functions. 18 Clinical trauma is a pathological condition that produces an inflammatory response and our recent retrospective study reveals female patients in pre-menopausal age range tolerating blunt trauma far better than the males (10). Our experimental results point to sex hormones significantly influencing the immune system in males and females following TH. Thus, gender and the hormonal status of the host appear to be critical in the outcome of TH and estrogen appears to be beneficial in the favorable outcome. Estrogen functions in different tissues and cells by distinct mechanisms, either by regulation of gene activity or by regulation of signal transduction processes (13,19,47,50). Our studies show that the local synthesis of the active steroid appears to be important at least for the T lymphocyte cytokine releases. Thus, a thorough understanding of the mechanisms of action of estrogen in different tissues as well as in different immune cells is important. Such studies are expected to lead to further understanding the basis of the pathophysiology of TH and help in the development of improved therapy to prevent/decrease morbidity and mortality following TH. 19 Acknowledgments. This work was supported by a grant from the National Institutes of Health, R01 GM-37127. 20 References. 1. Andersson S, Bishop RW, and Russell DW. Expression, cloning and regulation of steroid 5α-reductase, an enzyme essential for male sexual differentiation. J Biol Chem 264:16249-16255, 1989. 2. Angele MK, Ayala A, Monfils BA, Cioffi WG, Bland KI, and Chaudry IH. Testosterone and/or low estradiol: Normally required but harmful immunologically for males after trauma-hemorrhage. J Trauma 44:78-85, 1998 3. Angele MK, Schwacha MG, Ayala A, and Chaudry IH. Effect of gender and sex hormones on immune responses following shock. Shock 14: 81-90, 2000. 4. Angele MK, Catania RA, Ayala A, Cioffi WG, Bland KI, and Chaudry IH. Dehydroepiandrosterone: An inexpensive steroid hormone that decreases the mortality from sepsis following trauma-induced hemorrhage. Arch Surg 133:1281-1288, 1998. 5. Catania RA, Angele MK, Ayala A, Cioffi WG, Bland KI, and Chaudry IH. Dehydroepiandrosterone restores immune function following trauma-hemorrhage by a direct effect on T lymphocytes. Cytokine 11:443-450, 1999. 6. Chan WK, and Tan CH. FSH-induced aromatase activity in porcine granulose cells: noncompetitive inhibition by non-aromatizable androgens. J Endocrinol 108:335-341, 1986. 7. Cutolo M, Sulli A, Seriolo B, Accardo S, and Masi AT. Estrogens, the immune response and autoimmunity. Clin. Exp. Rheumatol 13:217-226, 1995. 8. Dufort I, Rheault X-F, Huang P, Soucy T, and Luu-The V. Characteristics of a highly labile human typeV 17β-hydroxysteroid dehydrogenase. Endocrinol 140:568-575, 1999. 9. Eidinger D, and Garrett TJ. Studies of the regulatory effects of the sex hormones on antibody formation and stem cell differentiation. J Exp Med 136:1098-1116, 1972. 21 10. George RL, McGwin Jr G, Windham ST, Melton SM, Metzger J, Chaudry IH, and Rue III LW. Age related gender differential in outcome following blunt or penetrating trauma. Shock 19: 28-32, 2003. 11. Grossman CJ, Roselle GA, and Mendenhall CL. Sex steroid regulation of autoimmunity. J Steroid Biochem Mol Biol 40:649-659, 1991. 12. Grossman CJ. Regulation of the immune system by sex steroids. Endocr Rev 5:435-455, 1994. 13. Hall JM, Couse JF, and Korach KS. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 276:36869-36872, 2001. 14. Jansson L, and Holmdahl R. Estrogen-mediated immunosuppression in autoimmune diseases. Inflamm Res 47:290-301, 1998. 