Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
4591 Development 126, 4591-4602 (1999) Printed in Great Britain © The Company of Biologists Limited 1999 DEV5344 The dare gene: steroid hormone production, olfactory behavior, and neural degeneration in Drosophila Marc R. Freeman, Anna Dobritsa, Peter Gaines*, William A. Segraves and John R. Carlson‡ Department of Molecular, Cellular, and Developmental Biology, Yale University, PO Box 208103, New Haven, CT 06520-8103, USA *Current address: Department of Veterinary Science, Pennsylvania State University, University Park, PA 16802, USA ‡Author for correspondence (e-mail: [email protected]) Accepted 30 July; published on WWW 27 September 1999 SUMMARY Steroid hormones mediate a wide variety of developmental and physiological events in insects, yet little is known about the genetics of insect steroid hormone biosynthesis. Here we describe the Drosophila dare gene, which encodes adrenodoxin reductase (AR). In mammals, AR plays a key role in the synthesis of all steroid hormones. Null mutants of dare undergo developmental arrest during the second larval instar or at the second larval molt, and dare mutants of intermediate severity are delayed in pupariation. These defects are rescued to a high degree by feeding mutant larvae the insect steroid hormone 20-hydroxyecdysone. These data, together with the abundant expression of dare in the two principal steroid biosynthetic tissues, the ring gland and the ovary, argue strongly for a role of dare in steroid hormone production. dare is the first Drosophila gene shown to encode a defined component of the steroid hormone biosynthetic cascade and therefore provides a new tool for the analysis of steroid hormone function. We have explored its role in the adult nervous system and found two striking phenotypes not previously described in mutants affected in steroid hormone signaling. First, we show that mild reductions of dare expression cause abnormal behavioral responses to olfactory stimuli, indicating a requirement for dare in sensory behavior. Then we show that dare mutations of intermediate strength result in rapid, widespread degeneration of the adult nervous system. INTRODUCTION associated with the endoplasmic reticulum (ER) (Miller, 1988). P450s require a pair of electrons and O2 to drive chemical modifications of substrates. Adrenodoxin reductase (AR) is a mitochondrial protein that transports electrons to all known mitochondrial P450s. It functions by transferring a pair of electrons from NADPH to another mitochondrial enzyme, adrenodoxin, which in turn donates these electrons to mitochondrial P450s (Miller, 1988), including the one required for the first step of steroid hormone synthesis. Thus, AR is essential for the synthesis of all vertebrate steroid hormones. In insects, the chemical intermediates in ecdysteroid synthesis have been extensively studied (Rees, 1985; Svoboda and Thompson, 1985); however, molecular and genetic characterization of the genes whose products catalyze steroid synthesis has been lacking. As in vertebrate steroid hormone metabolism, ecdysteroid production appears to require P450like enzymes (Grieneisen et al., 1993; Kappler et al., 1988; Smith et al., 1979). Mitochondrial P450-like enzymes are thought to hydroxylate ecdysteroid precursors in Locusta and Manduca, as evidenced by the blockage of these activities in mitochondrial extracts by inhibitors of P450 activity and the dependence of these reactions on NADPH (Grieneisen et al., 1993; Kappler et al., 1988). There is strong evidence that steroid biosynthesis depends on P450s in Drosophila also: Steroid hormones regulate a wide variety of developmental and physiological processes in animals. The study of insect model systems has contributed greatly to our understanding of steroid hormone regulation. Diverse aspects of insect biology, ranging from larval molting and metamorphosis to reproduction, are steroid hormone-dependent, and are thought to be mediated by a single class of steroid hormones, the ecdysteroids (Riddiford, 1993). Great progress has been made in recent years toward understanding the molecular and genetic mechanisms by which ecdysteroids regulate cellular responses (reviewed in Russell and Ashburner, 1996; Thummel, 1996). By contrast, remarkably little is known about a higher level in the control hierarchy: what regulates the regulator? The genes required for ecdysteroid biosynthesis remain largely unidentified; little is known about these genes or how they are regulated. In vertebrates, the first and rate-limiting step in the synthesis of all steroid hormones is the conversion of cholesterol to pregnenolone (Miller, 1988; Stone and Hechter, 1955). This step, like several others in steroid hormone synthesis, is catalyzed by a member of the cytochrome P450 family of enzymes (P450s), which are found either in mitochondria or Key words: Steroid hormone, Drosophila, Molting, Behavior, Neurodegeneration, dare, Olfaction 4592 M. R. Freeman and others application of a competitive inhibitor of P450 activity potently reduced ecdysteroid production by 80% in the Drosophila ring gland, the main steroid-producing organ in the larva (Grieneisen et al., 1993). Finally, antibody neutralization experiments in Spodoptera support a role for AR and certain P450s in insect steroid metabolism (Chen et al., 1994). AR, acting through its substrate adrenodoxin, is the only known electron donor for mitochondrial P450s. All well-characterized insect ecdysteroids contain hydroxyl groups believed to be added by mitochondrial P450s, suggesting a requirement for AR in the synthesis of all insect steroid hormones. Here we describe the dare gene and show that it encodes the Drosophila homologue of AR. Our study of this mutant provides the first genetic analysis in Drosophila of a defined component of the steroid hormone biosynthetic machinery. dare expression is most abundant in the two major steroid-producing tissues of Drosophila, the larval ring gland and adult ovary. Null mutants of dare exhibit defects in larval molting, while moderately strong mutants show delays in pupariation. These defects are rescued to a high