Download Discrete Shoot and Root Stem Cell-Promoting

Discrete Shoot and Root Stem Cell-Promoting WUS/WOX5 Functions Are an
Evolutionary Innovation of Angiosperms
Judith Nardmann, Pascal Reisewitz, and Wolfgang Werr
Institut für Entwicklungsbiologie, Universität zu Köln, Köln, Germany
The morphologically diverse bodies of seed plants comprising gymnosperms and angiosperms, which separated some
350 Ma, grow by the activity of meristems containing stem cell niches. In the dicot model Arabidopsis thaliana, these are
maintained by the stem cell-promoting functions of WUS and WUSCHEL-related homeobox 5 (WOX5) in the shoot and
the root, respectively. Both genes are members of the WOX gene family, which has a monophyletic origin in green algae.
The establishment of the WOX gene phylogeny from basal land plants through gymnosperms to basal and higher
angiosperms reveals three major branches: a basal clade consisting of WOX13-related genes present in some green algae
and throughout all land plant genomes, a second clade containing WOX8/9/11/12 homologues, and a modern clade
restricted to seed plants. The analysis of the origin of the modern branch in two basal angiosperms (Amborella
trichopoda and Nymphaea jamesoniana) and three gymnosperms (Pinus sylvestris, Ginkgo biloba, and Gnetum gnemon)
shows that all members of the modern clade consistently found in monocots and dicots exist at the base of the
angiosperm lineage, including WUS and WOX5 orthologues. In contrast, our analyses identify a single WUS/WOX5
homologue in all three gymnosperm genomes, consistent with a monophyletic origin in the last common ancestor of
gymnosperms and angiosperms. Phylogenetic data, WUS- and WOX5-specific evolutionary signatures, as well as the
expression pattern and stem cell-promoting function of the single gymnosperm WUS/WOX5 pro-orthologue in
Arabidopsis indicate a gene duplication event followed by subfunctionalization at the base of angiosperms.
Introduction
The evolutionary relationship between higher land
plants, gymnosperms and angiosperms, jointly seed plants,
is still a matter of debate. Recent molecular data support
that extant gymnosperms: cycadales, ginkgoales, coniferales, and gnetales, comprise a monophyletic group that separated from its sister lineage, the angiosperms, 350 Ma
(Goremykin et al. 1997). The origin, dominance, and diversity of angiosperms—Darwin’s ‘‘abominable mystery’’—
relates to their deeply branched phylogeny with monocots
and dicots, the two major lineages of the Mesangiospermae,
which diverged approximately 140 Ma (Moore et al. 2007).
Root and shoot systems are common to all seed plants,
the development of which depends on the activity of meristems. The aerial part of the plant body grows by the activity
of the shoot apical meristem (SAM), whereas the belowground part develops from the root meristem (RM). The
SAM and RM are comprised of small groups of cells usually
at the tip of growing axes, which retain an undifferentiated
state and continuously provide new cells for the formation of
the plant body. A cytohistological zonation model has been
claimed for all seed plants and divides the SAM into a central
zone (CZ) considered to comprise these slowly dividing stem
cells and a surrounding morphogenetic peripheral zone (PZ),
where cells divide more frequently and are recruited for differentiation. A second tunica/corpus model of the SAM is
generally applicable to angiosperms but not to all gymnosperms (for review, see Steeves and Sussex 1989); it distinguishes between single- or two-layered outer tunica layers
(L1 or L1 þ L2), which are clonal due to anticlinal cell divisions and an inner corpus (L3) where cells divide anticlinically and periclinally. The organization of the RM is
histologically evident, as a so-called quiescent centre
(QC) is surrounded by initials, which are founder cells for
Key words: WOX phylogeny, plant evolution, meristem.
E-mail: [email protected].
Mol. Biol. Evol. 26(8):1745–1755. 2009
doi:10.1093/molbev/msp084
Advance Access publication April 22, 2009
Ó The Author 2009. Published by Oxford University Press on behalf of
the Society for Molecular Biology and Evolution. All rights reserved.
For permissions, please e-mail: [email protected]
different root cell types often arranged in concentric cell files.
The molecular mechanisms underlying the establishment
and maintenance of plant meristems has so far mainly been
studied in angiosperm models and most of our knowledge is
based on the work in Arabidopsis thaliana. Few exceptions
are analyses of KNOTTED1-like homeobox (KNOX) gene
expression in the fern Ceratopteris richardii (Sano et al.
2005) and studies on the conservation of the KNOX–ARP
interaction during leaf development in the lycophyte Selaginella kraussiana and the basal leptosporangiate fern Osmunda regalis (Harrison et al. 2005).
In the Arabidopsis SAM, a two-cell–layered tunica
encloses the inner corpus. All three layers contribute to
the CZ, which is subdivided into the stem cell population
and the subtending organizing centre (OC) marked by
WUSCHEL (WUS) gene expression in the L3 layer.
WUS encodes a homeodomain transcription factor that promotes stem cell fate (Mayer et al. 1998) and is the founding
member of the WUSCHEL-related homeobox (WOX) gene
family in plants (Haecker et al. 2004). WUS activity in the
Arabidopsis SAM is antagonized by CLAVATA (CLV)
signaling, which involves a heterodimeric transmembrane
receptor kinase (CLV1, 2) and a secreted ligand, the
CLV3-derived polypeptide (Schoof et al. 2000). The conical
stem cell domain of the Arabidopsis SAM is marked by
CLV3 expression and overlies the WUS-marked OC.
Another member of the WOX gene family, WOX5, is
expressed in the QC and serves to maintain stem cell identity in the root initials surrounding the QC (Sarkar et al.
2007), which are founder cells for different root cell types.
When appropriately expressed from the WUS promoter,
WOX5 activity can rescue major phenotypic deficiencies
of wus mutants caused by their loss of stem cells, and
WOX5 consequently provides a similar stem cell-promoting
function in the RM as does WUS in the SAM (Sarkar et al.
2007). Whereas the organization of the RM, with the QC,
surrounding initials and descending cell files, is histologically apparent in roots of angiosperm and gymnosperm species (for review, see Barlow 1994), the cellular architecture
of the SAM is less evident.
