Download Diminished Basal Phosphorylation Level of Phospholamban in the

Diminished Basal Phosphorylation Level of Phospholamban
in the Postinfarction Remodeled Rat Ventricle
Role of b-Adrenergic Pathway, Gi Protein, Phosphodiesterase,
and Phosphatases
Boyu Huang, Su Wang, Dayi Qin, Mohamed Boutjdir, Nabil El-Sherif
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Abstract—Three weeks after myocardial infarction (MI) in the rat, remodeled hypertrophy of noninfarcted myocardium is
at its maximum and the heart is in a compensated stage with no evidence of heart failure. Our hemodynamic
measurements at this stage showed a slight but insignificant decrease of 1dP/dt but a significantly higher left ventricular
end-diastolic pressure. To investigate the basis of the diastolic dysfunction, we explored possible defects in the
b-adrenergic receptor–Gs/i protein–adenylyl cyclase– cAMP–protein kinase A–phosphatase pathway, as well as
molecular or functional alterations of sarcoplasmic reticulum Ca21-ATPase and phospholamban (PLB). We found no
significant difference in both mRNA and protein levels of sarcoplasmic reticulum Ca21-ATPase and PLB in post-MI left
ventricle compared with control. However, the basal levels of both the protein kinase A–phosphorylated site (Ser16) of
PLB (p16-PLB) and the calcium/calmodulin– dependent protein kinase-phosphorylated site (Thr17) of PLB (p17-PLB)
were decreased by 76% and 51% in post-MI myocytes (P,0.05), respectively. No change was found in the
b-adrenoceptor density, Gsa protein level, or adenylyl cyclase activity. Inhibition of phosphodiesterase and Gi protein
by Ro-20-1724 and pertussis toxin, respectively, did not correct the decreased p16-PLB or p17-PLB levels. Stimulation
of b-adrenoceptor or adenylyl cyclase increased both p16-PLB and p17-PLB in post-MI myocytes to the same levels
as in sham myocytes, suggesting that decreased p16-PLB and p17-PLB in post-MI myocytes is not due to a decrease
in the generation of p16-PLB or p17-PLB. We found that type 1 phosphatase activity was increased by 32% (P,0.05)
with no change in phosphatase 2A activity. Okadaic acid, a protein phosphatase inhibitor, significantly increased
p16-PLB and p17-PLB levels in post-MI myocytes and partially corrected the prolonged relaxation of the [Ca21]i
transient. In summary, prolonged relaxation of post-MI remodeled myocardium could be explained, in part, by altered
basal levels of p16-PLB and p17-PLB caused by increased protein phosphatase 1 activity. (Circ Res. 1999;85:848-855.)
Key Words: phospholamban n phosphatase n postmyocardial infarction n sarcoplasmic reticulum
A
The SR plays a critical role in the regulation of cytosolic
Ca21 concentrations and thus, excitation-contraction coupling
in adult myocardium. The release and reuptake of Ca21 by the
SR is tightly regulated in mammalian heart and is critical for
systolic and diastolic function. Contraction is mediated
through the release of Ca21 from the SR, whereas relaxation
involves the active reuptake of Ca21 into the SR lumen by SR
Ca21-ATPase (SERCA2). In cardiac muscle, SERCA2 is
under reversible regulation by phospholamban (PLB). Dephosphorylated PLB inhibits the affinity of the SERCA2 for
Ca21 and phosphorylation relieves the inhibitory effects.9,10
The mRNA levels for PLB and SERCA2 have been reported
to be reduced in failing human11–13 and rat14 hearts. However,
controversy exists regarding the corresponding protein levels.15–19 It is conceivable that the abnormality could be caused
by functional alterations in PLB and SERCA2 in the failing
fter myocardial infarction (MI), the heart undergoes a
remodeling process characterized by significant hypertrophy of the noninfarcted myocardium.1– 4 The process is
adaptive in nature and primarily represents a universal response of the heart to systolic or diastolic overload from
whatever cause. After a stage of compensated hypertrophy,
heart failure may ensue. Heart failure is characteristically
associated with systolic and diastolic dysfunction. The contraction duration is prolonged, and relaxation abnormalities
occur in patients with heart failure.5,6 These changes are
accompanied by prolonged [Ca21]i transients in isolated
ventricular myocytes from failing hearts.6,7 The prolonged
diastolic decay of the transient in heart failure is most
probably a result of reduced Ca21 uptake or storage by the
sarcoplasmic reticulum (SR).8 At present the biochemical
mechanisms for this defect are controversial.
Received July 30, 1999; accepted August 19, 1999.
From the Cardiology Division (B.H., D.Q., M.B., N.E.-S.), Department of Medicine, State University of New York Health Science Center and Veterans
Affairs Medical Center, Brooklyn, NY, and Laboratory of Cardiovascular Science (S.W.), Gerontology Research Center, National Institute on Aging,
NIH, Baltimore, Md.
Correspondence to Nabil El-Sherif, Cardiology Division, Box 1199, SUNY Health Science Center, 450 Clarkson Ave, Brooklyn, NY 11203. E-mail
[email protected]
© 1999 American Heart Association, Inc.