degree by feeding the steroid hormone 20-hydroxyecdysone to mutant larvae, arguing strongly for a role for dare in steroid hormone synthesis. Steroid hormones are known to regulate diverse aspects of nervous system development and function (Levine et al., 1995; Truman, 1996). In insects, developmental events such as postembryonic neural proliferation, programmed cell death and neuronal remodeling are coordinated by the ecdysteroids. The role of ecdysteroids in adult nervous system function, however, remains largely unexplored. Here we document two phenotypes not previously described in mutants associated with steroid hormone signaling. We show that mild reduction of dare expression dramatically affects adult olfactory-driven behavior, and that dare mutants of moderate strength reach adulthood, but then exhibit rapid degeneration of the adult nervous system. MATERIALS AND METHODS Drosophila stocks The dare1 mutation was generated in a w1118 background using the PlacW construct as an insertional mutagen (Boynton and Tully, 1992). P-element excision lines were generated from w1118; dare1 using the ∆2-3 transposase (Robertson et al., 1988). darerv2 is an excision chromosome in which the transposable element has excised precisely, as determined by Southern analysis and PCR. The dare3 excision chromosome retains a portion of the PlacW insertion, as determined by Southern analysis, but has a disruption within the P element that inactivates the mini-white+ marker transgene (mini-w+), as indicated by its white eye color. dare3 responds similarly to dare1 in olfactory behavioral assays (e.g. Fig. 1), and was used as a recipient mutant for transformation rescue experiments: its w− eye allowed identification of transgenic animals containing the mini-w+-marked dare rescue constructs (described below; dare1 is mini-w+). Prior to testing in behavioral assays, excision lines were outcrossed for three generations to the w1118 control line and maintained as stocks over the second chromosome balancer CyO. Behavioral analysis Flies were tested for response to odors in the olfactory T maze paradigm (purchased from Parker-Hanaffin Corp., NJ) as described previously (Helfand and Carlson, 1989). Choice periods lasted for 30 seconds. Odorants were of the highest purity available: ethyl acetate and 3-octanol were from Fluka; 4-methylcyclohexanol was from Aldrich. Paraffin oil, which fails to evoke any appreciable olfactory response from Drosophila in the olfactory T maze, was used as a diluent for odorants. Isolation of genomic and cDNA clones and expression analysis Isolation and manipulation of nucleic acids were performed as described elsewhere (McKenna et al., 1994). Genomic DNA flanking the P-element insertion in dare1 was isolated by standard plasmid rescue techniques (Pirrotta, 1986) using the unique PstI and SacII restriction sites in the PlacW insert. A 13 kb PstI-SacII genomic fragment from this region was used as a probe to screen a Drosophila testis cDNA library that was kindly provided by T. Hazelrigg (Columbia Univ.). Two classes of cDNA clones were isolated, represented by 3B1 and 5A1 in Fig. 2A. The 2 kb HindIII-EcoRV fragment of genomic DNA spanning the P insertion site in dare1 was used to probe a Drosophila head cDNA library kindly provided by T. Schwarz (Stanford University), from which the W8 cDNA and several shorter, cross-hybridizing cDNAs were obtained. The cytological location of the P-element insertion in dare1 was determined by in situ hybridization to polytene chromosomes as described elsewhere (McKenna et al., 1994) using the PlacW element (Bier et al., 1989) as a probe. RNA isolations were performed as described elsewhere (Chomczynski and Sacchi, 1987). Poly(A)+ RNA was isolated using the Oligotex mRNA isolation kit (Qiagen, Chatsworth). RNAse protection assays were performed with the RPA II kit from Ambion (Austin, TX) according to the manufacturer’s instructions. The dare probe used was 423 bp in length, spanning the first intron of the dare gene. The protection of the labeled dare fragment was normalized against an internal standard, i.e. it was compared to the protection of a labeled 165 bp fragment that spans the first intron of the ribosomal protein rp49 gene (O’Connell and Rosbash, 1984). Yeast RNA provided with the Ambion RPAII kit (Austin, TX) was used as a negative control. Results from all experiments were quantitated on a phosphorimager (Molecular Dynamics). For whole-mount in situ hybridizations to ring glands, CNS/ring gland complexes were dissected from wandering third-instar larvae in PBS, fixed in 4% paraformaldehyde/PBS for 45 minutes, and then washed six times in 0.1% Tween 20/PBS (PBST) for 15 minutes each. Tissue was washed for 5 minutes in 1:1 PBST:hybridization buffer (50% formamide, 5× SSC, 50 µg/ml heparin, 0.1% Tween 20) and prehybridized for 2 hours at 55°C in hybridization buffer. Hybridizations were carried out for 18 hours at 55°C at probe concentrations of 5 ng/ml. The tissue was then washed for a total of 8 hours at 55°C, with several changes of hybridization buffer. Specimens were then washed for 5 minutes in 1:1 PBST:hybridization buffer, followed by six washes in PBST for 10 minutes each. In situ hybridizations to ovaries were performed as described elsewhere (Buszczak et al., 1999). dare-specific digoxigenin-labeled RNA probes were generated, hydrolyzed and detected according to the manufacturer’s instructions (Boehringer Mannheim, Indianapolis). Generation of dare transgenes Oligonucleotide primers (5′ GAGCGAATTCGAAGATCACCTAGCAAAC 3′ and 5′ GATCTCTAGAGGCACGAGCAGGCCTCAAACG 3′, respectively), which included the 5′ and 3′ terminal sequences of the W8 cDNA clone, were used for PCR amplification from the W8 cDNA. The amplification product was then subcloned into pCaSpeR-hs (Thummel and Pirrotta, 1992) using the EcoRI and XbaI restriction sites in the above primers. This P[hs-AR, mini-w+] construct is referred to as hs-AR. A 6.5 kb BamHI-ClaI genomic fragment that spans the dare gene and truncates 3B1 genomic sequences was subcloned from cosmid DNA spanning the dare region into the pCaSpeR4 transformation vector. A 0.5 kb SacI fragment was