1746 Nardmann et al.
Orthologues of WUS and WOX5 have been confirmed
in two monocot model species, Oryza sativa and Zea mays.
Due to an ancient polyploidization event, the Z. mays genome contains two paralogues of each. Expression of
ZmWOX5B and OsWOX5/QHB is specific to the root QC
(Kamiya et al. 2003; Nardmann et al. 2007), whereas the
expression patterns of the single O. sativa or two Z. mays
WUS orthologues in the vegetative shoot apex revealed significant deviations from those in Arabidopsis (Nardmann
and Werr 2006). Common to all plants, however, is the requirement for stem cells and their homeostasis, thus making
it appropriate to characterize WUS and WOX5 orthologues
in more basal plant lineages.
The Arabidopsis genome contains 14 WOX gene family members (Haecker et al. 2004), with orthologues for
WUS, WOX2-5, WOX9, and WOX11-13 present in the
genomes of O. sativa and Z. mays (Nardmann and Werr
2006). Only WUS and WOX5 have been implicated in stem
cell homeostasis, with other family members being
involved in organ formation or embryonic patterning
(PRS/WOX3, Matsumoto and Okada 2001; NS1/2, Nardmann
et al. 2004; PFS2/WOX6, Park et al. 2005; WOX2/8/9,
Breuninger et al. 2008). To unequivocally identify WUS
or WOX5 orthologues, we established the WOX gene
phylogeny from basal land plants through gymnosperms to
basal and higher angiosperms. This WOX phylogenetic tree
identifies three major branches: a basal clade consisting of
WOX13-related genes already present in the genomes of
some green algae, a second clade containing WOX8/9/11/
12 homologues, and a modern clade containing WUS and
WOX5 restricted to seed plants. Distinct WUS and WOX5
genes are an innovation of angiosperms, whereas three
gymnosperm genomes each contain a single WUS/WOX5
pro-orthologue, suggesting that the genome of the last common ancestor (LCA) of gymnosperms and angiosperms
contained a single WUS/WOX5 precursor.
Material and Methods
Isolation of Gymnosperm, Basal Angiosperm, and Basal
Monocot WOX Gene Family Members
Degenerate primers (Nardmann et al. 2007) were used
to amplify the homeoboxes of WOX genes from the genomic DNA of the gymnosperm species Pinus sylvestris, Gnetum gnemon, and Ginkgo biloba, the basal angiosperms
Amborella trichopoda as well as Nymphaea jamesoniana,
and the basal monocot Acorus calamus. DNA and protein
sequence analysis was performed with the Wisconsin GCG
software package version 7.0 (University of Wisconsin Genetics Computer Group). WOX homeodomain–encoding
sequences of Ostreococcus tauri and Ostreococcus lucimarinus, Physcomitrella patens, and Selaginella moellendorffii as well as the full-length protein sequences of
Populus trichocarpa and O. sativa were derived from their
established genome sequences (http://genome.jgi-psf.org
or http://rice.plantbiology.msu.edu;). Zea mays and A.
thaliana homeodomain (HD) sequences have been described recently (Haecker et al. 2004; Nardmann et al.
2007). Accession numbers of the newly isolated sequences,
the loci of genome-derived sequences, or the IDs of proteins
used for phylogenetic analyses as well as further informations on source and genome versions are given in supplementary table 1 (Supplementary Material online). Multiple
sequence alignments are based on ClustalX (http://www.ebi.ac.uk/clustalX2) .The alignment of the full-length protein was refined using BioEdit (Tom Hall, Ibis
Therapeutics, Carlsbad, CA) in order to correctly align regions of conservation such as the WUS box. Selection of
the best-fit model of protein evolution of the alignments
was pursued by ProtTESTv1.4 (Abascal et al. 2005), which
suggested the Jones–Taylor–Thornton (JTT) model for the
HD and full-length protein alignments (details in Supplementary Materials online).
Three different phylogenetic methods were compared:
The Maximum Likelihood method created with the help of
PHYLIP (http://evolution.genetics.washington.edu/phylip.
html), the Neighbor-Joining method using MEGA4.0
(Kumar et al. 2008), and the Bayesian Inference (BI)
method performed with MrBayes 3.1.2 (http://mrbayes.
csit.fsu.edu/). All three methods revealed trees with a similar
topology (supplementary fig. 1A–F, Supplementary Material online); however, the phylogenetic trees obtained by the
BI method displayed the most significant support values
and are therefore shown here.
In situ Hybridization
Nonradioactive in situ hybridization followed the protocol of Jackson (1991). Paraffin-embedded tissue was sectioned by the use of the Leica RM 2145 rotary microtome
(7–10 lm). Probes for in situ hybridization were cloned in
sense or antisense orientation to the T7 promoter and digoxigenin-labeled RNA probes were obtained as described
(Bradley et al. 1993). The GgWUS/WOX5 probe corresponded to accession FM882154. Images were taken using
an Axioskop microscope equipped with an Axiocam camera (Zeiss, Germany). Pictures were processed using Adobe
Photoshop CS2.
Transgenic Experiments
To express GgWUS/WOX5 under the control of the
WUS promoter, GgWUS/WOX5 cDNA was amplified from
cDNA using the primers GgWUS/WOX5XhoIfw (5#GCTTCTCGAGTGACTTGGTTCTGAATCCATCATC)
and GgWUS/WOX5BamHIrev (5#-GCTTGGATCCTTCAGCGAAATCCACCGAGGCAAAG). The gene was
then cloned behind the pOp promoter and expressed by
a WUS:LhG4 driver construct (Sarkar et al. 2007). GUS activity was visualized according to Schoof et al. (2000).