Circulation Research is available at http://www.circresaha.org
848
Huang et al
Phosphatases and Postinfarction Remodeled Ventricle
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
ventricle without changes in their protein levels. A reduced
uptake of Ca21 into SR as well as reduced release from SR
could result entirely from reduced phosphorylation of PLB.
There is significant interest in understanding the nature of
alterations associated with the remodeling process and the
transition from an adaptive compensated hypertrophy to a
decompensated failing heart. Three weeks after MI in the rat,
remodeled hypertrophy of noninfarcted myocardium is at its
maximum, and the heart is in a compensated stage with no
evidence of heart failure.20 However, some studies have
shown that the left ventricular end-diastolic pressure may be
increased and both 1dP/dt and – dP/dt could be depressed at
this stage.20 Systolic [Ca21]i also was shown to be slightly but
significantly lower and diastolic [Ca21]i higher in post-MI
myocytes.21 The molecular and biochemical bases of these
alterations are not known. The present study was designed to
investigate possible defects in the b-adrenergic receptor–Gs/i
protein–adenylyl cyclase– cAMP–protein kinase A (PKA)–
phosphatase pathway as well as molecular or functional
alterations of SERCA2 and PLB at the stage of compensated
hypertrophy of the post-MI rat heart. These data may provide
insight into the nature of early alterations associated with the
attempt of the heart to adapt to an increased workload and the
possible negative consequences of some of these adaptive
mechanisms.
849
Western Blot Analysis
Myocyte suspensions were briefly spun down, and the pellets were
solubilized in 23 Laemmli buffer.26 Protein concentration was
determined according to Bradford.27 Immunoblot detection was
accomplished by following the manufacturer’s instructions (Tropix,
Inc, or NEB Labs, Inc).
Preparation of RNA From Ventricular Muscle
Total RNA was extracted from left ventricle using standard
protocol.28
Construction of DNA Templates
DNA templates were prepared by subcloning cDNA fragments into
pCRII (Invitrogen). The cDNA fragments were prepared by reverse
transcriptase–polymerase chain reaction from total cellular RNA
isolated from normal rat heart. For each template, the following
sequences were used as primers: PLB 320 bp (nucleotides 21 to
34029 ) forward, GTCTGCATTGTGACGATCAC, and reverse,
AGGTCTGCGGTGGCGACAGC, and SERCA2 260 bp (nucleotides 2281 to 254030 ) forward, TCCTTTGATGAGATCACAGC,
and reverse, GCCGTCAGGAAGATACAGAC. Internal control
used was a cDNA fragment of cyclophilin31 (nucleotides 38 to 142)
from Ambion.
RNase Protection Assay
RNase protection assays were performed as previously described.32
Preparation of Left Ventricular
Membrane Vesicles
Membrane vesicles were prepared as described by Neumann et al.33
Protein Phosphatase Activity Assay
Materials and Methods
Materials
Anti-Gas and -Gai polyclonal antibodies were from Santa Cruz
Biotechnology. Anti-SERCA2 monoclonal antibody was from
Affinity Bioreagents, Inc. The polyclonal antibodies PS-16 and
PT-17 and monoclonal antibody A1 were obtained from
PhosphoProtein Research.
Experimental Model
Sprague-Dawley rats weighing 200 to 250 g underwent either
coronary ligation or sham operation as previously described.22 The
rats were studied 3 weeks after operation. Measurements were made
for heart rate; systolic, diastolic, and mean systemic pressure; and
left ventricular end-diastolic pressure (LVEDP), and the maximal
dP/dt was determined by averaging 10 consecutive cycles.
Preparation of Isolated Cardiac Myocytes
Ventricular myocytes from adult rats were isolated by collagenase
digestion as described previously.22 Some of the freshly isolated
myocytes from sham and post-MI rats were preincubated with the
phosphodiesterase (PDE) inhibitor Ro-20-1724 (0.7 mmol/L) alone
or plus isoproterenol (50 nmol/L) or forskolin (1 mmol/L) for 10
minutes at room temperature, with 1 mg/mL pertussis toxin (PTX)
for 3 hours at 37°C and with 0.5 mmol/L okadaic acid (OA) for 30
minutes at room temperature.
Radioligand Binding Assay
Cell surface b-adrenergic receptors were quantified as previously
described.23–25
cAMP Determination
The procedure for extraction of cAMP from myocyte suspensions
and cAMP quantitative enzyme immunoassay kit (EIA system) were
provided by Amersham Life Science.
Assays were performed by using manufacturer’s protocol (protein
phosphatase assay system, Life Technologies). Phosphatase activity
was measured at 30°C using 32P-labeled phosphorylase a as
substrate.
Tricholoroacetic Acid (TCA) Extraction and Assay
of Phosphatase Inhibitor Activity
TCA extract enriched in phosphatase inhibitors 1 and 2 was isolated
from left ventricular myocardium, and the phosphatase inhibitor
activity in extracts was measured as described by Ahmad et al.34
Measurement of [Ca21]i Transient
[Ca21]i transient in myocytes from sham and post-MI rats was
measured as described by Spurgeon et al.35 The sampling rate was 5
milliseconds. Data were not filtered.
Statistical Analysis
Data are expressed as mean6SEM. Comparisons between sham and
post-MI myocardium were performed by Student nonpaired t test. A
value of P,0.05 was accepted as statistically significant.
An expanded Materials and Methods section is available online at
http://www.circresaha.org.