subsequently deleted from this Steroids, behavior and neural degeneration 4593 construct, removing 0.5 kb of 5A1 genomic sequences. This construct, which is expected to contain the complete dare gene but only partial copies of the two defined transcription units that flank dare, is referred to as GF-AR, an abbreviation for P[GF-AR, mini-w+]. GF-AR and hsAR were transformed into the w1118 background via standard germline transformation techniques (Spradling, 1986). Preparation of dare antibodies The carboxy-terminal portion of Dare (amino acids 237-466) was cloned into pMAL-c2 (New England Biolabs, Beverly). Fusion protein expression was induced in bacteria with 0.3 mM IPTG and the protein was affinity-purified on amylose resin according to the manufacturer’s instructions (New England Biolabs, Beverly). Immunization of mice and polyclonal antibody production were performed as described elsewhere (Hekmat-Scafe et al., 1997). The immunogen was a fusion protein containing the entire maltose binding protein (MBP) fused to the carboxy-terminal portion of Dare. Antiserum C40 was used in the current work; however, we note that antisera generated from three separate mice gave similar results. C40 antiserum was affinity-purified against MPB, using a fusion protein containing MBP and amino acids 2-208 of the Dare amino terminus coupled to nitrocellulose. Dare Cterminal-specific antibodies were then isolated by incubation of the purified antiserum with nitrocellulose coupled with a Dare C-terminal specific-MBP fusion protein. Bound antibodies were eluted with 4 M MgCl2 in the presence of 1% BSA and dialyzed against TBS. Western blot analysis Protein extracts from adult heads and larvae were prepared by homogenization and boiling in 50 mM Tris-HCl, pH 6.8, 2% SDS, 0.14 M β-mercaptoethanol. Mitochondrial suspensions were prepared as described elsewhere (Chen et al., 1994). Protein concentrations in extracts were determined using the Bio-Rad Protein Assay system. Prior to gel electrophoresis, protein extracts were boiled briefly in SDS sample buffer. To confirm the equal loading and transfer of protein among the lanes of a gel, protein blots were stained with Ponceau S. Blots were probed with affinity-purified anti-Dare at a dilution of 1:50, followed by an HRP-conjugated secondary antibody (Amersham, Arlington Heights) at a dilution of 1:10,000. Crossreacting bands were visualized using the ECL detection kit (Amersham, Arlington Heights). Developmental analysis dare alleles were crossed into a y w genetic background and maintained over the second chromosome balancer CyO y+. Larvae were collected from 6 hour egg lays, and dare homozygote larvae were distinguished from their siblings by their y− phenotype. Our initial observations indicated that all dare mutations (with the exception of the dare5 deletion, discussed below) cause little, if any, lethality during the embryonic or first larval instar stages: homozygous dare mutant larvae appeared at expected Mendelian ratios in populations of animals (n=200-300 larvae) at the secondinstar larval stage. For dare4 homozygotes, and dare4 in heterozygous combination with all other described alleles, viability was unaffected until the third larval instar. In subsequent experiments, animals collected for developmental analysis were second-instar larvae or older as indicated. For lethal phase analysis of dare excision mutants, groups of 20-30 larvae of the indicated genotypes were placed in fresh culture vials and allowed to develop at 25°C. dare5 is an embryonic lethal mutation that affects not only the dare gene (Fig. 2A) but also another gene required during embryonic stages; neither the hs-AR, nor GF-AR constructs rescue dare5 mutant animals beyond the embryonic stage, while dare102 homozygotes (a null dare mutation), and dare5/dare102 heterozygotes are rescued to adulthood by either transgene. Ecdysone-feeding experiments were similar to those described elsewhere (Garen et al., 1977). Briefly, to test the effects of 20hydroxyecdysone (20HE) feeding, larvae were collected from a single 6 hour egg lay and then divided into two groups. One group was fed 20HE (1 mg/ml, dissolved in a 10% ethanol solution), while the other, control group was fed 10% ethanol solution alone. For feeding, larvae were transferred into plastic vials containing only a piece of moistened filter paper on the wall of the vial to maintain humidity. Dry yeast were then placed at the bottom of the vial and wetted with 0.3 ml of either 20HE in 10% ethanol solution or 10% ethanol alone. Vials were then sealed with cotton plugs and incubated at 25°C. 20HE was from the Sigma Chemical Company. Histology Reduced silver staining procedures were performed as described elsewhere (Lipshitz and Kankel, 1985). Third-instar larvae were transferred to culture vials and allowed to develop at 25°C. Morphological markers were used to stage specimens in pupal cases (Bainbridge and Bownes, 1981) prior to fixation and embedding in paraffin. Animals were cut into 5 µm sections, stained and viewed by light microscopy. RESULTS dare mutants have defects in olfactory behavior that map to a P-element insertion The dare1 mutant (defective in the avoidance of repellents) was isolated in a screen for P-element-induced mutations that affect olfactory-driven learning and memory (Mihalek, 1995). dare1 was subsequently found to be defective in olfactory response per se, which is essential to the olfactory-driven learning paradigm. In an olfactory T maze, dare1 flies display striking abnormalities in their avoidance response to all olfactory repellents tested. Responses to three representative odors, 3octanol, ethyl acetate and 4-methylcyclohexanol, are shown in Fig. 1A. Control animals are strongly repelled by these stimuli, whereas dare1 flies display a severely reduced avoidance response. The dare1 mutation was induced by insertional mutagenesis using the PlacW transposable element. In situ hybridization of a PlacW probe to polytene chromosomes from dare1 revealed a single hybridization signal, located in cytogenetic region 47E. Southern analysis of dare1 genomic DNA confirmed that a single P-element insertion