Results
The LCA of Angiosperms and Gymnosperms Contained
a Single WUS/WOX5 Precursor
The phylogenetic tree depicted in figure 1 is based on
107 HD sequences common to all WOX family members
isolated from species of major radiations of the plant kingdom: green algae (O. tauri, Ot and O. lucimarinus, Ol),
WUS/WOX5 Phylogeny in Seed Plants
1747
FIG. 1.—HD sequence–based phylogeny of the WOX gene family of the plant kingdom. Phylogenetic tree obtained by the BI method based on the
HDs encoded by WOX genes from species of major radiations of the plant kingdom. Abbreviations are Ostreococcus tauri, Ot; Ostreococcus
lucimarinus, Ol; Physcomitrella patens, Pp; Selaginella moellendorffii, Sm; Pinus sylvestris, Ps; Gnetum gnemon, Gg; Ginkgo biloba, Gb; Amborella
trichopoda, Amt; Nymphaea jamesoniana, Nj; Acorus calamus, Ac; Oryza sativa, Os; Zea mays, Zm; Arabidopsis thaliana, At; and Populus
trichocarpa, Pt. The WUS HDs of Petunia hybrida (TER) and Antirrhinum majus (ROA) were included for the sake of completion. Only the posterior
probability values at the nodes of major subbranches are shown. The original dendrogram with all posterior probability values is included in
Supplementary Materials online. Posterior probability values in brackets were obtained in the absence of the SmWOXII HD (arrow), which is placed at
the base of the WOX9/11 and the modern WOX branches. The cladogram is a majority rule tree with a cutoff of 50% and was created by the TreeView
program (Page 1996).
1748 Nardmann et al.
WUS/WOX5 Phylogeny in Seed Plants
bryophytes (P. patens, Pp), lycophytes (S. moellendorffii,
Sm), gymnosperms (P. sylvestris, Ps; G. gnemon, Gg;
G. biloba, Gb), basal angiosperms (A. trichopoda, Amt; N.
jamesoniana, Nj), basal monocots (A. calamus, Ac), grasses
(O. sativa, Os; Z. mays; Zm), and dicots (A. thaliana, At;
P. trichocarpa, Pt). The WUS HDs of Petunia hybrida
(TERMINATOR, TER; Stuurman et al. 2002) and Antirrhinum majus (ROSULATA, ROA; Kieffer et al. 2006) were
also included in the analysis. The HD sequences of O. tauri,
O. lucimarinus, P. patens, S. moellendorffii, A. thaliana,
P. trichocarpa, and O. sativa are based on their established
genome sequences; Z. mays WOX gene family members were
described recently (Nardmann and Werr 2006; Nardmann
et al. 2007). WOX gene sequences from gymnosperms,
basal angiosperms, and A. calamus were independently
isolated by polymerase chain reaction (PCR) using degenerate primers (sequences in Nardmann et al. 2007), which
correspond to the most conserved polypeptide sequences
of WUS or WOX HDs and include 40 amino acid (aa)
core HD sequences of the WOX proteins or 41 aa in WUS
orthologues due to a characteristic extra amino acid in the
loop between helix 1 and helix 2 of the homeodomain.
Phylogenetic analyses based on the HD sequences performed by the BI method revealed three major branches:
a probably ancient branch with orthologues of Arabidopsis
WOX13 as the founding member present in all land
plants and the green algae Ostreococcus, a second clade
comprising the Arabidopsis WOX8/9/11/12 homologues,
and a modern clade containing WUS and WOX1–7 restricted
to seed plants (fig. 1; all support values are given in supplementary fig. 1A (Supplementary Material online).
The relationship between the three branches is still unclear
as the branch lengths do not consistently identify the
WOX13 clade to be ancestral (Deveaux et al. 2008; see
supplementary fig. 1G, Supplementary Material online).
Therefore, the presence of archetypical WOX genes in the
LCA of land plants and the subsequent loss of WOX genes
during green algae and basal land plant evolution cannot
be ruled out.
In this HD-based phylogeny, one of the Selaginella
sequences, SmWOXII, could neither be grouped with high
significance to the WOX13 nor to the WOX9/11 clade,
which relates to the absence of the full sequences of the
C-terminal recognition helix targeted by the degenerate
PCR primers. However, the deduced protein sequence
(ID115439) contains the sequence NVFYWFQN, which
is 100% identical to the sequences of all WOX9/11 and
modern clade members, in contrast to the consensus sequence of the WOX13 clade members (NVYNWFQN).
Omission of SmWOXII in the phylogenetic reconstructions
1749
increases the posterior probabilities for the three main
branches in the BI phylogeny to 99% (fig. 1, values in
brackets; supplementary fig. 1B, Supplementary Material
online). However, based on the complete SmWOXII HD
sequence, the characteristic helix 3 or DNA recognition helix of the WOX9/11 and modern clade gene family members apparently evolved with vascular plants.
To examine the origin of the modern branch in basal
angiosperms and gymnosperms in more detail, we established full-length WUS or WOX protein–encoding
sequences from N. jamesoniana and the gymnosperms
P. sylvestris, G. gnemon, and G. biloba by cDNA cloning
or genome walking. These protein sequences were compared with those deduced from the A. thaliana, Z. mays,
O. Sativa, and P. trichocarpa genome sequences. The phylogenetic analysis depicted in figure 2A confirms that with
the exception of WUS and WOX5, all members of the modern clade consistently found in monocots and dicots existed
before the separation of gymnosperms and angiosperms. In
contrast, significant posterior probability values support the
existence of a single WUS/WOX5 pro-orthologue in all
three gymnosperm species. The WUS/WOX5 monophyly
is only observed in the phylogenetic tree based on fulllength protein sequences, whereas analyses solely based
on the HDs group PsWUS/WOX5 to the WOX1/6 branch
and not into the WUS/WOX5 subbranch. This difference
relates firstly to the absence of the WUS-specific extra
amino acid residue in the PsWUS/WOX5 HD and secondly
to domain conservation outside the HD, which is characteristic for members of the WUS/WOX5 clade (fig. 2B). Present in all members of the modern clade is the WUS box
(Haecker et al. 2004), whereas a small C-terminal domain
is restricted to members of the WUS/WOX5 clade. Initially
identified as a WUS-specific EAR-like domain (Kieffer
et al. 2006), this motif should be reconsidered as WUS/
WOX5 specific. In the absence of established genome sequences, we cannot ultimately exclude the existence of
other WOX genes to exist in gymnosperms; however, the
consistency of a single WUS/WOX5 pro-orthologue detected in three major gymnosperm radiations supports
a monophyletic origin of WUS and WOX5 in the LCA
of gymnosperms and angiosperms. Other modern clade
members in the three gymnosperm lineages are WOX2,
WOX3, and WOX4, which may have also be present in
the LCA.