Results
Hemodynamic Characterization
Hemodynamic measurements were taken before the heart was
removed. There was no significant difference between sham
and post-MI rats regarding heart rate (sham, 319620 bpm;
post-MI, 325618 bpm), systolic blood pressure (sham,
115612 mm Hg; post-MI, 112610 mm Hg), and mean systemic pressure (sham, 105610 mm Hg; post-MI,
10269 mm Hg). The 1dP/dt was slightly decreased in
post-MI rats compared with sham rats, but the difference was
not statistically significant (sham, 10 20061800 mm Hg per
second; post-MI, 910061500 mm Hg per second). On the
850
Circulation Research
October 29, 1999
Figure 2. Adenylyl cyclase activity in isolated myocytes from
sham-operated (n58) and post-MI (n58) rats. Data are
mean6SEM (n58). Ro indicates Ro-20-1724; Iso, isoproterenol;
and Forskl, forskolin.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Figure 1. A, Representative Western blot analysis of Gsa and Gia
in sham (n58) and post-MI (n58) rat myocardium. B, Densitometric analysis of Western blot. Data are mean6SEM protein
levels normalized to sham values. *P,0.03 compared with
sham.
other hand, the LVEDP was significantly higher in post-MI
compared with sham rats, (sham, 2.660.4 mm Hg; post-MI,
6.161.3 mm Hg; P,0.05).
b-Adrenergic Receptor Density
(n58) units in post-MI (Figure 2) myocytes. Figure 2 also
shows no change in cAMP concentration in post-MI (n58)
compared with sham (n58) myocytes after inhibition of PDE
by Ro-20-1724 (5.860.4 sham versus 6.160.5 pmol/mg
post-MI), Ro-20-1724 plus isoproterenol (12.361.6 sham
versus 11.361.7 pmol/mg post-MI), or Ro-20-1724 plus
forskolin (416622 sham versus 440630 pmol/mg post-MI)
for 10 minutes.
PLB and SERCA2 mRNAs Levels
Figure 3 shows the results of RNase protection assay of PLB
and SERCA2 gene expression in sham as well as post-MI
To determine whether changes of b-adrenergic receptor
density occur in isolated 3-week-post-MI myocytes, receptor
binding assays were performed. Cell-surface b-adrenergic
receptors were quantified using the hydrophilic ligand
[3H]CGP-12177, which specifically labels cell-surface receptors.23 The binding data from 5 sham and 5 post-MI rat hearts
were analyzed with a nonlinear least-squares method. The
b-adrenergic receptor density was significantly increased
from 13.660.3 to 20.660.7 fmol/105 cells (P,0.05) in sham
(n58) and post-MI (n58) myocytes, respectively. However,
the b-adrenergic receptor densities normalized to protein
concentrations showed no significant change between sham
and post-MI myocytes (14.060.6 fmol/mg sham versus
13.660.9 fmol/mg post-MI; NS). The affinity (Kd) of the
receptor for the radioligand in the myocytes was also not
affected after MI (41.262.3 pmol sham versus 38.962.1
pmol post-MI; NS).
Gai and Gas Protein Densities
Figure 1 shows results of Western blot analysis of Gai and Gas
protein levels. Compared with sham, Gai immunoreactivity
was significantly increased by 55% (P,0.03, n58), whereas
Gas protein level was found unchanged in 3-week-post-MI
myocytes.
Adenylyl Cyclase Activity
The cAMP EIA system was used to measure the cAMP
contents in myocytes with or without stimulation. The basal
activity of adenylyl cyclase was unmodified, being 4.260.3
(n58) pmol cAMP per mg protein in sham and 4.360.3
Figure 3. Expression of SERCA2 and PLB genes in the post-MI
myocardium. A, Representative RNase protection assay
obtained with total RNA isolated from the left ventricle of sham
(n56) and post-MI (n56) rats. Each lane contains 10 mg of total
RNA. B, Densitometric analysis of RNase protection assay. Data
are mean6SEM mRNA levels (in arbitrary units) normalized to
cyclophilin mRNA values.
Huang et al
Phosphatases and Postinfarction Remodeled Ventricle
851
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Figure 4. A, Representative Western blot analysis of PLB and
SERCA2 in sham (n56) and post-MI (n56) rat myocardium. B,
Densitometric analysis of Western blot. Data are mean6SEM
protein levels normalized to sham values.
myocardium. Compared with sham, both PLB and SERCA2
mRNA levels showed no significant difference in post-MI
myocardium.
PLB and SERCA2 Protein Levels
Figure 4 shows the results of Western blot of PLB and
SERCA2 protein levels in sham and post-MI myocardium.
No significant difference was found between sham and
post-MI in the protein levels of PLB or SERCA2.
PLB Phosphorylation
Figure 5 compares the level of phosphorylated PLB and total
PLB in sham and post-MI myocytes. The antibody p-16 that
recognizes phosphorylated Ser16 in PLB, which is known to
be the main phosphorylation site by PKA, was used. After a
second antibody and luminescent detection, the membrane
was stripped and relabeled with antibody A1, which recognizes total PLB (Figure 5A). There was no change in the level
of total PLB, but there was a 76% (P,0.05, n56) decrease in
the basal level of p16-PLB in post-MI myocytes. The level of
p16-PLB was only slightly corrected by Ro-20-1724 alone.
