Download Resistance of IAPs to methylation reprogramming may provide a

© 2003 Wiley-Liss, Inc.
genesis 35:88 –93 (2003)
LETTER
Resistance of IAPs to Methylation Reprogramming May
Provide a Mechanism for Epigenetic Inheritance
in the Mouse
Natasha Lane,1 Wendy Dean,1 Sylvia Erhardt,2 Petra Hajkova,3 Azim Surani,2 Jörn Walter,3 and
Wolf Reik1*
1
Laboratory of Developmental Genetics and Imprinting, The Babraham Institute, Cambridge, UK
Wellcome Trust/Cancer Research UK Institute of Cancer and Developmental Biology, University of Cambridge,
Cambridge, UK
3
Universität des Saarlandes, Fr 8.2 Genetik, Saarbrücken, Germany
2
Received 5 August 2002; Accepted 21 September 2002
Summary: Genome-wide epigenetic reprogramming by
demethylation occurs in early mouse embryos and primordial germ cells. In early embryos many single-copy
sequences become demethylated both by active and
passive demethylation, whereas imprinted gene methylation remains unaffected. In primordial germ cells single-copy and imprinted sequences are demethylated,
presumably by active demethylation. Here we investigated systematically by bisulphite sequencing the methylation profiles of IAP and Line1 repeated sequence families during preimplantation and primordial germ cell
development. Whereas Line1 elements were substantially demethylated during both developmental periods,
IAP elements were largely resistant to demethylation,
particularly during preimplantation development. This
may be desirable in order to prevent IAP retrotransposition, which could cause mutations. In turn, this can result in the transgenerational inheritance of epigenetic
states of IAPs, which could lead to heritable epimutations of neighbouring genes through influencing their
transcriptional states. genesis 35:88 –93, 2003.
© 2003 Wiley-Liss, Inc.
Key words: DNA methylation; demethylation; IAP; epigenetic inheritance; reprogramming
INTRODUCTION
Epigenetic modifications such as DNA methylation have
important roles in genome function and stability (Bird,
2002; Ben-Porath and Cedar, 2001; Rideout et al., 2001;
Bestor, 2000; Reik et al., 2001; Surani, 2001). DNA methylation patterns are generally stable in somatic tissues
both in embryos and after birth. In mammals there are
two developmental periods, however, during which
global demethylation occurs, followed by de novo methylation several days later, generating patterns of DNA
methylation that are different from the ones before demethylation commenced (Reik et al., 2001). In primor-
dial germ cells, primarily from E11.5–12.5, demethylation occurs in all single-copy and imprinted genes
analysed so far (Kafri et al., 1992; Brandeis et al., 1993;
Lee et al., 2002; Hajkova et al., 2002). The mechanism of
demethylation is likely to be active since there is at most
a single round of DNA replication that the germ cells
undergo between the two stages. In addition, Dnmt1 the
maintenance methyltransferase is present in nuclei at
these stages, so passive demethylation is unlikely to
occur (Hajkova et al., 2002). In the zygote, the spermderived genome undergoes large-scale demethylation before DNA replication commences. This has been identified both by immunofluorescence using an antibody
against 5-methyl cytosine (Mayer et al., 2000; Dean et al.,
2001; Santos et al., 2002) and by bisulphite analysis of
single-copy sequences (Oswald et al., 2000). However,
an important difference to demethylation in germ cells is
that paternally methylated imprinted genes are exempt
from demethylation (Olek et al., 1997; Tremblay et al.,
1997). The mechanism of this active demethylation is
unknown but does not involve the candidate demethylase gene Mbd2 (Santos et al., 2002). Further demethylation in the preimplantation embryo occurs passively
during cleavage divisions and depends on DNA replication (Howlett and Reik, 1991; Rougier et al., 1998). The
likely reason for passive demethylation is that Dnmt1
protein is excluded from nuclei of cleavage embryos at
most stages (Carlson et al., 1992; Howell et al., 2001).
Again, passive demethylation does not occur to imprinted genes and the reasons for this are unknown
* Correspondence to: Wolf Reik, Laboratory of Developmental Genetics
and Imprinting, The Babraham Institute, Cambridge CB2 4AT, UK.
E-mail [email protected]
Contract grant sponsor: BBSRC and MRC.