Evolutionary WUS/WOX5 Homeodomain Signatures
A protein sequence comparison of all available WUS/
WOX5 orthologues reveals striking conservation and
FIG. 2.—Phylogeny based on full-length WOX seed plant proteins and WUSCHEL/WOX5 protein alignment. (A) A phylogenetic tree based on the
available full-length protein sequences of different seed plant species using the BI method. Abbreviations are the same as in figure 1. The posterior
probability values are given at each node. The phylogenetic analysis was also performed using the ML method (supplementary fig. 1E, Supplementary
Material online). The significant bootstrap value at the branch point of the WUS/WOX5 subbranch and the remaining modern WOX subbranches is
given in brackets. (B) Protein sequence comparison of Arabidopsis WUS (AtWUS) and WOX5 (AtWOX5) with their corresponding angiosperm
orthologues in Populus (PtWUS/PtWOX5), Zea (ZmWUS1/ZmWUS2 and ZmWOX5A/ZmWOX5B), Oryza (OsWUS and OsWOX5/QHB), and
Nymphaea (NjWUS and NjWOX5). The WUS orthologues of Antirrhinum (ROA) and Petunia (TER) are also included in the alignment as well as the
single gymnosperm sequences of Ginkgo (GbWUS/WOX5), Gnetum (GgWUS/WOX5), and Pinus (PsWUS/WOX5). The extra aa residue specific for
the WUS HD is indicated by an arrow. The positions of the entire HD as well as its subdomains are indicated by gray lines; the WUS box and the EARlike domain are marked by gray rectangles.
1750 Nardmann et al.
evolutionary signatures in the HD (fig. 2B), which consists
of the flexible N-terminal arm, helix 1, a loop to helix 2, and
a turn followed by helix 3, the recognition helix contacting
the DNA in the major groove (for review, see Gehring et al.
1994). The WUS-specific extra tyrosine (Y) residue in the
loop between helix 1 and 2 (Mayer et al. 1998) is present in
all angiosperm proteins and in the Ginkgo protein; the Gnetum orthologue contains a histidine (H) substitution. This
extra amino acid residue is absent in the P. sylvestris
WUS/WOX5 orthologue which, however, contains a phenylalanine residue which replaces tyrosine in angiosperm
WOX5 orthologues. Another discriminating difference between WUS and WOX5 resides in the N-terminal arm of the
homeodomain: The SGS and SGT tripeptides in the Pinus
and Gingko WUS/WOX5 ancestor (SGA in Gnetum) are
identical to those in the monocot WUS orthologues of Z.
mays and O. sativa, respectively, and the central glycine
(G) residue of this N-terminal tripeptide is changed to a
serine (S) in the WUS orthologues from eudicots and
Nymphaea. In contrast, all surveyed WOX5 orthologues
here share a KCG tripeptide and differ in an N-terminal
arm–specific signature of the homeodomain of which the
WUS-specific one relates to the ancestral WUS/WOX5 lineage present in extant gymnosperms. The N-terminal arms
of HDs provide a dual function: first, they contact the minor
groove of the DNA double helix and second, they participate in protein–protein interactions (Frazee et al. 2002).
Consequently, WUS- or WOX5-specific N-terminal arm
sequences thus might alter the mode or affinity of HD
DNA target site recognition (Palena et al. 2001; Frazee
et al. 2002), selectively bind auxilary proteins (Lohr and
Pick 2005), or interact with signaling components such
as SMAD4, which mediates the BMP signal of the Hoxc9
HD (Zhou et al. 2008).
Another signature affects the border of the turn to helix 3,
where a serine residue in WOX5 orthologues replaces the
glycine in the angiosperm WUS orthologues and the gymnosperm WUS/WOX5 ancestor. According to the ratio of
synonymous to nonsynonymous changes in the HD-coding
region, which was estimated using the SELECTON server
(Doron-Faigenboim et al. 2005; Stern et al. 2007), neither
the glycine nor the serine is under positive selection. However, this serine residue is WOX5 specific and differentiates
the WOX5 HD from the HDs of all other modern branch
members among gymnosperms and angiosperms. Thus,
a glycine residue rather than a serine was probably a feature
of the gymnosperm and angiosperm LCA. As for the Nterminal arm, this so-called DNA recognition helix 3
appears to be bifunctional contributing also to protein interactions in paired-class homeodomains (Bruun et al. 2005).
Expression Patterns of WUS/WOX5 Genes in Basal Seed
Plants
Using reverse transcriptase (RT)-PCR analysis, expression of all three gymnosperm WUS/WOX5 genes was
detected in shoots and roots, although transcripts were rare
(supplementary fig. 2, Supplementary Material online). Expression of NjWUS was specific for the shoot and was not
detectable in the root tissue. In contrast, NjWOX5 tran-
FIG. 3.—Expression pattern of GgWUS/WOX5. RNA in situ
hybridization performed with the GgWUS/WOX5 probe on longitudinal
section of a Gnetum SAM (A, B), male cone (C), male flowers (D, E), and
female flower (F). mf, male flower; ff, female flower; l, leaf; a,
antherophore; s, sporangium.
scripts were detected via RT-PCR in root and shoot tissue;
however, it was not possible to dissect the shoot tissue entirely away from adventitious roots, which in the water lily
develop from each shoot phytomer. Therefore, at least
NjWUS has been subfunctionalized to the shoot, suggesting
that a functional separation of WUS and WOX5 was initiated at the base of angiosperms, whereas an ancient seed
plant ‘‘progenitor’’ gene probably provided similar functions in shoot and root.