However, the addition of forskolin or isoproterenol increased
the p16-PLB in post-MI to the same level as sham (Figure
5B). Similarly, the basal level of p17-PLB was also found to
be significantly decreased (51%, P,0.05) in post-MI (n56)
compared with sham myocytes (n56), and the addition of
forskolin or isoproterenol increased the p17-PLB level in
post-MI to the same level as in sham (Figure 6). Taken
together, these results further support the intact function in
dissociated myocytes.
Figure 5. A, Representative Western blot analysis of p16-PLB and
total PLB protein levels in isolated sham (S; n56) and post-MI (M;
n56) myocytes. B, Densitometric analysis of Western blot. Data
are mean6SEM p16-PLB levels (in arbitrary units) normalized to
basal sham values. *P,0.05 compared with basal sham. Ro indicates Ro-20-1724; Iso, isoproterenol; and Forsk, forskolin.
fore, compared phosphatase 1 and 2A activities in membrane
vesicle preparations from sham and post-MI rat left ventricles. Figure 7A shows the results of assays of protein
phosphatase activities using radiolabeled phosphorylase a as
substrate. Types 1 and 2A were differentiated in the presence
Phosphatase Activities
Activators of phosphatases can dephosphorylate PLB and
exert a negative inotropic effect.36 Type 1 and 2A phosphatases are the main phosphatases of the myocardium,37 and
both phosphatases can dephosphorylate PLB.38 We, there-
Figure 6. A, Representative Western blot analysis of p17-PLB in
isolated sham (n56) and post-MI (n56) myocytes. B, Densitometric
analysis of Western blot. Data are mean6SEM p17-PLB levels (in
arbitrary units) normalized to basal sham values. *P,0.05 compared with basal sham. Abbreviations as in Figure 5 legend.
852
Circulation Research
October 29, 1999
Figure 7. A, Phosphatase activity in preparations (membrane
vesicles) from sham (n56) and post-MI (n56) hearts. One unit
was 2.8 mU/mg membrane protein. PP indicates protein phosphatase. *P,0.05 compared with sham. B, Effects of TCA
extract (8 mg) enriched in phosphatase inhibitors 1 and 2 from
sham and post-MI myocardium on purified phosphatase 1
activity.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
of 10 nmol/L OA.39 The type 1 phosphatase activity was
significantly increased by 32% in post-MI compared with
sham myocytes (P,0.05, n56), and there was no change in
the type 2A phosphatase activity (Figure 7A). Figure 7B
demonstrates that the acid extract enriched in phosphatase
inhibitors 1 and 2 showed no difference in inhibition of
purified phosphatase 1 activity.
Effects of Gi Protein, PDE, and Protein
Phosphatase on Phosphorylation of PLB
We used PTX, Ro-20-1724, and 0.5 mmol/L OA to block Gi
protein, PDE, and protein phosphatase activities, respectively, to study their effects on the levels of p16-PLB and
p17-PLB in 3-week-post-MI myocytes. The results of these
experiments are illustrated in Figures 8 and 9. In Figure 8, OA
alone or in combination with Ro-20-1724 significantly in-
Figure 9. A, Representative Western blot analysis of effects of
PTX, Ro-20-1724 (RO), and OA on p17-PLB in isolated post-MI
myocytes (n56). B, Densitometric analysis of Western blot. Data
are mean6SEM p17-PLB levels (in arbitrary units) normalized to
basal values. *P,0.05 compared with basal.
creased the level of p16-PLB in post-MI myocytes by 2.3 to
8.4 times the basal level (P,0.05, n56), respectively. Lesser
changes were seen with PTX alone or PTX plus Ro-20-1724.
Figure 9 shows that OA alone as well as in combination with
Ro-20-1724 significantly increased the p17-PLB in post-MI
myocytes by 10 times. Lesser effects were also seen with
PTX plus Ro-20-1724. No significant changes were found in
both p16- and p17-PLB levels when a low dose of OA (10
nmol/L) was used (data not shown).
[Ca21]i Transient in Sham and Post-MI Myocytes
We further compared the changes of [Ca21]i transient in sham
and post-MI myocytes before and after incubation with 10
nmol/L and 0.5 mmol/L of OA. Figure 10 shows transients
recorded from a sham and a post-MI myocyte before and after
incubation with OA. Data from 6 sham (n517 cells) and 6
post-MI (n524 cells) myocyte preparations are summarized in
Figure 8. A, Representative Western blot analysis of effects of
PTX, Ro-20-1724 (Ro), and OA on p16-PLB in isolated post-MI
myocytes (n56). B, Densitometric analysis of Western blot. Data
are mean6SEM p16-PLB levels (in arbitrary units) normalized to
basal values. *P,0.05 compared with basal.
Figure 10. Representative [Ca21]i transients recorded from a
sham and a post-MI myocyte before and after incubation with
10 nmol/L and 0.5 mmol/L of OA. Stimulation rate was 0.5 Hz.