DOI: 10.1002/gene.10168
METHYLATION REPROGRAMMING IN MOUSE DEVELOPMENT
(Reik and Walter, 2001). De novo methylation begins
after the morula stage in the inner cell mass cells of the
blastocyst and is presumably dependent upon Dnmt3a
and b (Santos et al., 2002; Okano et al., 1999).
The large-scale methylation changes detected with the
anti 5-methyl cytosine antibody presumably reflect
changes in many different regions in the genome, including in repetitive gene families and transposons. There
have been some limited studies of methylation of Line1
elements (10,000 –100,000 copies), Intracisternal A Particle elements (IAP, 1,000 copies), and centromeric satellites. High levels of overall methylation in Line1 elements have been found in mature oocytes and in sperm,
with evidence of passive demethylation from zygote to
blastocyst stage (Sanford et al., 1987; Howlett and Reik,
1991). IAP elements were also highly methylated in the
gametes with some demethylation in blastocysts
(Howlett and Reik, 1991; Walsh et al., 1998). Some
demethylation of IAP elements and Line1 elements was
also reported in primordial germ cells (Walsh et al.,
1998; Hajkova et al., 2002). However, a precise analysis
by bisulphite sequencing of these elements at various
critical stages of development is lacking. Such an analysis
is particularly important in the light of observations of
epigenetic inheritance in the mouse (Roemer et al.,
1997), which in one instance has been shown to be
mediated by an IAP element inserted in close proximity
to the agouti gene (Morgan et al., 1999). The methylation state of this individual element in primordial germ
cells and in preimplantation embryos is not known.
We designed primers for bisulphite analysis in the
5⬘LTR of the IAP genome in order to amplify a 258-bp
fragment containing up to 11 CpG dinucleotides spanning the IAP promoter, which is known to be methylation sensitive (Walsh et al., 1998). For the Line1 genome, we amplified a 5⬘ fragment of 249 bp containing
up to 9 CpGs, and a 3⬘ fragment of 485 bp containing up
to 7 CpGs (Fig. 1a). We analysed mature oocytes, sperm,
zygotes, blastocysts, and primordial germ cells of both
sexes from E11.5–E13.5, during which time dramatic
demethylation occurs in imprinted genes and singlecopy sequences (Lee et al., 2002; Hajkova et al., 2002).
ES cells and primary embryo fibroblasts (PEFs) were
analysed as representatives of early epiblast cells and
foetal somatic cells, respectively. The primordial germ
cells were isolated using an Oct4-GFP transgene and
fluorescence activated cell sorting (Hajkova et al., 2002).
Line1 elements were highly (5⬘, 98%) and moderately
(3⬘, 54%) methylated in sperm and methylation patterns
were homogeneous between different genomic copies
(each sequenced clone is assumed to have arisen from a
separate element in the genome because of the high
complexity of these elements; this is supported by many
sequence differences between individual clones; Fig. 1b,
and data not shown). Mature oocytes were moderately
(5⬘, 29%) or scarcely (3⬘, 4%) methylated, and the 5⬘
clones showed heterogeneity, suggesting different methylation patterns depending on individual sequence or
location in the genome (Fig. 1b). Zygotes and blastocysts
89
showed similar low methylation levels and patterns at
both the 5⬘ (25%, 27%) and the 3⬘ end (23%, 15%) which
were similar to those of the oocyte (29%, 4%). This
suggests that active demethylation of most of the sperm
copies has occurred in the zygote, consistent with the
large-scale demethylation in the zygote seen by immunofluorescence (Mayer et al., 2000; Dean et al., 2001;
Santos et al., 2002). The notion of active demethylation
is further supported by the fact that while most sperm
copies of Line1-5⬘ were fully methylated, none of the
zygote copies were (Fig. 1b). Not much further passive
demethylation appears to occur between the zygote and
blastocyst stages at the CpGs analysed here.