exists in the dare1 line. In order to determine whether the olfactory defects of dare1 are caused by the P insertion, we analyzed stocks derived from excision of the P element (Fig. 1B). The darerv2 precise excision line responds to the tested odors at control levels. In contrast, the dare3 excision stock (which was generated in parallel to darerv2 but which retained most of the P-element insertion) behaves similarly to dare1, displaying a reduced avoidance response to all odors tested. These data indicate that the dare1 olfactory defects result from the insertion of the P element. dare encodes adrenodoxin reductase, an enzyme required for steroid hormone synthesis We isolated genomic DNA surrounding the P insertion in dare1 and used it to screen Drosophila cDNA libraries. cDNA clones representing three transcriptional units were obtained and mapped to the dare insertion region (Fig. 2A). Multiple crosshybridizing cDNAs representing the transcriptional unit mapping closest to the P insertion in dare1 were recovered from a Drosophila head cDNA library. The 5′ end of one of these cDNAs, referred to as W8, maps 44 bp 3′ of the P-element insertion site. 5′ RACE experiments suggested that the 5′ end 4594 M. R. Freeman and others A 1 Response Index 0.8 0.6 + dare1 0.4 0.2 0 OCT Response Index B EA MCH 1 0.8 0.6 + darerv2 dare3 0.4 0.2 0 OCT EA MCH Fig. 1. The olfactory defects in dare map to a P-element insertion. Behavioral responses of flies to repellent odors were tested in an olfactory T maze. For all experiments, one arm of the T maze contained an air stream that passed over the indicated odor, while the other arm contained a control airstream that passed over the paraffin oil diluent. The response index is the number of flies in the control arm minus the number in the repellent arm, divided by the total number of flies. Thus, positive values indicate repulsion. All stocks were in a w1118 genetic background, including the control stock, which is labeled ‘+’. The odors were diluted v/v in paraffin oil as follows: 10−2 for 3-octanol (OCT); 5×10−2 for ethyl acetate (EA); 10−1 for 4-methylcyclohexanol (MCH). Error bars indicate s.e.m. Each value represents n=10 groups of 25-35 flies. (A) The dare1 mutant shows a reduced avoidance response to all olfactory repellents. For all odors, differences between the dare mutant and the control are significant at the P<0.0004 level. (B) Flies homozygous for the precise excision darerv2 respond to olfactory repellents at control levels, while flies homozygous for the dare3 insertion retain the olfactory defects. Differences between dare3 and the other two lines are significant at the P<0.005 level. of this transcriptional unit maps ~10 bp upstream from the P insertion. Consistent with these results, the sequence of an EST corresponding to W8 (ref. num. LD17269; Berkeley Drosophila Genome Project) contains a 5′ end which lies 14 bp 5′ of the P insertion in dare1. Analysis of cDNA sequences and hybridization patterns to northern blots of RNA isolated from whole flies has revealed only a single splice form for this gene. Quantitative RNAse protection assays using a W8 probe with whole-fly RNA revealed that transcript levels from this gene are reduced by ~40% in the dare1 mutant relative to control animals (Fig. 2B). W8 sequences are expressed in heads, where their transcript levels are reduced by ~45% in dare1 compared to control heads (Fig. 2C). Northern blots of whole-fly poly(A)+ RNA isolated from dare mutants and control lines indicate that the expression of 5A1 and 3B1, the two genes that flank the W8 gene, are unaffected by the dare1 mutation (data not shown). These data suggested that the W8 gene was likely to correspond to dare, a suggestion tested rigorously as described below. The W8 cDNA encodes a predicted Drosophila homologue of vertebrate adrenodoxin reductase (AR) (Fig. 2D) (Lin et al., 1990; Solish et al., 1988). In mammals, AR is required for synthesis of all steroid hormones (see Introduction). The amino acid sequence of Drosophila AR is 42% identical to human AR and shares conserved binding sites for an FAD moiety, and for NADPH (Fig. 2D). To determine whether dare encodes AR, we attempted to rescue the olfactory behavioral defects using two AR transgenes: an AR cDNA (hs-AR) and a genomic fragment that spans the AR gene but that truncates flanking genes (GF-AR). We found that the olfactory defects of dare3 were rescued by each of two AR constructs tested (Fig. 3). Taken together with the reduction of AR transcript levels in dare mutants, these results clearly indicate that dare mutations affect the AR gene and lead us to conclude that the AR gene and dare are the same. Henceforth, we will refer to the Drosophila adrenodoxin reductase gene as dare. dare expression is enriched in tissues that synthesize steroid hormones Steroid hormone synthesis in Drosophila occurs primarily in two organs, the larval ring gland and the adult ovary. In situ hybridization of dare RNA probes to third-instar larval ring glands and adult ovaries revealed that dare expression is greatly enriched in these tissues (Fig. 4A-C). Strong expression is observed within the portion of the ring gland referred to as the prothoracic gland, where the steroid hormone ecdysone is synthesized (Riddiford, 1993). Expression in the ovary is limited to the nurse cells of developing egg chambers. It is first detectable by in situ hybridization in stage 6-7 egg chambers. Expression levels rise until approximately stage 10 (Fig. 4C), and then remain high until nurse cell cytoplasmic dumping, which occurs at the end of oogenesis (data not shown). Low levels of expression have been observed in all adult tissues examined, including heads (Figs 2C, 5A, discussed below), dissected brain tissue, male bodies and adult antenna, by these methods, RT-PCR or RNAse protection. To characterize dare expression and localization further, we generated antibodies specific to the carboxy-terminal half of the Dare protein. On western blots of head protein extracts, anti-Dare antibodies react with a polypeptide band of approximately 55 kDa (Fig. 5A), which corresponds to the predicted size of