On the cellular level, WUS/WOX5 transcripts were not
detected in the root or the CZ of the shoot meristem by RNA
in situ hybridization experiments. However, in G. gnemon
expression of GgWUS/WOX5 was found in the lateral flank
of the SAM (fig. 3A), whereas transcripts were absent in
consecutive median longitudinal sections (fig. 3B). New
leaves in G. gnemon develop in a decussate or orthodistichous phyllotaxy, and WUS/WOX5 transcriptional activity
thus appears associated with the initiation of new leaf pairs
at the SAM flank. Gnetum gnemon is a dioecious plant with
flowers arranged in cones. Every female cone develops several bracts or collars, each bearing a whorl of five or more
female flowers. In contrast, the male inflorescence develops
several whorls of flowers in the axil of one collar with the
WUS/WOX5 Phylogeny in Seed Plants
1751
FIG. 4.—GgWUS/WOX5 promotes stem cell fate in Arabidopsis. Expression of WUS-GgWUS/WOX5 results in a clv-like phenotype with
supernumerary flowers and floral organs (B, C) due to an increase in stem cell number compared with Arabidopsis (A). The GgWUS/WOX5 expression
domain is indicated by coactivation of the GUS monitor gene by the WUS:LhG4 driver in the inflorescence meristem (IM; D) or in the nucellus (E).
uppermost whorl consisting of sterile female flowers. These
floral whorls develop basipetally, with the uppermost whorl
developing first and the lowest whorl developing last. Each
male flower develops two microsporangia subtended by
a single antherophore (Endress 1996; Hufford 1996). In
the male inflorescence, GgWUS/WOX5 transcripts were
detectable at different stages of male flower development.
In young flowers, GgWUS/WOX5 was exclusively and
strongly expressed in the epidermal layer of the developing
microsporangium (fig. 3C and D) but not in the epidermis
of the subtending antherophore. Expression then spreads
throughout the sporangium, including the sporogenous cells
(fig. 3E). In addition, GgWUS/WOX5 was preferentially
expressed in the L1 layer of the nucellus primordium in
the sterile female flower of the upper whorl (fig. 3E). In
the female cones, GgWUS/WOX5 was expressed in the apical
part of the developing nucellus of the fertile flower (fig. 3F).
The Gymnosperm WUS/WOX5 Pro-orthologue
Promotes Stem Cell Fate
In order to address the function of the gymnosperm
WUS/WOX5 progenitor, we expressed the GgWUS/WOX5
gene under control of the WUS promoter in Arabidopsis
plants via the synthetic LhG4/pOp transcription factor
system (Sarkar et al. 2007). In contrast to the wild-type
inflorescence (fig. 4A), Arabidopsis lines expressing
WUS-GgWUS/WOX5 exhibited phenotypes such asfasciation
of the inflorescence stem, overproliferation of flowers,
1752 Nardmann et al.
and supernumerary floral organs in all whorls (fig. 4B and C),
which are all reminiscent of an increased stem cell population
asobservedinclvloss-of-functionmutants.Becausethebinary
construct used for expression of the GgWUS/WOX5 transgene
inArabidopsis alsocontained the pOp::GUSreporter, we were
able to concomitantly monitor the expression domain. GUS
expression was visible in an OC-like domain in the IM (fig.
4D), in early flower buds, and in the nucellus of the developing
ovules (fig. 4E), reflecting the expression pattern of the endogenousWUS gene. Inconsequence,the clv phenocopy isnot due
to ectopic GgWUS/WOX5 expression outside of the stem cell
OC but implies that the gymnosperm WUS/WOX5 pro-orthologue interferes with the control of stem cell homeostasis in the
Arabidopsis SAM and promotes supernumerary stem cells.
Discussion
Phylogeny of the WOX Family Reveals a Seed plantSpecific ‘‘Modern’’ Clade
The morphologically diverse seed plant bodies all develop by the activity of meristems containing stem cell
niches, which according to the dicot model A. thaliana
are maintained by similar stem cell-promoting gene functions, WUS and WOX5, in the shoot and the root, respectively (Sarkar et al. 2007). Both genes are members of
the WOX gene family, which has a monophyletic origin
in green algae. In the moss P. patens, all three WOX family
members are still restricted to the WOX13 branch, whereas
in the lycophyte S. moellendorffii, apart from six WOX13
relatives, SmWOXII groups outside the branch and according to its HD recognition helix might be placed at the base
of the WOX9/11 and the modern branch.
Relying on the published genome sequences, these
data identify the complete WOX gene complement in basal
land plant species. In contrast, degenerate primer PCR in
gymnosperms and basal angiosperms consistently revealed
members of the seed plant-specific modern clade in addition
to members of the basal WOX13 and WOX9/11 branches.
Two data points indicate completion of the WOX gene family at the base of angiosperms. First, the A. trichopoda and
N. jamesoniana genomes encode family members in each
branch consistently found in the monocots Z. mays and O.
sativa or the eudicots Arabidopsis and Populus, and second, modern clade members are also identified in three major gymnosperm radiations, in addition to a WUS/WOX5
pro-orthologue, which is the focus here. The Gnetum,
Pinus, and Ginkgo genomes clearly contain WOX2, WOX3,
and WOX4 homologues. WOX3 genes of Arabidopsis
(PRESSED FLOWER, PRS) and Z. mays (Narrow sheath1/
2, NS1/NS2), for example, are involved in the development
of lateral domains of leaves and flowers (Matsumoto and
Okada 2001; Nardmann et al. 2004). Although possibly
incomplete, the number of modern WOX genes in three
gymnosperm species is lower than in basal angiosperms analyzed at the same PCR primer complexity. Extant gymnosperms thus have a reduced set of WOX genes or tolerate
a higher sequence divergence in the homeodomain primer target sequences, which might interfere with PCR amplification.
These data suggest an amplification of the WOX gene
number from basal to higher land plants and are consistent
with other transcription factor families, such as MADS-box,
KNOX, or HDIII-ZIP genes, which are frequently discussed
with respect to sub- or neofunctionalization (Reiser et al.
2000; Irish and Litt 2005; Floyd et al. 2006; Scofield
and Murray 2006; Mondragon-Palomino and Theissen
2008). Most data with respect to phylogenetic evolution
are available for MADS-box genes, which relate to the evolution of the flower or in Darwin’s terms, the abominable
mystery—the appearance of flowering plants (Theissen and
Melzer 2007). A subgroup of MADS-box genes, the socalled ABC function genes, define floral organ identity
and are lacking in nonseed plants (Zhang et al. 2004). Basal
land plants, however, contain MIKC-type MADS-box
genes, which similar to WOX13 orthologues, are found
in all land plant genomes (Münster et al. 1997) or algae,
suggesting that ancestral functions might have been functionally maintained throughout plant evolution, although
possibly adapted in extant species. Similar to ABC function
MADS-box genes, the modern WOX family members appeared with seed plants, supporting the view that both were
present in the genome of the LCA of gymnosperms and
angiosperms.