15. Kashima N, Nishi-Takaoka C, Fujita T, Taki S, Hamuro J, and Taniguchi T. Unique structure of murine interleukin-2 as deduced from cloned cDNAs. Nature 313:402-404, 1985. 16. Knöferl MW, Jarrar D, Angele MK, Ayala A, Schwacha MG, Bland KI, and Chaudry IH. 17β-estradiol normalizes immune responses in ovariectomized females after traumahemorrhage. Am J Physiol Cell Physiol 281:C1131-C1138, 2001. 17. Knöferl MW, Diadoto MD, Angele MK, Ayala A, Cioffi WG, Bland KI, and Chaudry IH. Do female sex steroids adversely or beneficially affect the depressed immune responses in males after trauma-hemorrhage? Arch Surg 135: 425-433, 2000. 18. Knöferl MW, Angele MK, Diodato MD, Schwacha MG, Ayala A, Cioffi WG, Bland KI, and Chaudry IH. Female sex hormones regulate macrophage function following trauma- 22 hemorrhage and prevent increased mortality from subsequent sepsis. Ann Surg 235:105112, 2002. 19. Kousteni S, Bellido T, Plotkin LT, O’Brien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, and Manolagas SC. Nongenotropic, sex-nonspecific signaling through the estrogen and androgen receptors: dissociation from transcriptional activity. Cell 104:719730, 2001. 20. Krzych U, Strausser HR, Bressler JP, and Goldstein AL. Effects of sex hormones on some T and B cell functions, evidenced by differential immune expression between male and female mice by cyclic pattern of immune responsiveness during the estrous cycle in female mice. Am J Reprod Immunol 1: 73-77,1981. 21. Labrie F, Luu-The V, Lin SX, Simard J, Labrie C, El-Alfy M, Pelletier G, and Bélanger A. Intracrinology: role of the family of 17β-hydroxysteroid dehydrogenases in human physiology and disease. J Mol Endocin 25:1-16, 2000. 22. Labrie F, Sugimoto Y, Luu-The V, Simard J, Lachance Y, Bachvarov D, Leblanc G, Durocher F, and Paquet N. Structure of human type II 5 alpha-reductase gene. Endocrinol 131:1571-1573, 1992. 23. Lahita RJ. The role of sex hormone in systemic lupus erythematosus. Curr Opin Rheumatol 11:352-356, 1999. 24. McDonnell DP. Definition of the molecular action of tissue-selective oestrogen-receptor molecules. Biochem So. Trans 26:54-60, 1998. 23 25. Meldrum DR, Ayala A, Wang P, Ertel W, and Chaudry IH. Association between decreased splenic ATP levels and immunodepression: amelioration with ATP-MgCl2. Am J Physiol Regulatory Integrative Comp Physiol 261:R351-R357, 1991. 26. Mustonen MVJ, Poutanen MH, Isomaa VV, Vihko PT, and Vihko RK. Cloning of mouse 17β-hydroxysteroid-dehydrogenase type 2 and analyzing expressions of the mRNAs for types 1, 2, 3, 4 and 5 in mouse embryos and adult tissues. Biochem J 325:199-205, 1997. 27. Nephew KP, Sheeler CQ, Dudley MD, Gordon S, Nayfield SG, and Khan SA. Studies of dehydroepiandrosterone (DHEA) with the human estrogen receptor in yeast. Mol Cell Endocrinol 143:133-142, 1998. 28. Normand T, Husen B, Leenders F, Pelczar H, Baert JL, Begue A, Flourens AC, Adamski J, and de Launoit Y. Molecular Characterization of mouse 17β-hydroxysteroid dehydrogenase IV. J Steroid Biochem Mol Biol 55:541-548, 1995. 29. Olsen NJ, and Kovacs WJ. Gonadal steroids and immunity. Endocr Rev 17:369-384, 1994. 30. Patterson K, and Gustafsson J-A. Role of estrogen receptor beta in estrogen action. Annu Rev Physiol 63:165-192, 2001. 31. Peltoketo H, Vihko P, and Vihko R. Regulation of estrogen action: role of 17βhydroxysteroid dehydrogenases. Vitamins and hormones 55:353-398, 1999. 32. Pottratz ST, Bellido T, Mocharla M, Crabb D, and Manolagas SC. 17β-estradiol inhibits expression of human interleukin-6 promoter-receptor constructs by a receptor-dependent mechanism. J Clin Invest 93:944-950, 1994. 