Huang et al
Phosphatases and Postinfarction Remodeled Ventricle
853
Effects of OA on T50 of [Ca21]i Transient Recorded From 6 Sham and 6 Post-MI Myocyte Preparations
Sham (n517)
T50, ms
Post-MI (n524)
Before OA
After OA (10 nmol/L)
After OA (0.5 mmol/L)
Before OA
After OA (10 nmol/L)
After OA (0.5 mmol/L)
204615
205610
210619
261611*
257613
240610†
*P,0.005 between sham and post-MI before OA; †P,0.01 between before OA and after OA in post-MI.
the Table. Half time of relaxation (T50) was found significantly
prolonged in post-MI myocytes compared with sham myocytes
(P,0.005). After a 30-minute incubation with 0.5 mmol/L of
OA, T50 of the relaxation time significantly shortened in post-MI
myocytes (P,0.01) but remained prolonged compared with
sham myocytes. On the other hand, OA had no significant effect
on T50 of sham myocytes. Also, no significant change of T50 was
found in post-MI myocytes after incubation of 10 nmol/L of OA
compared with before OA.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Discussion
Three weeks after MI, the heart is in a compensated stage
with remodeled hypertrophy of noninfarcted myocardium.
However, abnormalities of the diastolic function could be
detected in vivo as increased LVEDP20 and in vitro as an
increased diastolic [Ca21]i.21 Our findings of prolonged relaxation of the Ca21 transient in post-MI remodeled myocytes is
consistent with those observations and suggest a reduced
SERCA2 activity.12 We have shown that the reduction in
SERCA2 activity at this stage was not a result of altered gene
expression and protein levels of SERCA2 and its regulatory
protein PLB, but it was a result of decreased basal levels of
both p16-PLB and p17-PLB. A recent study has shown that
phosphorylation of Ser16 is a prerequisite for Thr17 phosphorylation in PLB, and prevention of phosphoserine formation results in attenuation of the b-agonist stimulatory responses in the mammalian heart.40 Reduced p-PLBs are
expected to increase the inhibitory effect of PLB on
SERCA2. In principle, the reduction in p-PLBs can result
either from a diminished cAMP content or an increased
activity of protein phosphatases. We have shown that the
reduced p-PLBs were not caused by significant abnormalities
of the b-adrenergic receptor–G protein–adenylyl cyclase–
cAMP–PKA complex, because stimulation of b-adrenergic
receptor, Gs protein, or adenylyl cyclase could increase the
level of p-PLBs in post-MI myocytes to the same level as in
sham myocytes. Further, no changes were found in the
b-adrenergic receptor density, Gsa protein expression level,
and adenylyl cyclase activity. Our findings that Gi protein
level was significantly increased in 3-week-post-MI myocardium and that PTX, in combination with Ro-20-1724, can
slightly but significantly increase the PLB phosphorylation
levels indicated that an increased Gi level may play a role in
post-MI hypertrophied myocardium. Gi protein was found to
be increased in rat heart as early as 4 weeks after MI,41 in
pacing-induced heart failure in dogs,42 and in human heart
failure.43 An increased Gi protein level could alter activity of
the catalytic subunit of adenylyl cyclase and result in an
increased level of inhibition of adenylyl cyclase activity.
Further, Gi protein stimulation could enhance phosphatase
activity via inhibitor-1.44,45 Our results seem to support the
latter mechanism, given that we found no change in adenylyl
cyclase activity in post-MI compared with sham myocytes.
However, the slight but significant increase of p-PLB levels
in post-MI myocytes after incubating with PTX suggests that,
besides Gi protein alteration, additional defects exist in
post-MI myocytes.
Our results strongly suggest that the decreased basal
p16-PLB and p17-PLB levels in our animal model were
mainly a result of the enhanced activity of type 1 phosphatase
that dephosphorylates p16-PLB and p17-PLB. Type 1 phosphatase has been reported to be capable of dephosphorylating
membrane-associated PLB when it is phosphorylated by
PKA.38,46,47 Further evidence that supports this hypothesis is
our finding that 0.5 mmol/L of OA, a protein phosphatase
inhibitor, dramatically increased p16-PLB as well as p17PLB levels in post-MI myocytes. This is one more indication
that the PLB phosphorylation process in compensated
post-MI myocardium is essentially normal. The same dose of
OA also partially corrected the prolonged relaxation of the
Ca21 transient. However, PLB is only one of the phosphoproteins contributing to the accelerated relaxation of the Ca21
transient.