WOX5 is an Angiosperm Innovation
Both, gymnosperms and angiosperms are probably
monophyletic sister groups within 300–350 Ma of independent evolution (Goremykin et al. 1997). The presence of
a single WUS/WOX5 orthologue in three gymnosperms
contrasts with discrete WUS and WOX5 functions from
basal to higher angiosperms and suggests either gene duplication at the base of angiosperms or, alternatively, a lossof-gene function in the ancestral lineage of Pinaceae,
Ginkgoales, and Gnetales.
The confinement of amino acid conservation to the homeodomain and small subbranch-specific polypeptide motifs is a general feature within the modern branch of the
WOX gene family. Discriminating differences between
WUS and WOX5 HDs except the WUS-specific extra residue are located in the N-terminal arm of the homeodomain
and at the border of the turn to helix 3. Both domains appear
to be bifunctional, contributing to DNA target site recognition and protein interactions (Palena et al. 2001; Frazee
et al. 2002; Bruun et al. 2005; Lohr and Pick 2005), and
the amino acid differences between WUS and WOX5
are thus located at crucial functional positions.
Concerning WOX5 evolution, it is important to note
that all isolated gymnosperm modern branch WOX family
members have a glycine residue in the turn to helix 3 of the
HD. Its presence in all three gymnosperm WUS/WOX5 proorthologues and in WUS orthologues of basal angiosperms
supports the conclusion that a WUS-type HD containing
a glycine was ancestral in the genome of the LCA of gymnosperms and angiosperms, whereas the serine-containing
WOX5 HD arose later at the base of the angiosperm lineage.
The conservation of both types of HDs in angiosperms
in the absence of positive selection is reminiscent of the
homeodomain paradox in animals: ‘‘transcriptional versus
functional specificity’’ (Svingen and Tonissen 2006). On
WUS/WOX5 Phylogeny in Seed Plants
the cellular level, modern WOX genes have acquired very
specific expression patterns (Haecker et al. 2004), most of
which are conserved evolutionarily (Nardmann et al. 2007).
However, the function of the modern group members seems
to be exchangeable (Sarkar et al. 2007; Shimizu et al. 2009),
although the gene products have diverged and manifested
specific signatures within as well as outside the HD such as
the serine in the WOX5 HD or the WUS/WOX5 box, respectively. Apparently, the criteria for the selection of HD
protein sequences are unclear in animals as well as in plants.
Although the presence of a WOX5 orthologue in gymnosperms ultimately cannot be excluded in the absence of
full genome sequences, the consistency of the data in three
major gymnosperm radiations, the full-length protein sequence–derived phylogeny, and the transcription in the root
and shoot tip or the stem cell-promoting function in transgenic experiments suggest a single WUS/WOX5 gene to be
present in the genome of extant gymnosperms. Discrete
shoot and root stem cell-promoting functions thus appear
to be exclusive to angiosperms and subfunctionalization
might have contributed to the rapid diversification, variability, and dominance of angiosperms.
The Gymnosperm WUS/WOX5 Pro-orthologue and the
Ancestral WUS Function
Transgenic experiments performed in Arabidopsis
(fig. 4) confirm a stem cell-promoting function for the G.
gnemon WUS/WOX5 gene. Sequence orthology is thus supported by functional equivalence, although the cellular expression pattern of the Gnetum WUS/WOX5 pro-orthologue
is different to that established for WUS in the Arabidopsis
SAM, where WUS is transcribed in an OC-type pattern
(Mayer et al. 1998). However, WUS transcripts are also detected in the nucellus of young ovules (Gross-Hardt et al.
2002) and in a few stomium cells of developing anthers
(Deyhle et al. 2007). Also ROSULATA (ROA), the WUS
orthologue of Antirrhinum, is expressed in the nucellus
of the ovule and in a broad domain between the locules
of immature anthers (Kieffer et al. 2006). This association
with the reproductive phase or sporogenesis is reminiscent
of the GgWUS/WOX5 transcription pattern in nucellus tissue and in the epidermis of developing microsporangia,
which are homologous to the anthers of angiosperms.
As for ROA in Anthirrhinum, our failure to identify
GgWUS/WOX5 expression on the cellular level in the
CZ of the SAM or in the RM may be due to low transcript
levels as is known for ROA (Kieffer et al. 2006); also, a transient pulse of expression as is known for ZmWUS1 and OsWUS in the SAM centre could have interfered with
detection via RNA in situ hybridizations (Nardmann and
Werr 2006). However, this lack of cellular data might also
relate to the organization of the SAM in gymnosperms. The
G. gnemon apex consists of a corpus and a single-layered
tunica which are not present in all gymnosperms and, for
example, is lacking in Ginkgo (Foster 1938). The Gnetum
corpus has a zonal structure with subapical initials (1–2
layers), a subtending zone of central mother cells (CMC),
flanking layers, and the pith-rib meristem. Although,
CMCs share a distinct histology and a rare cell division
1753
frequency (Johnson 1950) with cells of the root QC, there
is no evidence for expression of the gymnosperm WUS/
WOX5 pro-orthologue in those cells.
Similar to in Z. mays or O. sativa, GgWUS/WOX5
transcripts are detected in the PZ of the SAM (fig. 3A)
where lateral organs will develop. In grasses, ZmWUS2,
one of two paralogues in Z. mays, or OsWUS, the single
O. sativa orthologue, is expressed in emerging leaf primordia where expression overlaps with that of TD1 and FON1
encoding the CLV1 orthologues of Z. mays or O. sativa,
respectively (Nardmann and Werr 2006). Data for the extant gymnosperm G. gnemon now suggest that a contribution to lateral organ anlagen might be an ancestral function
of WUS and might still be conserved in the orthologous
genes of grasses and Antirrhinum where roa mutants are
not only defective in stem cell maintenance but also in leaf
development (Kieffer et al. 2006). The accumulating multispecies data indicate that WUS has been subject to significant adaptations in the course of speciation and apparently,
so far only TER, the WUS orthologue of P. hybrida, shares
the OC-type expression domain in the SAM with WUS in
Arabidopsis (Stuurman et al. 2002). However, during the
reproductive phase of ontogeny, the expression of all
WUS orthologues is associated with the development of micro- or megasporangia in gymnosperms and angiosperms,
which corresponds with the appearance of modern branch
WOX family members in seed plants.