24 33. Ray A, Prefontaine KE, and P Ray. Down-modulation of interleukin-6 gene expression by 17β-estradiol in the absence of high affinity DNA binding by the estrogen receptor. J Biol Chem 269:12940-12946, 1994. 34. Rosenfeld CR, White RE, Roy T, and Cox BE. Calcium-activated potassium channels and nitric oxide coregulate estrogen-induced vasodilation. Am J Physiol Heart Circ Physiol 279:H319-H328, 2000. 35. Ruh MF, Bi Y, D’Alonzo R, and Bellone CJ. Effect of estrogens on IL-1β promoter activity. J Steroid Biochem Mol Biol 66:203-210, 1998. 36. Samy TSA, Knöferl MW, Zheng R, Schwacha MG, Bland KI, and Chaudry IH. Divergent immune responses in male and female mice following trauma-hemorrhage: dimorphic alterations in T lymphocyte steroidogenic enzyme activities. Endocrinol 42:3519-3529, 2001. 37. Samy TSA, Schwacha MG, Chung S-C, Cioffi WG, Bland KI, and Chaudry IH. Proteasome participates in the alteration of signal transduction in T and B lymphocytes following trauma-hemorrhage. Biochim Biophys Acta 1453:92-104, 1999. 38. Samy TSA, Schwacha MG, Cioffi WG, Bland KI, and Chaudry IH. Androgen and estrogen receptors in splenic T lymphocytes: The effects of Flutamide and traumahemorrhage. Shock 14:465-470, 2000. 39. Samy TSA, Catania RA, Ayala A, and Chaudry IH. Trauma-hemorrhage activates signal transduction pathways in mouse splenic T lymphocytes. Shock 9:443-450, 1998. 40. Schmidt M, Kreutz M, Loffler G, Scholmerich J, and Straub RH. Conversion of dehydroepiandrosterone to down stream steroid hormones in macrophages. J Endocrinol 164:161-169, 2000. 25 41. Shilling AD, and Williams DE. The non-aromatizable androgen, dihydrotestosterone, induces antiestrogenic responses in the rainbow trout. J Steroid Biochem Mol Biol 74: 187-194, 2000. 42. Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM, GrahamLorence S, Amernesh B, Ito Y, Fisher CR, Michael MD, Mendelson CR, and Bulun SE. Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 15:342-355, 1994. 43. Stephan RN, Kupper TS, Geha AS, Baue AE, and Chaudry IH. Hemorrhage without tissue trauma produces immunosuppression and enhances susceptibility to sepsis. Arch Surg 122:62-68, 1987. 44. Terashima M, Toda K, Kawamoto T, Kuribayashi I, Ogawa Y, Maeda T, and Shizuta Y. Isolation of a full-length cDNA encoding mouse aromatase P450. Arch Biochem Biophys 285:231-237, 1991. 45. Thompson EA, and Siiteri PK. Utilization of oxygen and reduced nicotinamide adenine dinucleotide phosphate by human placental microsomes during aromatization of androstenedione. J Biol Chem 279:5364-5372, 1974. 46. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, and Giguere V. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol Endocrinol 11:353-365, 1997. 47. Tsai MJ, and O'Malley BW. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486, 1994. 26 48. Turgeon C, Gingras S, Carrière MC, Blais Y, Labrie F, and Simard J. Regulation of sex steroid formation by interleukin-4 and interleukin-6 in breast cancer cells. J Steroid Biochem Mol Biol 65:151-162, 1998. 49. Van Snick J, Cayphas S, Szikora, Renauld J-C, Van Roost, Boon T, and Simpson RJ. cDNA cloning of murine interleukin-HP1: homology with human interleukin 6. Eur J Immunol 18:193-197, 1988. 50. Wade CB, Robinson S, Shapiro RA, and Dorsa DM. Estrogen receptor (ER)α and ERβ exhibit unique pharmacologic properties when coupled to activation of the mitogenactivated protein kinase pathway. Endocrinol 142:2336-2342, 2001. 51. Wang P, Ba ZF, Burkhardt J, and Chaudry IH. Trauma-hemorrhage and resuscitation in the mouse: effects on cardiac output and organ blood flow. Am J Physiol Heart Circul Physiol 33:H1166-H1173, 1993. 