The kinetics of IAP methylation were very different
from those of the Line1 elements (Fig. 1b). As with the
Line1 elements, each sequenced clone is assumed to
have arisen from a separate element in the genome; this
is confirmed by the many sequence differences detected
in our analysis, reflecting the fact that 5⬘ and 3⬘ LTR
sequences vary between most IAP copies (Christy et al.,
1985). IAPs were highly methylated in oocytes, sperm,
and notably remained at the same level in zygotes. Thus,
most of the IAP copies in the genome do not undergo
active demethylation in the zygote. In this respect IAPs
are unusual and behave unlike single copy and Line1
sequences (which are actively demethylated) but like
the paternally methylated H19 gene (Olek et al., 1997;
Tremblay et al., 1997). IAPs and imprinted genes may,
therefore, share sequence elements or epigenetic modifications that protect them from active demethylation in
the zygote. There may be further similarities with imprinted genes which are also resistant to passive demethylation, since only a moderate decrease in methylation of
IAPs was found in blastocysts (Fig. 1b). Some demethylation had occurred in most individual copies of the IAPs,
but there were very few individual copies that were
substantially demethylated. This pattern is consistent
with active demethylation, but we cannot exclude the
possibility that Dnmt1 acts in a highly localised fashion
to maintain methylation. However a combination of passive demethylation and de novo methylation could also
give rise to these patterns. The relatively homogeneous
demethylation between individual IAP copies makes it
less likely that there are substantial differences between
inner cell mass and trophectoderm cells at this stage.
Indeed, ES cells (which are derived from inner cell mass
cells) had a very similar level of IAP methylation as
blastocysts (Fig. 3). The same is true of Line1 sequences
(Howlett and Reik, 1991).
In primordial germ cells on E11.5, both IAP and 5⬘
Line1 methylation was fairly high (74%, 65%), which for
5⬘ Line1s indicate de novo methylation in germ cell
precursors after the blastocyst stage (Fig. 2). For 5⬘
Line1s this was followed by dramatic demethylation by
E12.5 and E13.5 (to 32% and 17% for combined male and
female cells, respectively). While there was also considerable demethylation from E11.5 to E12.5 in IAPs (40%
male, 34% female), no further demethylation occurred to
E13.5, and in fact there was an indication of de novo
90
LANE ET AL.
FIG. 1. Dynamics of methylation
changes at repeat loci in germ cells
and preimplantation embryos. a: The
regions analysed by bisulphite sequencing in Line1 and IAP elements
are shown. Filled circles represent
CpG dinucleotides present in the regions analysed in Line1 repeats (accession D84391) and IAP long terminal repeats (LTRs) (accession
M17551). b: Bisulphite sequencing
profiles of Line1 5⬘, Line1 3⬘, and IAP
LTR sequences. Individual DNA
methylation profiles are shown, with
filled (methylated) and open (unmethylated) circles, following bisulphite
treatment and amplification of sperm,
oocyte, zygote, and blastocyst DNA.
Gaps in the methylation profiles represent mutated or missing CpG sites,
indicating sequence differences between individual elements. Combined results from a minimum of two
independent bisulphite treatments
are shown. The overall percentage of
methylated CpGs is shown above
each group of clones.
METHYLATION REPROGRAMMING IN MOUSE DEVELOPMENT
91
FIG. 2. Dynamics of methylation changes at repeat
loci in primordial germ cells (PGCs). Bisulphite sequencing profiles of Line1 5⬘ and IAP LTR sequences
are shown. Individual DNA methylation profiles, with
filled (methylated) and open (unmethylated) circles,
following bisulphite treatment and amplification of
⬃200 PGCs at different stages of development. E11.5
PGCs were from unsexed embryos, E12.5 and E13.5
PGCs were sexed and results are divided into male
and female groups. Gaps in the methylation profiles
represent mutated or missing CpG sites. The results
for each cell type are from combination of a minimum
of two independent bisulphite treatments. The overall
percentage of methylated CpGs is shown above each
group of clones.
methylation at least in the female PGCs (61%). Previous
analyses using Southern blotting found considerable demethylation of IAP genomes in E13.5 (Walsh et al., 1998)
and E17.5 female germ cells (Sanford et al., 1987). These
results cannot be quantitatively compared to ours because a different technique was used and the probes
used also analysed CpGs within the IAP gene body,
whereas our analysis focusses exclusively on the LTR,
whose methylation state is crucial for IAP expression.
The demethylation events from E11.5–E12.5 parallel
those observed in single-copy and imprinted genes, but
are less extensive. They are likely to occur by active
demethylation because at most one round of DNA replication occurs and even that is in the presence of Dnmt1
in the nucleus (Hajkova et al., 2002). The absence of de
novo methyltransferases Dnmt3a and b from PGCs (Hajkova et al., 2002) could also contribute to the loss of
methylation in the Line1 elements (Liang et al., 2002).