Dare: 55 kDa. The identity of this 55 kDa species as the dare gene product is supported by two lines of genetic evidence. First, heat shock of a transformant line bearing the hs-AR construct led to an increase in the abundance of this band (Fig. 5A). Second, levels of this band are substantially reduced in dare mutants, but not in the precise excision darerv2. Moreover, the most severe reductions are observed in the most severe mutant combinations: animals bearing strong combinations of dare alleles (dare4/dare34 and dare4/dare5, described below), which die at late pupal stages or very shortly after eclosion, exhibit more severe reductions than do the viable mutants dare1 and dare3. In addition to these Steroids, behavior and neural degeneration 4595 1 dare A 1 kb CV B S BS SV H 5' P 3' dare (W8) 5A1 P C P Sa C dare102 dare 34 dare5 dare4 75 50 0 + dare1 Yeast RNA 25 Head 100 75 50 25 0 + dare1 Yeast RNA Whole-fly 100 Relative Protection of Labelled W8 Fragment (%) C Relative Protection of Labelled W8 Fragment (%) B 3B1 D Dros DrosARAR Human Human AR AR MGINC----- LNIFRRG-LH --TSSARL-Q VIQSTTPTKR ICIVGAGPAG MASRCWRWWG WSAWPRTRLP PAGSTPSFCH HFSTQEKTPQ ICVVGSGPAG 41 50 DrosARAR Dros Human AR AR Human FYAAQLILKQ LDNCVVDVVE KLPVPFGLVR FGVAPDHPEV KNVINTFTKT FYTAQHLLKH PQAHV-DIYE KQPVPFGLVR FGVAPDHPEV KNVINTFTQT 91 99 Dros DrosARAR Human Human AR AR AEHPRLRYFG NISLGTDVSL RELRDRYHAV LLTYGADQDR QLELENEQLD AHSGRCAFWG NVEVGRDVTV PELQEAYHAV VLSYGAEDHR ALEIPGEELP 141 149 Dros DrosARAR Human Human AR AR NVISARKFVA WYNGLPGAEN LAPDLSGRDV TIVGQGNVAV DVARMLLSPL GVCSARAFVG WYNGLPENQE LEPDLSCDTA VILGQGNVAL DVARILLTPP 191 199 Dros ARAR Dros Human Human AR AR DALKTTDTTE YALEALSCSQ VERVHLVGRR GPLQAAFTIK ELREMLKLPN EHLERTDITK AALGVLRQSR VKTVWLVGRR GPLQVAFTIK ELREMIQLPG 241 249 Dros DrosARAR Human Human AR AR VDTRWRTEDF SGIDMQLDKL QRPRKRLTEL MLKSLKEQ-G RISGSKQFLP ARPILDPVDF LGLQDKIKEV PRPRKRLTEL LLRTATEKPG PAEAARQASA 290 299 Dros DrosARAR Human Human AR AR I------FLR APKAIAPGEM EFSVTELQQE AAVPTSSTER LPSHLILRSI SRAWGLRFFR SPQQVLPSPD GRRAAGVRLA VTRLEGVDEA TRAVPTGDME 334 349 Dros DrosARAR Human Human AR AR GYKSSCVDTG INFDTRR-GR VHNINGRI-L KDDATGEV-D -PGLYVAGWL DLPCGLVLSS IGYKSRPVDP SVPFDSKLGV IPNVEGRVMD VPGLYCSGWV 380 399 Dros DrosARAR Human Human AR AR GTGPTGVIVT TMNGAFAVAK TICDDINTNA LDTSSVKPGY DA-------D KRGPTGVIAT TMTDSFLTGQ MLLQDLKAGL L-PSGPRPGY AAIQALLSSR 423 448 Dros DrosARAR Human Human AR AR GKRVVTWDGW QRINDFESAA GKAKGKPREK IVSIEEMLRV AGV GVRPVSFSDW EKLDAEEVAR GQGTGKPREK LVDPQEMLRL LGH 466 491 reductions observed in adult heads, the levels of this 55 kDa band are reduced in extracts from dare second-instar larvae, with no product detectable in the strong allele dare34 (Fig. 5B). Cell fractionation experiments with Drosophila heads suggest that dare is localized primarily to mitochondria, and not to the ER (Fig. 5C), consistent with the mitochondrial localization of AR in vertebrate cells. dare is required for steroid-mediated developmental transitions Pulses of ecdysteroids govern many developmental transitions Fig. 2. Molecular characterization of dare. (A) The dare insertion region. The intron-exon maps of the dare gene (to which the W8 cDNA corresponds) and other genes in the region are shown below the restriction map. The structures of the other genes have not been examined in as much detail as dare. For dare, black boxes represent coding regions, and open boxes represent untranslated regions. The PlacW element is not drawn to scale. The 5′ to 3′ orientation of the lacZ reporter gene is from left to right. The dare deletions are shown below the restriction map. The solid lines indicate regions that are present; dashed lines represent regions of uncertainty. The dare102 deletion was defined precisely by PCR amplification and sequence analysis (the deletion begins 8 bp 3′ of the dare1 P-element insertion site). For dare34, dare4 and dare5, 3′ deletion breakpoints were determined by Southern analysis. The 5′ deletion endpoints for dare34, dare4, and dare5 have not been mapped. It is possible that some of the DNA indicated as deleted in dare34 may be present in a rearranged form elsewhere in the genome. P, PstI; V, EcoRV; B, BamHI; S, SacI; H, HindIII; C, ClaI; Sa, SalI. (B) Quantitative RNase protection assays reveal a reduction of ~40% in levels of dare RNA in whole fly poly(A)+ RNA. Values indicate the means of two independent experiments. (C) Reduction of 45% in levels of dare RNA in head poly(A)+ RNA. n=3 independent experiments. (D) Alignment of the predicted amino acid sequence of dare (Dros AR) and human adrenodoxin reductase (Human AR). Amino acid identities are boxed. The first and second black bars underline the conserved FAD binding (GXGXXG) and NADPH binding sites (GXGXXA), respectively. Sequences were aligned using GeneWorks (IntelliGenetics, Mountain View, CA). The GenBank accession number for the dare cDNA sequence is AF168685. in Drosophila including larval molting, pupariation and metamorphosis (Riddiford, 1993). To determine whether the dare gene plays a role in these processes, we generated stronger dare alleles by excision of the P-element insertion in dare1 and investigated their effects on development. The dare102 mutation is a deletion that begins in the dare 5′ untranslated region and ends in the dare 3′ untranslated region, thereby removing the entire dare coding region (Fig. 2A). Thus, the dare102 mutation is a molecular null for the dare gene, and does not extend into other genes lying beyond the 5′ and 3′ boundaries of dare. The dare34 excision mutation is also a deletion that likely removes the entire dare gene, although it has not been defined as precisely as dare102 in molecular terms (Fig. 2A). Dare protein is undetectable in western blots of dare34 second-instar larvae (Fig. 5B), indicating that dare34 is also a molecular null allele. dare102 causes lethality primarily during the second larval instar (Table 1; see also Fig. 6B below). 