52. Waynforth H.B. Experimental and surgical techniques in the rat. London: Academic. 1980. 53. White R, Lees JA, Needham M, Ham J, and Parker M. Structural organization and expression of the mouse estrogen receptor. Mol Endocrinol 1:735-744, 1987. 54. Wichmann MW, Angele MK, Ayala A, Cioffi WG, Chaudry IH. Flutamide: A novel agent for restoring the depressed cell-mediated immunity following soft-tissue trauma and hemorrhagic shock.” Shock 8: 242-248, 1997. 55. Wichmann MW, Zellweger R, DeMaso CM, Ayala A, and Chaudry IH. Enhanced immune responses in females, as opposed to decreased responses in males following hemorrhagic shock and resuscitation. Cytokine 8: 853-863, 1996. 27 56. Xu YX, Ayala A, and Chaudry IH. Prolonged immunodepression following trauma and hemorrhagic shock. J Trauma 44:335-341, 1998. 57. Zellweger R, Ayala A, DeMaso CM, and Chaudry IH. Trauma-hemorrhage causes prolonged depression in cellular immunity. Shock 4:149-153, 1995. 58. Zheng , Samy TSA, Schneider CP, Rue III LW, Bland KI, and Chaudry IH. Decreased 5α-dihydrotestosterone catabolism suppress T lymphocyte functions in males after trauma-hemorrhage. Am J Physiol Cell Physiol 282:C1332-C1338, 2002. Footnotes. Abbreviations: Trauma-hemorrhage and resuscitation, TH; Ovariectomized, OVX; E1, estrone; E2, 17β-Estradiol; DHT, 5α-Dihydrotestosterone; DHEA, Dehydroepiandrosterone; ER-α, Estrogen receptor α; ER-β, Estrogen receptor β; 17β-HSD, 17β-Hydroxysteroid dehydrogenase. 28 Table 1. Primers used in PCR analysis. Target mRNA Primer sequences Location 5α-Reductase type II (22) 5’CAGTGGTACTAAGCACAGAAACTCAC3’ 5’AGCTACACCTGAAGATTTACTTCACC3’ 5’CTTTCAGCCTTTTGGCTTTG3’ 5’ TTTCTTCACTGGTCCCCAAC3’ 5’ TCCTGGCCATAGTTCTCTCCTG3’ 5’CAAGGCGTTTCTGCCTCTACTT3’ 5’ GGATTTTCTGCAAGGCATGT3’ 5’ CCCTTCAGAGCTTGGCATAG3’ 5’ TTCTGACTTCCATGGGCATT3’ 5’ TAGACGCACTGTCTGCTGCT3’ 5’GAAGCTAGTGCTCAGCTCTCTA3’ 5’TAGAGTCTCTGTACAGCCAAGG3’ 5’ATGGCATTCTACAGTCCTGCTGTGATGAAC3’ 5’TCACTGAGACTGGAGGTTCTG3’ 5’ACAGGTTCCCCGGGCAGCATCTCTA3’ 5’TCAGCATCTCATCCCAGCCCAAGCA3’ 5’TGATGCTGGTGACAACCACGGCCTTC3’ 5’AGCCACTCCTTCCTGTGACTCCAGCTT3’ 3793-3819 4245-4271 1324-1343 1754-1773 697-718 971-990 1621-1640 2105-2224 63-84 345-365 590-610 1146-1168 1162-1184 1375-1497 100-121 336-357 34-59 647-671 Aromatase (44) 17β-HSD type II (26) 17β-HSD type IV (28) 17β-HSD type V (8) ER-α (53) ER-β (46) IL-2 (15) IL-6 (53) 29 Table 2. Kinetics of aromatase, 5α-reductase and 17β-HSD of splenic T lymphocytes with different substrates Activity Aromatase Substrate Testosterone Androstenedione Testosterone 5α-Reductase Androstenedione 17β-HSD Estrone (reductive) *pmoles/mg protein/min Product Vmax* Km Vmax/ Km 17β-estradiol Estrone 5α-dihydrotestosterone Testosterone 17β-estradiol 200 186 150 150 120 7.5 25.8 24 16.7 48.3 26.6 7.2 6.25 9.0 2.5 30 Figure Legends Figure 1. Aromatase activity in different tissues isolated from proestrus and ovariectomized (OVX) mice following trauma-hemorrhage, with testosterone (A and B) and 4-androstenedione (C and D) as substrates. The data are expressed as mean + SD of 8 experiments for each group. S, sham. *p<0.05 vs. sham. Figure 2. The reductase activity of 17β-hydroxysteroid dehydrogenase (17β-HSD) in different tissues isolated from proestrus and OVX mice following trauma-hemorrhage, with estrone and (A and B) and 4-androstenedione (C and D) as substrates. The data are expressed as mean + SD of 8 experiments for each group. S, sham. *p<0.05 vs. sham. Figure 3. The activity of 5α-reductase with testosterone (A and B) as the substrate and 17βhydroxysteroid dehydrogenase (17β-HSD), oxidative, with 17β-estradiol (C and D) as the substrate