The de novo methylation of IAPs on E13.5 may indicate
that reprogramming is incomplete and brief, whereas
Line1 sequences continue to be demethylated. De novo
methylation of Line1s occurs much later during male and
female gametogenesis (Howlett and Reik, 1991).
The results of our study on Line1 and IAP methylation
at critical developmental stages are summarised in Figure
3. The most significant finding of our study is that IAP
elements are substantially resistant to epigenetic reprogramming, in contrast to many other regions in the
genome, including other retrotransposons such as Line1
elements, which are substantially demethylated during
PGC and preimplantation development. The overall resistance to demethylation of IAPs might be beneficial to
the host organism since many of these elements are
capable of retrotransposition, which would have detrimental consequences in the form of mutations. Indeed,
high-level transcriptional activation of IAP genomes has
been seen in Dnmt1 mutant mouse embryos in which
IAP genomes are demethylated (Walsh et al., 1998). In
some respects IAPs are similar to imprinted genes, in
that there is almost no reprogramming in preimplantation embryos, whereas there is some in primordial germ
cells. This may explain the parental imprinting effects
observed with some endogenous genes whose expression is influenced by nearby IAP insertions (Morgan et
al., 1999; Rakyan et al., 2002). There are, perhaps, individual IAP copies that become reprogrammed in primordial germ cells, followed by remethylation in one but not
the other germline. However, a very significant fraction
of all the IAP genomes remains substantially non-reprogrammed in primordial germ cells. This may explain the
inheritance of epigenetic states of genes such as agouti
viable yellow (Avy) in which an IAP LTR insertion leads
to ectopic expression of the agouti gene, thus leading to
the mutant phenotype. Methylation of the IAP LTR suppresses the mutant phenotype and epigenetic inheritance of state of expression of the Avy allele has been
reported through the female germline. Thus, partial resistance to reprogramming, which could differ between
male and female germline and maternal and paternal
genomes immediately after fertilisation, is likely to un-
92
LANE ET AL.
oocytes were collected from super-ovulated F1 females.
F1 zygotes (50 –100 per sample) and F1 blastocysts (3– 6
per sample) were collected from super-ovulated females
9 –10 h postfertilisation and on embryonic (E) day 4,
respectively, following in vivo fertilisation (Hogan et al.,
1986). Samples were stored in 1⫻ PBS at ⫺70°C.
Primordial germ cells (PGCs) were obtained from
whole embryonic genital ridges at different stages of
development by the use of expression from an Oct-4GFP reporter transgene, as described previously (Hajkova et al., 2002). PGCs were sorted from pooled genital ridges using a MoFlo (Cytomation Bioinstruments,
Freiberg im Breisgau, Germany) into batches of 200 cells
and stored in 1⫻ PBS at –70°C. Embryonic stages were
designated as E, where E0.5 is noon on the day of plug
detection.
Bisulphite Treatment
Isolated sperm DNA and cell samples were embedded in
agarose (1.5%) and subjected to the bisulphite treatment
followed by sequence specific PCR amplifications (Oswald et al., 2000). The PCR products were gel purified
using QiaexII (Qiagen, Chatsworth, CA), ligated into
pCR-TOPO 2.1 cloning vector (TOPO cloning kit; Invitrogen, La Jolla, CA) and transformed into TOP10 (Invitrogen) Escherichia coli cells. Positive clones were
verified by restriction analysis and the products were
sequenced using standard methods.
FIG. 3. Methylation reprogramming of repeat loci during mouse
development. The top diagram represents the overall methylation
changes that occur during mouse development. Below are representations of the methylation level of Line1 5⬘ and 3⬘ regions and
IAP LTRs at several developmental time-points. The methylation
percentages shown were obtained by combining the methylation
profiles from different treatments in bisulphite sequencing experiments and calculating an overall methylation percentage. Methylation percentages are also shown for ES cells and primary embryo
fibroblasts (PEF); these were obtained by bisulphite sequencing but
are not shown in Figs. 1 and 2.
derlie epigenetic inheritance in the case of Avy and perhaps of other alleles as well. In general, partial resistance
to reprogramming of IAP genomes would contribute
both to epigenetic inheritance and to epigenetic variability between individuals, as proposed previously
(Whitelaw and Martin, 2001). It will thus be important to
isolate additional individual IAP loci that are inserted
close to endogenous genes and study their interactions.