91% of dare102 animals die as second instar larvae, 6% die at the second to third instar larval molt, and only 3% survive to the third larval instar. Animals that die at the second larval molt have a distinct morphology (Fig. 6A). They have two pairs of mouth hooks, one pair with morphology similar to those of second-instar larvae, and a second pair similar to those of third-instar larvae. These animals also have compound anterior spiracles that are a combination of those from second instar and third instar larvae. The death of many dare102 animals prior to the second larval molt is consistent with a requirement for dare in the initiation of this molt. In addition, as many of these mutants die in the late stages of the molting process (as in Fig. 6A), dare also appears to be required for the completion of the second larval molt. 4596 M. R. Freeman and others 0.7 Response Index 0.6 0.5 0.4 0.3 0.2 0.1 0 3-OCT EA MCH + dare 3; hs-AR dare 3 dare 3; GF-AR Fig. 3. Olfactory responses are rescued by adrenodoxin reductase transgenes. (A) The hs-AR and GF-AR transgenes were crossed into the dare3 mutant background and tested in the T maze. All lines were in a w1118 genetic background. Error bars indicate s.e.m. Each value represents n=10 groups of 25-35 flies. Odors were diluted v/v in paraffin oil as follows: 10−2 for 3-octanol (OCT); 5×10−2 for ethyl acetate (EA); 5×10−2 for 4-methylcyclohexanol (MCH). Flies were reared and tested at 22°C. The hs-AR transgene was not induced by heat shock in this experiment, i.e. the levels of AR RNA transcribed from the leaky heat-shock promoter were sufficient to rescue the phenotype. Differences between dare3 and all other lines for 3-OCT, EA, and MCH are significant at the P<0.04, P<0.03 and P<0.002 levels, respectively. The dare34 mutation also causes lethality during larval stages, again with most animals dying either at the second instar or at the second to third instar larval molt, with the remaining individuals dying as third instar larvae, failing to pupariate (Table 1; see also Fig. 6B below). Both dare102 (Table 1) and dare34 (not shown) mutant animals are rescued to adulthood by either the hs-AR or GF-AR transgene, indicating that the developmental lethality of both mutations arises exclusively from mutation of the dare gene. Rescue of developmental lethality with the hs-AR construct occurred even Fig. 5. Anti-Dare antibodies reveal the reduction or absence of Dare protein in dare mutants. Within each blot, equal amounts of protein were loaded in each lane. (A) Head protein extracts. Molecular weight markers (kDa) are indicated on the left. The arrowhead indicates Dare. The fainter band visible below Dare in most tracks is likely to be a Dare degradation product; its abundance correlates with the amount of Dare protein except in the case of heat-shocked animals. A long exposure of the immunoblot (not shown) reveals very weak bands in lanes 5 and 6, indicating that these mutants do not completely lack Dare protein. Dare protein level is increased following heat shock (1 hour at 37°C) in the dare4/dare5; hs-AR construct (lane 8); the uninduced level in this strain is greater than that in the dare4/dare5 strain, indicating some expression in the absence of induction. (B) Dare protein levels in extracts from second instar larvae are reduced in dare4 and undetectable in dare34. (C) Cellular fractionation of Drosophila heads reveals that Dare is found primarily in the fraction containing mitochondria. W, whole tissue; M, mitochondrial fraction; S, supernatant. Fig. 4. dare is expressed in tissues that synthesize steroid hormones. Antisense (A,C) and sense (B) dare RNA probes were hybridized to ring glands dissected from wandering third-instar larvae (A,B) and adult ovaries (C) from the w1118 control line. Note the lack of staining in the cells adjacent to the ring gland (A, bottom). dare expression in the ovary is only detected in the nurse cells of developing egg chambers. No label was detected in ovaries hybridized with the dare sense strand control probe (not shown). in the absence of heat shock, as if low levels of leaky dare expression were sufficient for full rescue (evidence for low levels of expression in the absence of heat shock is shown in Fig. 5A). Do dare mutants exhibit defects in larval molting because of a steroid deficiency? To test this possibility, we collected dare102 and dare34 larvae at the second instar and fed them the insect molting hormone 20-hydroxyecdysone (20HE). For both mutants, feeding with 20HE had a striking effect, providing substantial rescue of the development defects (Fig. 6B). Specifically, the per cent of dare102 larvae progressing to or beyond the second larval molt increased from 7% in control dare102 animals to 70% in dare102 animals fed 20HE. Similarly, the per cent of dare34 larvae progressing to or beyond the Steroids, behavior and neural degeneration 4597 Fig. 6. dare mutants have defects in larval molting and pupariation that are rescued by 20-hydroxyecdysone (20HE) feeding. (A) A dare34 larva, with two pairs of mouth hooks, one pair resembling those of a second-instar larva (small arrows), and the other pair resembling those of a third-instar larva (large arrows). The larva also has compound anterior spiracles, composed of spiracles characteristic of a second-instar larva (small arrowhead) and spiracles characteristic of a third-instar larva (large arrowheads). (B) dare mutant defects in molting are rescued by 20HE feeding. A total of 107-180 larvae were tested per genotype per condition. All larvae were fed yeast paste wetted with a 10% ethanol solution with (+) or without (−) 1 mg/ml 20HE. Animals were scored as dying at the second larval molt (i.e. 2/3 molt) if they had either two sets of mouth hooks or compound anterior spiracles, as shown in (A). 