In summary, the analysis of the WUS/WOX gene family in basal angiosperms and three gymnosperms provides
evidence that the stem cell-promoting WUS function was
present in a likely common ancestor of gymnosperms
and angiosperms. The phylogenetic data, the evolutionary
WUS- and WOX5-specific signatures, and the expression
of the gymnosperm WUS/WOX5 pro-orthologue in shoot
and root generally favor a gene duplication event followed
by subfunctionalization at the base of angiosperms. The single WUS/WOX5 pro-orthologue in gymnosperms is consistent with the functional similarity shared between WUS and
WOX5 in SAM and RM of Arabidopsis (Sarkar et al. 2007)
and still provides stem cell-promoting function. To elucidate the functional relationship between WUS, which is apparently restricted to seed plants, and the basal WOX13
lineage, which has been maintained in all higher land plant
genomes, is a pertinent focus of future research.
Supplementary Material
Supplementary materials, figures 1 and 2, and tables 1
are available at Molecular Biology and Evolution online
(http://www.mbe.oxfordjournals.org/).
Acknowledgments
We thank H. Shahbodaghi-Rückert for perfect technical assistance, Dr J. Chandler for critically reading the manuscript; J. Hintzsche, S. Wirges, and C. Wienhold for
providing gymnosperm plant material; and Siegfried Werth
for photography. We especially wish to thank Dr C. Scutt
(RDP/ENS Lyon) for providing genomic DNA from Amborella trichopoda, Dr T. Borsch for helpful discussions
1754 Nardmann et al.
and providing Nymphaea jamesoniana plants, and Dr T.
Laux for providing the pOp promoter construct and the
WUS:LhG4 driver line. The project was supported by the
Deutsche Forschungsgemeinschaft through WE 1262/7-1
and SFB 680.
Literature Cited
Abascal F, Zardoya R, Posada D. 2005. ProtTest: selection of
best-fit models of protein evolution. Bioinformatics.
21:2104–2105.
Barlow PW. 1994. Structure and function of the root apex—
phylogenetic and ontogenetic perspectives on apical cells and
quiescent centres. Plant and Soil. 167:1–16.
Bradley D, Carpenter R, Sommer H, Hartley N, Coen E. 1993.
Complementary floral homeotic phenotypes result from
opposite orientations of a transposon at the plena locus of
Antirrhinum. Cell. 72:85–95.
Breuninger H, Rikirsch E, Hermann M, Ueda M, Laux T. 2008.
Differential expression of WOX genes mediates apical-basal axis
formation in the Arabidopsis embryo. Dev Cell. 14:867–876.
Bruun JA, Thomassen EI, Kristiansen K, Tylden G, Holm T,
Mikkola I, Bjorkoy G, Johansen T. 2005. The third helix of
the homeodomain of paired class homeodomain proteins acts
as a recognition helix both for DNA and protein interactions.
Nucleic Acids Res. 33:2661–2675.
Deveaux Y, Toffano-Nioche C, Claisse G, Thareau V, Morin H,
Laufs P, Moreau H, Kreis M, Lecharny A. 2008. Genes of the
most conserved WOX clade in plants affect root and flower
development in Arabidopsis. BMC Evol Biol. 8:291.
Deyhle F, Sarkar AK, Tucker EJ, Laux T. 2007. WUSCHEL
regulates cell differentiation during anther development. Dev
Biol. 302:154–159.
Doron-Faigenboim A, Stern A, Mayrose I, Bacharach E,
Pupko T. 2005. Selecton: a server for detecting evolutionary
forces at a single amino-acid site. Bioinformatics.
21:2101–2103.
Endress PK. 1996. Structure and function of female and bisexual
organ complexes in Gnetales. Int J Plant Sci. 157:S113–S125.
Floyd SK, Zalewski CS, Bowman JL. 2006. Evolution of class III
homeodomain-leucine zipper genes in streptophytes. Genetics. 173:373–388.
Foster AS. 1938. Structure and growth of the shoot apex in
Ginkgo biloba. Bull Torrey Bot Club. 65:531–556.
Frazee RW, Taylor JA, Tullius TD. 2002. Interchange of DNAbinding modes in the deformed and ultrabithorax homeodomains: a structural role for the N-terminal arm. J Mol Biol.
323:665–683.
Gehring WJ, Affolter M, Burglin T. 1994. Homeodomain
proteins. Annu Rev Biochem. 63:487–526.
Goremykin V, Hansmann S, Martin W. 1997. Evolutionary
analysis of 58 proteins encoded in six completely sequenced
chloroplast genomes: revised molecular estimates of two seed
plant divergence times. Plant Syst Evol. 206:337–351.
Gross-Hardt R, Lenhard M, Laux T. 2002. WUSCHEL signaling
functions in interregional communication during Arabidopsis
ovule development. Genes Dev. 16:1129–1138.
Haecker A, Gross-Hardt R, Geiges B, Sarkar A, Breuninger H,
Herrmann M, Laux T. 2004. Expression dynamics of WOX
genes mark cell fate decisions during early embryonic patterning
in Arabidopsis thaliana. Development. 131:657–668.
Harrison CJ, Corley SB, Moylan EC, Alexander DL,
Scotland RW, Langdale JA. 2005. Independent recruitment
of a conserved developmental mechanism during leaf
evolution. Nature. 434:509–514.
Hufford L. 1996. The morphology and evolution of male
reproductive structures of Gnetales. Int J Plant Sci.
157:S95–S112.
Irish VF, Litt A. 2005. Flower development and evolution: gene
duplication, diversification and redeployment. Curr Opin
Genet Dev. 15:454–460.
Jackson D. 1991. In situ hybridization in plants. In: Bowles DJ,
Gurr SJ, McPerson M, editors. Molecular plant pathology:
a practical approach. Oxford: Oxford University Press. p.
163–174.
Johnson MA. 1950. Growth and development of the shoot of
Gnetum gnemon L. I. The shoot apex and pith. Bull Torrey
Bot Club. 77:354–367.