MATERIALS AND METHODS
Sample Preparation
Sperm were collected from C57BL6/JxCBA/Ca (F1) mice
and DNA was immediately extracted. Samples of 50 –100
Experiment Validation and Clone Selection
All PCR primers and conditions were tested for unbiased
amplification of methylated and unmethylated alleles by
comparison to Southern blots (data not shown). Sequenced clones were selected for inclusion in the analysis only if there were no more than three non-CpG
located cytosines per sequenced clone that remained
unconverted (to uracil) by the bisulphite reaction. This
equates to a conversion efficiency of at least 94% for
clones included in the analysis. In our experiments it
was generally found that no sequences had to be rejected on this basis and the level of bisulphite conversion
was extremely high. A few whole treatments were rejected due to there being an overall low level of conversion, or poor PCR amplification that could have been
due to a number of causes, including a poor preparation
of sodium bisulphite solution or excessive DNA template
degradation during the bisulphite treatment. Additionally, those clones that had the same pattern of nonconversion and an identical sequence were rejected because
they could have originated clonally. The results shown
for each cell type are a combination of at least two
individual bisulphite treatments.
Amplification of Line1 5ⴕ Regions (Accession
D84391)
Primers and conditions. F1: GTTAGAGAATTTGATAGTTTTTGGAATAGG, R1: CCAAAACAAAACCTTTCTCAAACACTATAT; F2: TAGGAAATTAGTTTGAATAGGTGAGAGGT, R2: TCAAACACTATATTACTTTAACAATT
METHYLATION REPROGRAMMING IN MOUSE DEVELOPMENT
CCCA; 1st PCR (30 cycles): F1/R1; 2nd PCR (30 cycles):
F2/R2. PCR conditions: 94°C 3 min, 94°C 1 min, 56°C 1
min (2nd PCR 56°C), 72°C 1 min, 72°C 5 min.
Amplification of Line1 3ⴕ Regions (Accession
D84391)
Primers and conditions. F1: GGATGGATTTGGAGAGTATTATTTTGAGTG, R1: TTCCAATACTATACCAAAAATCCCCCTTAC; F2: GGAGTTGAGATGAAAGGATGGATTATGTAG, R2: AATACTATACCAAAAATC
CCCCTTACCCAC; 1st PCR (30 cycles): F1/R1; 2nd PCR
(30 cycles): F2/R2. PCR conditions: 95°C 3 min, 94°C 1
min, 56°C 1 min (2nd PCR 58°C), 72°C 1 min, 72°C 5
min.
Amplification of IAP LTRs (Accession M17551)
Primers and conditions. F1: TTGATAGTTGTGTTTTAAGTGGTAAATAAA, R1: AAAACACCACAAACCAAAATCTTCTAC; F2: TTGTGTTTTAAGTGGTAAATAAATAATTTG, R2: CAAAAAAAACACACAAACCAAAAT; 1st PCR
(30 cycles) F1/R1; 2nd PCR (30 cycles): F2/R2. PCR
conditions: 94°C 3 min, 94°C 1 min, 53°C 1 min (2nd
PCR 53°C), 72°C 1 min, 72°C 5 min.
ACKNOWLEDGMENT
We thank Hugh Morgan for helpful comments on the
manuscript.
LITERATURE CITED
Ben-Porath I, Cedar H. 2001. Epigenetic crosstalk. Mol Cell 8:933–935.
Bestor TH. 2000. The DNA methyltransferases of mammals. Hum Mol
Genet 9:2395–2402.
Bird A. 2002. DNA methylation patterns and epigenetic memory.
Genes Dev 16:6 –21.
Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Razin A, Cedar H.
1993. The ontogeny of allele-specific methylation associated with
imprinted genes in the mouse. EMBO J 12:3669 –3677.
Carlson LL, Page AW, Bestor TH. 1992. Properties and localization of
DNA methyltransferase in preimplantation mouse embryos: implications for genomic imprinting. Genes Dev 6:2536 –2541.
Christy RJ, Brown, AR, Gourlie BB, Huang RC. 1985. Nucleotide sequences of murine intracisternal A-particle gene LTRs have extensive variability within the R region. Nucleic Acids Res 13:289 –302.
Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik
W. 2001. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos.
Proc Natl Acad Sci USA 98:13734 –13738.