in different tissues isolated from proestrus and OVX mice following TH. The data are expressed as mean + SD of experiments for each group. S, sham. *p<0.05 vs. sham. Figure 4: The expression of 5α-reductase (5AR, 479 bp); aromatase (ARO, 450 bp); 17βhydroxysteroid dehydrogenase oxidative isomers (17β-HSD type II 294 bp, type IV 605 bp and type V 303 bp), analyzed by RT-PCR assay, in splenic T lymphocytes of proestrus and OVX mice following TH. S, sham. The data shown is a representative of four separate experiments. Figure 5: The effect of trauma-hemorrhage on ER-α and ER-β expression in T lymphocytes of proestrus (P) and OVX mice. S, sham. The data is representative of four separate experiments. Figure 6: The effect of trauma-hemorrhage on the expression and release of IL-2 and IL-6 by T lymphocytes from proestrus and OVX mice. The IL-2 and IL-6 expression in lymphocytes were by RT-PCR analysis and the data is a representative of 4 separate experiments. The relative intensity of the band (receptor expression from 4-6 analyses) is shown in the histogram. For 31 cytokine release, the lymphocytes were stimulated with 10 µg per ml of anti-CD3 in Click’s medium at 37oC for 36 h. S, sham. Data are expressed as mean + SD of 8 experiments for each group. *p<0.05 vs. sham. Figure 7: Metabolism of 17β-estradiol in the T lymphocytes. 5-AR, 5α-reductase; 17β-HSD, 17β-hydrosysteroid dehydrogenase; R, reduction; O, oxidation. 32 Samy et al Figure 1 Aromatase activity 17β-estradiol formed pmoles/mg protein/min 80 80 A Proestrus * 60 TH S 40 * 20 * * * * 20 0 0 Adrenal gland Ovary Adrenal Spleen T cells Adipose gland Aromatase activity estrone formed pmoles/mg protein/min TH S 60 40 10 OVX B C Proestrus S TH 5 10 Spleen T cells Adipose OVX D S 5 0 0 Ovary Adrenal Spleen gland T cells Adipose Adrenal gland Spleen T cells Adipose TH 33 17β-HSD activity (reductive) 17β-estradiol formed pmoles/mg protein/min Samy et al Figure 2 Proestrus A 10 S 5 10 OVX B S TH 5 0 0 Adrenal gland 17 β-HSD activity (reductive) testosterone formed pmoles/mg protein/min TH Ovary Spleen C Adrenal gland Adipose T cells D Proestrus 50 S * * 25 TH Spleen T cells 50 Adipose OVX S * 25 0 0 Adrenal gland Ovary Spleen T cells Adipose Adrenal Spleen gland T cells Adipose TH 34 Samy et al Figure 3 5α-Reductase activity 5α-dihydrotestosterone formed pmoles/mg protein/min 60 50 60 A Proestrus S 40 40 30 30 20 20 10 10 0 17β-HSD activity, (oxidative) estrone formed pmoles/mg protein/min S TH 0 Adrenal gland Ovary Adrenal Spleen T cells Adipose gland 30 OVX B 50 TH C 15 TH T cells D Proestrus S Spleen Adipose OVX S 30 15 0 0 Adrenal gland Ovary Spleen T cells Adipose Adrenal gland Spleen T cells Adipose TH 35 Samy et al Figure 4 17β-HSD 5AR ARO II IV V 600 bp 400 bp 300 bp S TH S TH S TH S TH S TH Proestrus 17β-HSD 5AR II ARO IV V 600 bp 400 bp S TH S TH S TH S TH S TH OVX 36 Samy et al Figure 5 ER-α 600 bp 600 bp ER-β S TH S Proestrus (P) TH OVX Relative band intensity 100 S TH 80 60 * 40 * 20 0 P OVX ER-α P OVX ER-β 37 Samy et al Figure 6 600 bp TH IL-2 expression Relative band intensity Proestrus S TH OVX 100 S TH 80 60 40 20 0 S TH Proestrus TH IL-6 expression Relative band intensity 100 80 TH OVX S TH 60 40 0 * S TH Proestrus S TH OVX * 100 0 Proestrus S * 20 200 OVX IL-6 S S TH S TH 600 bp Proestrus 300 S TH IL-6 release, units/mg protein S IL-2 release, units/mg protein IL-2 S TH OVX S TH 300 * 150 0 S TH Proestrus S TH OVX 38 Samy et al Figure 7 Metabolism of 17β-estradiol in T lymphocytes Aromatase 4-Androstenedione Estrone 17β-HSD R O O R 17β-HSD Testosterone 17β-Estradiol Aromatase 5AR 5α-Dihydrotestosterone