It is important to emphasize the advantage of the use of
dissociated myocytes rather than myocardial homogenates in
the study of the b-adrenergic receptor–Gs/i protein–adenylyl
cyclase– cAMP–PKA pathway in the post-MI remodeled
hypertrophied myocardium. Tissue homogenates inevitably
include other cell types besides myocytes. This is especially
important when comparing normal and diseased myocardium,
because nonmyocyte structures are also altered after MI.48
Further, using hydrophilic radioactive probe in b-adrenergic
receptor binding assays on isolated myocytes would allow the
quantification of receptor density exclusively on the extracellular membrane of intact cell, an effective approach to
compare diseased and normal myocardium.24
The role of PLB in the regulation of basal myocardial
contractility has been recently elucidated through the generation of a PLB-deficient mouse model.49 Ablation of PLB
was associated with a significant increase in intraventricular
pressure and in the rates of contraction and relaxation,
assessed in isolated work-performing heart preparations.49
The elevated contractile parameters in PLB-deficient hearts
could not be further stimulated with isoproterenol.49 These
findings demonstrated that PLB is a repressor of left ventricular basal contractile parameters, and alterations in the levels
of PLB would be expected to result in alterations in myocardial contractility. The rates of phosphorylation/dephosphorylation reactions on PLB appear to be faster than those of other
phosphoproteins. PLB has been shown to be phosphorylated
in vivo, and the resulting stimulatory effects on SR Ca21
transport have been suggested to be a prominent mediator of
854
Circulation Research
October 29, 1999
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
the b-adrenergic responses in the mammalian heart.50 –52 The
function of PLB during catecholamine stimulation of the
heart suggests a role for this protein as an internal “brake
mechanism.”53 Ser16 of PLB is the first and main site to be
phosphorylated in response to an increase in cAMP levels
during b-agonist administration, followed by an increase in
the activity of the cardiac SR Ca21 transport system and
increased rate of cardiac relaxation.51,54,55
In addition to phosphorylation of PLB, myocardial SR
possesses phosphatase activity capable of dephosphorylating
PLB. SR-associated “PLB phosphatase” has been shown to
be inhibited by inhibitor-1,46 which is very similar to protein
phosphatase 1.38,46 In addition to activation of PKA through
augmentation of cAMP, b-agonist may also exert its effect on
augmenting cardiac contractility by phosphorylation of protein phosphatase inhibitor-1.56 A decrease in type 1 protein
phosphatase activity through phosphorylation of phosphatase
inhibitor-1 is expected to further augment the effects of
b-agonist. Our findings that isoproterenol and forskolin can
increase both p16-PLB and p17-PLB levels in post-MI
myocytes to the same levels in sham could be explained by
their inhibitory effects on phosphatases by phosphorylating
protein phosphatase inhibitor-1.
In summary, the present study has shown that alterations in
diastolic function develop much earlier in the post-MI remodeled rat heart and well before the onset of overt heart failure.
The prolonged relaxation of post-MI remodeled myocytes
was due to decreased basal levels of both p16- and p17-PLB.
The latter could be explained, in part, by increased type 1
protein phosphatase activity. However, other factors, including increase of Gi, could also be involved.
Acknowledgments
This work was supported by Veteran Affairs Medical Research
Funds (in part by VA MERIT grant to N.E.-S.).
References
1. Anversa P, Beghi C, Kikkawa Y, Olivetti G. Myocardial infarction in rats.
Infarct size, myocyte hypertrophy, and capillary growth. Circ Res. 1986;
58:26 –37.
2. Pfeffer JM, Pfeffer MA, Fletcher PJ, Braunwald E. Progressive ventricular remodeling in rat with myocardial infarction. Am J Physiol. 1991;
260:H1406 –H1414.
3. Swynghedauw B, ed. Cardiac Hypertrophy and Failure. Paris, France:
INSERM/John Libbey; 1990.
4. Gidh-Jain M, Huang B, Jain P, Gick G, El-Sherif N. Alterations in cardiac
gene expression during ventricular remodeling following experimental
myocardial infarction. J Mol Cell Cardiol. 1998;30:627– 637.
5. Morgan JP. Abnormal intracellular modulation of calcium as a major
cause of cardiac contractile dysfunction. N Engl J Med. 1991;325:
625– 632.
6. Gwathmey JK, Copelas L, MacKinnon R, Schoen FJ, Feldman MD,
Grossman W, Morgan JP. Abnormal intracellular calcium handling in
myocardium from patients with end-stage heart failure. Circ Res. 1987;
61:70 –76.
7. del Monte F, O’Gara P, Poole-Wilson PA, Yacoub M, Harding SE. Cell
geometry and contractile abnormalities of myocytes from failing human
left ventricle. Cardiovasc Res. 1995;30:281–290.
8. Davies CH, Harding SE, Poole-Wilson PA. Cellular mechanisms of
contractile dysfunction in human heart failure. Eur Heart J. 1996;17:
189 –198.
9. Hicks MJ, Shigekawa M, Katz AM. Mechanism by which cyclic adenosine 39:59-monophosphate-dependent protein kinase stimulates calcium
transport in cardiac sarcoplasmic reticulum. Circ Res. 1979;44:384 –391.
10. Kim HW, Steenaart NAE, Ferguson DG, Kranias EG. Functional reconstitution of the cardiac sarcoplasmic reticulum Ca21-ATPase with phospholamban in phospholipid vesicle. J Biol Chem. 1990;265:1702–1709.
11. Feldman AM, Ray PE, Silan CM, Mercer JA, Minobe W, Bristow MR.
Selective gene expression on failing human heart: quantification of
steady-state levels of messenger RNA in endomyocardial biopsies using
the polymerase chain reaction. Circulation. 1991;83:1866 –1872.
12. Mercadier J-J, Lompré AM, Duc P, Boheler KR, Fraysse J-B, Wisnewsky
C, Allen PD, Komajda M, Schwartz K. Altered sarcoplasmic reticulum
Ca21-ATPase gene expression in the human ventricle during end-stage
heart failure. J Clin Invest. 1990;85:305–309.
13. Arai M, Alpert NR, MacLennan DH, Barton P, Periasamy M. Alterations
in sarcoplasmic reticulum gene expression in human heart failure: a
possible mechanism for alterations in systolic and diastolic properties of
the failing myocardium. Circ Res. 1992;72:463– 469.