Kamiya N, Nagasaki H, Morikami A, Sato Y, Matsuoka M.
2003. Isolation and characterization of a rice WUSCHEL-type
homeobox gene that is specifically expressed in the central
cells of a quiescent center in the root apical meristem. Plant J.
35:429–441.
Kieffer M, Stern Y, Cook H, Clerici E, Maulbetsch C, Laux T,
Davies B. 2006. Analysis of the transcription factor
WUSCHEL and its functional homologue in Antirrhinum
reveals a potential mechanism for their roles in meristem
maintenance. Plant Cell. 18:560–573.
Kumar S, Dudley J, Nei M, Tamura K. 2008. MEGA: a biologistcentric software for evolutionary analysis of DNA and protein
sequences. Brief Bioinform. 9:299–306.
Lohr U, Pick L. 2005. Cofactor-interaction motifs and the
cooption of a homeotic Hox protein into the segmentation
pathway of Drosophila melanogaster. Curr Biol. 15:643–649.
Matsumoto N, Okada K. 2001. A homeobox gene, PRESSED
FLOWER, regulates lateral axis-dependent development of
Arabidopsis flowers. Genes Dev. 15:3355–3364.
Mayer KF, Schoof H, Haecker A, Lenhard M, Jurgens G,
Laux T. 1998. Role of WUSCHEL in regulating stem cell fate
in the Arabidopsis shoot meristem. Cell. 95:805–815.
Mondragon-Palomino M, Theissen G. 2008. MADS about the
evolution of orchid flowers. Trends Plant Sci. 13:51–59.
Moore MJ, Bell CD, Soltis PS, Soltis DE. 2007. Using plastid
genome-scale data to resolve enigmatic relationships among
basal angiosperms. Proc Natl Acad Sci USA.
104:19363–19368.
Münster T, Pahnke J, Di Rosa A, Kim JT, Martin W, Saedler H,
Theissen G. 1997. Floral homeotic genes were recruited from
homologous MADS-box genes preexisting in the common
ancestor of ferns and seed plants. Proc Natl Acad Sci USA.
94:2415–2420.
Nardmann J, Ji J, Werr W, Scanlon MJ. 2004. The maize
duplicate genes narrow sheath1 and narrow sheath2 encode
a conserved homeobox gene function in a lateral domain of
shoot apical meristems. Development. 131:2827–2839.
Nardmann J, Werr W. 2006. The shoot stem cell niche in
angiosperms: expression patterns of WUS orthologues in rice
and maize imply major modifications in the course of monoand dicot evolution. Mol Biol Evol. 23:2492–2504.
Nardmann J, Zimmermann R, Durantini D, Kranz E, Werr W.
2007. WOX gene phylogeny in Poaceae: a comparative
approach addressing leaf and embryo development. Mol Biol
Evol. 24:2474–2484.
Page RDM. 1996. TREEVIEW: an application to display
phylogenetic trees on personal computers. Comput Appl
Biosci. 12:357–358.
Palena CM, Tron AE, Bertoncini CW, Gonzalez DH, Chan RL.
2001. Positively charged residues at the N-terminal arm of the
homeodomain are required for efficient DNA binding by
homeodomain-leucine zipper proteins. J Mol Biol. 308:39–47.
Park SO, Zheng Z, Oppenheimer DG, Hauser BA. 2005. The
PRETTY FEW SEEDS2 gene encodes an Arabidopsis
WUS/WOX5 Phylogeny in Seed Plants
homeodomain protein that regulates ovule development.
Development. 132:841–849.
Reiser L, Sanchez-Baracaldo P, Hake S. 2000. Knots in the
family tree: evolutionary relationships and functions of knox
homeobox genes. Plant Mol Biol. 42:151–166.
Sano R, Juárez CM, Hass B, Sakakibara K, Ito M, Banks JA,
Hasebe M. 2005. KNOX class of homeobox genes potentially
have similar function in both diploid unicellular and
multicellular meristems, but not in haploid meristems. Evol
Dev. 7:69–78.
Sarkar AK, Luijten M, Miyashima S, Lenhard M, Hashimoto T,
Nakajima K, Scheres B, Heidstra R, Laux T. 2007. Conserved
factors regulate signalling in Arabidopsis thaliana shoot and
root stem cell organizers. Nature. 446:811–814.
Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens G,
Laux T. 2000. The stem cell population of Arabidopsis shoot
meristems in maintained by a regulatory loop between the
CLAVATA and WUSCHEL genes. Cell. 100:635–644.
Scofield S, Murray JA. 2006. KNOX gene function in plant stem
cell niches. Plant Mol Biol. 60:929–946.
Shimizu R, Ji J, Kelsey E, Ohtsu K, Schnable PS, Scanlon MJ.
2009. Tissue specificity and evolution of meristematic WOX3
function. Plant Physiol. 149:841–850.
Steeves TA, Sussex IM. 1989. Patterns in plant development.
Cambridge: Cambridge University Press.
1755
Stern A, Doron-Faigenboim A, Erez E, Martz E, Bacharach E,
Pupko T. 2007. Selecton 2007. Advanced models for
detecting positive and purifying selection using a Bayesian
inference approach. Nucleic Acids Res. 35:W506–W511.
Stuurman J, Jaggi F, Kuhlemeier C. 2002. Shoot meristem
maintenance is controlled by a GRAS-gene mediated signal
from differentiating cells. Genes Dev. 16:2213–2218.
Svingen T, Tonissen KF. 2006. Hox transcription factors and
their elusive mammalian targets. Heredity. 97:88–96.
Theissen G, Melzer R. 2007. Molecular mechanisms underlying
origin and diversification of the angiosperm flower. Ann Bot
(Lond). 100:603–619.
Zhang P, Tan HT, Pwee KH, Kumar PP. 2004. Conservation of
class C function of floral organ development during 300
million years of evolution from gymnosperms to angiosperms.
Plant J. 37:566–577.
Zhou B, Chen L, Wu X, Wang J, Yin Y, Zhu G. 2008. MH1
domain of SMAD4 binds N-terminal residues of the
homeodomain of Hoxc9. Biochim Biophys Acta.
1784:747–752.
Neelima Sinha, Associate Editor
Accepted April 13, 2009