2nd, second instar larval stage; 2/3 molt, second larval molt; 3rd, third instar larval stage. (C) dare mutants exhibit a delay in pupariation that is rescued by 20HE feeding or by a dare transgene. Each value represents n=5 groups of 10-12 larvae. Error bars indicate s.e.m. The percentage of animals pupariating was calculated 48 hours after control animals began pupariating. B Percent Animals Dying at Indicated Larval Stage 100 - 20HE + 20HE 75 50 25 0 2nd 2/3 molt 3rd dare102 Percent Animals Pupariating @ 48hrs APF C 2nd 2/3 3rd molt dare34 100 75 50 25 0 + dare 4 dare 5 dare 4 dare 4 ; hs-AR dare 5 dare 5 (+ 20HE) second larval molt increased from 21% in control dare34 animals to 93% in animals fed 20HE. To expand our understanding of dare gene function at other developmental times, we sought to analyze mutations intermediate in severity between the weak, homozygous viable alleles dare1 and dare3, and the strong, presumptive null alleles dare102 and dare34. One such intermediate allele is dare4. The dare4 mutation is a deletion that removes genomic sequences 5′ to the P-element insertion site, presumably removing dare regulatory sequences, but leaving the dare coding region entirely intact. Western blot analysis of protein extracts from dare4 mutant larvae indicates that this mutation reduces, but does not abolish, Dare protein levels (Fig. 5B). However, the dare4 mutation is not dare-specific. While the molecular extent of the deletion has not been determined, it clearly affects at least one transcription unit besides dare (5A1 in Fig. 2A). Moreover, the hs-AR and GF-AR transgenes do not rescue the lethality of dare4 homozygotes. We therefore have analyzed dare4 in heterozygous combination with two other deletions, dare34 (described above) and dare5 (Fig. 2A); the developmental lethality of both of these combinations is rescued by both hs-AR and GF-AR transgenes (not shown), indicating that their developmental defects map to dare. The utility of these heterozygotes is that they contain intermediate levels of dare function, allowing us to gain insight into additional roles of dare. Interestingly, dare4/dare5 heterozygote larvae exhibit a delay in pupariation, the steroid-mediated transition from the thirdinstar larval stage to the prepupal stage. In synchronous cultures of larvae, only 34% of dare4/dare5 larvae pupariate during the 48 hour period following the pupariation of the first control larva (Fig. 6C). By contrast, 100% of control larvae pupariate during this 48 hour period. To confirm that this pupariation defect does in fact derive from a lack of dare function, and more particularly from a lack of steroid hormone consequent to insufficient dare function, we performed two additional rescue experiments. We first tested the ability of the hs-AR transgene to rescue the phenotype, and found that dare4/dare5 pupariation rates increased dramatically to 80% (Fig. 6C). We then tested whether feeding with 20HE could rescue the defect, and again found that pupariation increased to 80%. These results confirm a role for dare in pupariation, and provide further strong support for a role of dare in steroid hormone synthesis. Although pupariation is delayed, all or nearly all dare4/dare5 and dare4/dare34 eventually pupariate (Table 1). These animals 4598 M. R. Freeman and others Table 1. Lethal phases of dare P-element excision mutants Larval stages Genotype1 + dare102 dare34 dare4 dare4/dare5 dare4/dare34 dare102; hs-AR 2nd Instar (%) 2/3M2 (%) 3rd Instar (%) Prepupa3 (%) Early/mid pupa3 (%) 0 91 51 05 05 05 2 0 6 30 05 05 05 0 0 3 19 0 0 0 1 0 0 0 14 2 1 1 0 0 0 86 6 2 1 Late pupa/ pharate adult3,4 (%) Eclosed (%) Total no. of larvae 0 0 0 0 39 30 1 100 0 0 0 546 676 94 152 205 201 105 206 207 164 1All stocks were in a y w genetic background. 2Indicates animals that died during the second larval molt. 3Morphological markers representative of the indicated developmental stages were scored according to Bainbridge and Bownes (1981). 4Animals were categorized as late pupae or pharate adults if they had undergone bristle pigmentation. 5Larvae of these genotypes were selected at the third larval instar, as early larval lethality was not observed in previous experiments (see methods). 6100% of these animals died within 7 days of eclosion. then undergo premature lethality, with a lethal phase intermediate between those of null and viable dare genotypes. Specifically, the majority of these heterozygotes die late in metamorphosis or early in adult life (Table 1). A large fraction, 39% of dare4/dare5 and 30% of dare4/dare34 mutant animals, die late in pupation, most of these while attempting to eclose. Most animals, however, successfully eclose, but all eclosed flies then die within 7 days. While alive, these adult animals show an extreme behavioral phenotype: they are unable to stand, lying on the substratum with legs and wings twitching. The adult lethality and behavioral uncoordination were rescued by either the hs-AR or GF-AR transgenes. Rescue was complete in quantitative measurements of olfactory response for the one genotype examined, dare4/dare5, following introduction of the hs-AR transgene: response of the transformants to 4-methyl cyclohexanol was indistinguishable from control levels (not shown). dare mutations cause degeneration of the adult nervous system The severe uncoordination of dare4/dare5 and dare4/dare34 mutants, a phenotype that could be rescued by dare transgenes, prompted us to examine the gross nervous system morphology of these animals. Striking degeneration was observed in the nervous systems of both mutants. Particularly prominent was the appearance of large vacuoles in a variety of brain regions, including the antennal lobes (Fig. 7A), the optic lobes (e.g. 7F), the ellipsoid body and fan-shaped body of the central complex (not shown), and the thoracic nervous system (Fig. 7I). Examination of the nervous system at several developmental times indicated that the vacuoles in the optic lobes appear after optic lobe assembly is complete, or largely complete. Fig. 7C shows wild-type optic lobes; Fig. 7D shows the optic lobes of a mutant, which appear similar, at the end of pupal development (the pharate adult stage). Thus at a gross scale, visual system morphology appears to develop normally in the mutants. However, shortly after eclosion, small vacuoles can be seen in all regions of the optic lobes except the lamina (Fig. 7E, note inset). The vacuoles enlarge as the animal ages: by 2.5 days after eclosion the vacuoles are much larger, and are readily observed in the lamina (Fig. 7F). These defects were observed both in dare4/dare5 and dare4/dare34, and map to the dare gene, since they are fully rescued by animals bearing the hs-AR