14. Zarain-Herzberg A, Afzal N, Elimban V, Dhalla NS. Decreased
expression of cardiac sarcoplasmic reticulum Ca(21)-pump ATPase in
congestive heart failure due to myocardial infarction. Mol Cell Biochem.
1996;163–164:285–290.
15. Hasenfuss G, Reinecke H, Studer R, Meyer M, Pieske B, Holtz J,
Holubarsch C, Posival H, Just H, Drexler H. Relation between myocardial
function and expression of sarcoplasmic reticulum Ca21-ATPase in
failing and nonfailing human myocardium. Circ Res. 1994;75:434 – 442.
16. Movsesian MA, Karimi M, Green K, Jones LR. Ca21-transporting
ATPase, phospholamban and calsequestrin levels in nonfailing and failing
human heart. Circulation. 1994;90:653– 657.
17. Linck B, Boknı́k P, Eschenhagen T, Müller FU, Neumann J, Nose M,
Jones LR, Schmitz W, Scholz H. Messenger RNA expression and immunological quantification of phospholamban and SR-Ca21-ATPase in
failing and nonfailing human hearts. Cardiovasc Res. 1996;31:625– 632.
18. Munch G, Bolch B, Hoischen S, Brixius K, Bloch W, Reuter H,
Schwinger RH. Unchanged protein expression of sarcoplasmic reticulum
Ca21-ATPase, phospholamban, and calsequestrin in terminally failing
human myocardium. J Mol Med. 1998;76:434 – 441.
19. Schwinger RH, Bohm M, Schmidt U, Karczewski P, Bavendiek U, Flesch
M, Krause EG, Erdmann E. Unchanged protein levels of SERCA II and
phospholamban but reduced Ca21 uptake and Ca(21)-ATPase activity of
cardiac sarcoplasmic reticulum from dilated cardiomyopathy patients
compared with patients with nonfailing hearts. Circulation. 1995;92:
3220 –3228.
20. Pfeffer JM, Pfeffer MA, Fletcher PJ, Braunwald E. Ventricular performance in rats with myocardial infarction and failure. Am J Med. 1984;
76:99 –103.
21. Zhang XQ, Moore RL, Tenhave T, Cheung JY. [Ca21]i transients in
hypertensive and postinfarction myocytes. Am J Physiol. 1995;269:
C632–C640.
22. Qin D, Zhang ZH, Caref EB, Boutjdir M, Jain P, El-Sherif N. Cellular and
ionic basis of arrhythmias in postinfarction remodeled ventricular myocardium. Circ Res. 1996;79:461– 473.
23. Stachelin M, Hertel C. [3H]CGP-12177, a beta-adrenergic ligand suitable
for measuring cell surface receptors. J Recept Res. 1983;3:35– 43.
24. Horackova M, Wilkinson M. Characterization of cell-surface
b-adrenergic ([3H]CGP-12177) binding in adult rat ventricular myocytes:
lack of regulation by b-agonists at physiological concentrations. Pflügers
Arch. 1992;421:440 – 446.
25. Munson PJ, Rodbard D. Ligand, a versatile computerized approach for
characterization of ligand-binding systems. Anal Biochem. 1980;107:
220 –239.
26. Laemmli UK. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature. 1970;227:680 – 685.
27. Bradford MM. A rapid and sensitive method for quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding. Anal Biochem. 1976;72:248 –254.
28. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem.
1987;162:156 –159.
29. Hwang KS, Nadal-Ginard B. Cloning phospholamban cDNA from rat
aortic smooth muscle. Adv Exp Med Biol. 1991;304:387–395.
30. Lompré AM, de la Bastie D, Boheler KR, Schwartz K. Characterization
and expression of the rat heart sarcoplasmic reticulum Ca21-ATPase
mRNA. FEBS Lett. 1989;249:35– 41.
31. Danielson P, Forss-Petter S, Brow M, Calavette L, Douglass J, Milner R,
Sutcliffe J. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin.
DNA. 1988;7:261–267.
Huang et al
Phosphatases and Postinfarction Remodeled Ventricle
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
32. Gidh-Jain M, Huang B, Jain P, El-Sherif N. Differential expression of
voltage-gated K1 channel genes in left ventricular remodeled myocardium after experimental myocardial infarction. Circ Res. 1996;79:
669 – 675.
33. Neumann J, Gupta RC, Schmitz W, Scholz H, Nairn AC, Watanabe AM.
Evidence for isoproterenol-induced phosphorylation of phosphatase inhibitor-1 in the intact heart. Circ Res. 1991;69:1450 –1457.
34. Ahmad Z, Green FJ, Subuhi HS, Watanabe AM. Autonomic regulation of
type 1 protein phosphatase in cardiac muscle. J Biol Chem. 1989;264:
3859 –3863.
35. Spurgeon HA, Stern MD, Baartz G, Raffaeli S, Hansford RG, Talo A,
Lakatta EG, Capogrossi MC. Simultaneous measurement of Ca21, contraction, and potential in cardiac myocytes. Am J Physiol. 1990;258:
H574 –H586.
36. Zimmermann N, Boknik P, Gams E, Gsell S, Jones LR, Maas R,
Neumann J, Scholz H. Mechanisms of the contractile effects of 2,3butanedione-monoxime in the mammalian heart. Naunyn Schmiedebergs
Arch Pharmacol. 1996;354:431– 436.