Hajkova P, Erhardt S, Lane N, Haaf T, Reik W, Walter J, Surani MA.
2002. Epigenetic reprogramming in primordial germ cells. Mech
Dev 117:15–23.
Hogan B, Beddington R, Costantini F, Lacy E. 1986. Manipulating the
mouse embryo. A laboratory manual, 2nd ed. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press.
Howell CY, Bestor TH, Ding F, Latham KE, Mertineit C, Trasler JM,
93
Chaillet JR. 2001. Genomic imprinting disrupted by a maternal
effect mutation in the Dnmt1 gene. Cell 104:829 – 838.
Howlett SK, Reik W. 1991. Methylation levels of maternal and paternal
genomes during preimplantation development. Development
113:119 –127.
Kafri T, Ariel M, Brandeis M, Shemer R, Urven L, McCarrey J, Cedar H,
Razin A. 1992. Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line. Genes Dev 6:705–714.
Lee J, Inoue K, Ono R, Ogonuki N, Kohda T, Kaneko-Ishino T, Ogura
A, Ishino F. 2002. Erasing genomic imprinting memory in mouse
clone embryos produced from day 11.5 primordial germ cells.
Development 129:1807–1817.
Liang G, Chan MF, Tomigahara Y, Tsai YC, Gonzales FA, Li E, Laird PW,
Jones PA. 2002. Cooperativity between DNA methyltransferases in
the maintenance methylation of repetitive elements. Mol Cell Biol
22:480 – 491.
Mayer W, Niveleau A, Walter J, Fundele R, Haaf T. 2000. Demethylation
of the zygotic paternal genome. Nature 403:501–502.
Morgan HD, Sutherland HG, Martin DI, Whitelaw E. 1998. Epigenetic
inheritance at the agouti locus in the mouse. Nat Genet 23:314 –
318.
Okano M, Bell DW, Haber DA, Li E. 1999. DNA methyltransferases
Dnmt3a and Dnmt3b are essential for de novo methylation and
mammalian development. Cell 99:247–257.
Olek A, Walter J. 1997. The pre-implantation ontogeny of the H19
methylation imprint. Nat Genet 17:275–276.
Oswald J, Engemann S, Lane N, Mayer W, Olek A, Fundele R, Dean W,
Reik W, Walter J. 2000. Active demethylation of the paternal
genome in the mouse zygote. Curr Biol 10:475– 478.
Rakyan VK, Blewitt ME, Druker R, Preis JI, Whitelaw E. 2002. Metastable epialleles in mammals. Trends Genet 18:348 –351.
Reik W, Walter J. 2001. Genomic imprinting: parental influence on the
genome. Nat Rev Genet 2:21–32.
Reik W, Dean W, Walter J. 2001. Epigenetic reprogramming in mammalian development. Science 293:1089 –1093.
Rideout WM 3rd, Eggan K, Jaenisch R. 2001. Nuclear cloning and
epigenetic reprogramming of the genome. Science 293:1093–
1098
Roemer I, Reik W, Dean W, Klose J. 1997. Epigenetic inheritance in the
mouse. Curr Biol 7:277–280.
Rougier N, Bourc’his D, Gomes DM, Niveleau A, Plachot M, Paldi A,
Viegas-Pequignot E. 1998. Chromosome methylation patterns during mammalian preimplantation development. Genes Dev
12:2108 –2113.
Sanford JP, Clark HJ, Chapman VM, Rossant J. 1987. Differences in
DNA methylation during oogenesis and spermatogenesis and their
persistence during early embryogenesis in the mouse. Genes Dev
1:1039 –1046.
Santos F, Hendrich B, Reik W, Dean W. 2002. Dynamic reprogramming
of DNA methylation in the early mouse embryo. Dev Biol 241:
172–182.
Surani MA. 2001. Reprogramming of genome function through epigenetic inheritance. Nature 414:122–128.
Tremblay KD, Duran KL, Bartolomei MS. 1997. A 5’ 2-kilobase-pair
region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol Cell Biol 17:
4322– 4329.
Walsh CP, Chaillet JR, Bestor TH. 1998. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat
Genet 20:116 –117.
Whitelaw E, Martin DI. 2001. Retrotransposons as epigenetic mediators of phenotypic variation in mammals. Nat Genet 27:361–365.