37. Wera S, Hemmings BA. Serine/threonine protein phosphatases. Biochem
J. 1995;311(Pt 1):17–29.
38. MacDougall LK, Jones LR, Cohen P. Identification of the major protein
phosphatases in mammalian cardiac muscle which dephosphorylate phospholamban. Eur J Biochem. 1991;196:725–734.
39. Neumann J, Eschenhagen T, Jones LR, Linck B, Schmitz W, Scholz H,
Zimmermann N. Increased expression of cardiac phosphatases in patients
with end-stage heart failure. J Mol Cell Cardiol. 1997;29:265–272.
40. Luo W, Chu G, Sato Y, Zhou Z, Kadambi VJ, Kranias EG. Transgenic
approaches to define the functional role of dual site phospholamban
phosphorylation. J Biol Chem. 1998;273:4734 – 4739.
41. Kompa AR, Gu Xh, Evans BA, Summers RJ. Desensitization of cardiac
beta-adrenoceptor signaling with heart failure produced by myocardial
infarction in the rat: evidence for the role of Gi but not Gs or phosphorylating proteins. J Mol Cell Cardiol. 1999;31:1185–1201.
42. Vatner DE, Sato N, Galper JB, Vatner SF. Physiological and biochemical
evidence for coordinate increases in muscarinic receptors and Gi during
pacing-induced heart failure. Circulation. 1996;94:102–107.
43. Feldman AM, Cates AE, Veazey WB, Hershberger RE, Bristow MR,
Baughman KL, Baumgartner WA, Van Dop C. Increase of the
40,000-mol wt pertussis toxin substrate (G protein) in the failing human
heart. J Clin Invest. 1988;82:189 –197.
44. Gupta RC, Neumann J, Watanabe AM, Sabbah HN. Muscariniccholinoceptor mediated attenuation of phospholamban phosphorylation
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
855
induced by inhibition of phosphodiesterase in ventricular cardiomyocytes: evidence against a cAMP-dependent effect. Mol Cell Biochem.
1998;187:155–161.
Gupta RC, Neumann J, Watanabe AM. Comparison of adenosine and
muscarinic receptor-mediated effects on protein phosphatase inhibitor-1
activity in the heart. J Pharmacol Exp Ther. 1993;266:16 –22.
Steenart NAE, Ganim JR, Di Salvo JD, Kranias EG. The phospholamban
phosphatase associated with cardiac sarcoplasmic reticulum is a type 1
enzyme. Arch Biochem Biophys. 1991;297:17–24.
Sulakhe PV, Vo XT, Morris TE, Pato MD, Khandelwal RL. Protein
phosphorylation in rat cardiac microsomes: effects of inhibitors of protein
kinase A and of phosphatases. Mol Cell Biochem. 1997;175:109 –115.
Yamamoto J, Ohyanagi M, Morita M, Iwasaki T. Beta-adrenoceptor-G
protein-adenylate cyclase complex in rat hearts with ischemic heart
failure produced by coronary artery ligation. J Mol Cell Cardiol. 1994;
26:617– 626.
Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy JJ, Doetschman
T, Kranias EG. Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of
b-agonist stimulation. Circ Res. 1994;75:401– 409.
Kranias EG, Solaro RJ. Phosphorylation of troponin I and phospholamban during catecholamine stimulation of rabbit heart. Nature. 1982;
298:182–184.
Lindemann JP, Jones LR, Hathaway DR, Henry BG, Watanabe AM.
b-Adrenergic stimulation of phospholamban phosphorylation and Ca21ATPase activity in guinea pig ventricles. J Biol Chem. 1983;258:
464 – 471.
Wegner AD, Simmerman HKB, Lindemann JP, Jones LR. Phospholamban phosphorylation in intact ventricles. J Biol Chem. 1989;264:
11468 –11474.
Koss KL, Kranias EG. Phospholamban: a prominent regulator of myocardial contractility. Circ Res. 1996;79:1059 –1063.
Mundina de Weilenmann C, Vittone L, deCingolani G, Mattiazi A.
Dissociation between contraction and relaxation: the possible role of
phospholamban phosphorylation. Basic Res Cardiol. 1987;82:507–516.
Garvey JL, Kranias EG, Solaro RJ. Phosphorylation of C-protein,
troponin I and phospholamban in isolated rabbit hearts. Biochem J.
1988;249:709 –714.
Gupta RC, Neumann J, Watanabe AM, Lesch M, Sabbah HN. Evidence
for presence and hormonal regulation of protein phosphatase inhibitor-1
in ventricular cardiomyocyte. Am J Physiol. 1996;270(4 pt
2):H1159 –H1164.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Diminished Basal Phosphorylation Level of Phospholamban in the Postinfarction
Remodeled Rat Ventricle: Role of β-Adrenergic Pathway, Gi Protein, Phosphodiesterase,
and Phosphatases
Boyu Huang, Su Wang, Dayi Qin, Mohamed Boutjdir and Nabil El-Sherif
Circ Res. 1999;85:848-855
doi: 10.1161/01.RES.85.9.848
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 1999 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/85/9/848
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/1999/10/25/85.9.848.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/