transgene (Fig. 7G). Similarly, other brain regions and the thoracic nervous system appear to assemble normally and then undergo degeneration. The earliest evidence of vacuoles that we have observed was in the ellipsoid body and fan-shaped body, where degeneration first became apparent during the late pupal stages. We have not detected gross degeneration in the antenna, either by silver staining or by immunohistochemistry with an antiElav antibody; these results are consistent with the normal physiology that we have observed in measurements of electroantennogram and electropalpogram amplitude and kinetics following stimulation with odorants (e.g. EAG response amplitude to a 10−2 dilution of ethyl acetate was 12.2±1.0 mV for dare1 and 13.0±1.0 mV for the control; n=5 animals in each case). In all portions of the nervous system where degeneration was observed, the anatomical phenotype was fully rescued by the hs-AR transgene. We have not observed neural degeneration in the weaker alleles dare1 and dare3, even when animals are aged 3-4 weeks. DISCUSSION dare is defective in a defined component of the steroid hormone synthesis pathway We have shown that the dare mutant is defective in AR, an enzyme that acts in the synthesis of all mammalian steroid hormones. We have found that, in Drosophila, the gene is expressed at highest levels in the two tissues that are the primary sites of steroid hormone synthesis. Genetic analysis of dare shows that its activity is required for the molt from second to third larval instars, and for pupariation; both of these developmental transitions follow pulses of steroid hormone in wild-type. Both of these phenotypes are rescued, to a high degree, by feeding steroid hormone to dare larvae. These results indicate that the molting and pupariation defects are due either exclusively or primarily to a reduction in steroid hormone levels. Taken together, the simplest interpretation of all our data is that AR, the product of the Drosophila dare gene, plays an essential role in the steroid hormone synthetic pathway. Thus we have provided genetic and molecular evidence that AR is required for steroid hormone synthesis in Steroids, behavior and neural degeneration 4599 insects, and that AR is required both for molting and Requirements for dare in steroid hormone-mediated pupariation. developmental transitions Several other Drosophila mutants associated with Pulses of steroid hormones during larval life initiate molts and abnormal ecdysone metabolism have been described pupariation in insects (Riddiford, 1993). Consistent with a role previously, but none has been shown to contain a defined for dare in steroid metabolism, the null mutants dare102 and lesion in the ecdysteroid biosynthetic pathway. These mutants have been widely used to analyze the role of steroid hormones in Drosophila development and have been very informative in a variety of ways, but they suffer the limitation that the molecular nature of their defects either has not been defined or has been shown not to lie in the steroid biosynthetic pathway. Such mutants include ecdysoneless1 (ecd1), a temperature-sensitive (ts) mutant that fails to pupariate if shifted to the restrictive temperature during the early third instar (Garen et al., 1977). Subsequent work showed ecd1 to exhibit a wide variety of phenotypes not necessarily attributable to an ecdysone deficiency (Redfern and Bownes, 1983; Sliter, 1989). It has been proposed that ecd1 may affect the intracellular transport of steroid hormone precursors (Warren et al., 1996). It has also been proposed that the ecdysone deficiency in ecd1 results from cell death and an inhibition of tissue growth (Redfern and Bownes, 1983) and the molecular nature of ecd1 remains unknown. Another useful mutation has been l(3)DTS3, a dominant ts mutant which, under restrictive conditions, causes developmental arrest at the third instar and ultimately lethality (Holden and Suzuki, 1973). A third mutation, giant (gt), is also associated with abnormal ecdysone production and molecular analysis has revealed that it encodes a b-ZIP transcription factor expressed in a variety of tissues and developmental times (Capovilla et al., 1992; Schwartz et al., 1984). In addition to these three mutants, there are several others associated with abnormal Fig. 7. Degeneration of the adult ecdysone metabolism, but we are aware of none nervous system in dare mutants. All in which the defect has been shown to lie in the images are of 5 µm horizontal sections of animals embedded in paraffin, steroid biosynthesis pathway. In addition to the fact that the dare defect has stained by a reduced silver method, and been assigned to a defined step of ecdysteroid viewed by phase contrast microscopy. (A) Vacuoles (arrowheads) are apparent biosynthesis, dare is also of interest in that it is in the antennal lobe in a dare4/dare34 likely to affect production of all steroid hormones adult 2.5 days posteclosion. The star (see Introduction). If hormones other than 20HE indicates the antennal nerve, visible on play important roles in Drosophila development, one half of the preparation in this plane of section. (B) Control antennal lobe (w1118, then genetic analysis of components that respond the control for the dare genetic background) at <5 days posteclosion. (C) The visual only to 20HE may give an incomplete system of a control animal (w1118). r, retina; l, lamina; m, medulla; lc, lobula understanding of the role of steroid hormones as complex. (D) a dare4/dare34 animal at the late pupal/pharate adult stage. The a class. At the same time, we note the possibility morphology appears normal in all portions of the visual system at this stage. 4 34 that genetic manipulation of dare may have (E) dare /dare , within minutes after eclosion. Degeneration is apparent in the lobula complex and medulla. The inset is a higher magnification view of the boxed pleiotropic effects unrelated to steroid region; arrowheads indicate vacuoles. (F) A dare4/dare34 animal 2.5 days after metabolism; we therefore attempted to rescue by eclosion shows severe degeneration throughout the visual system, including the 20HE feeding of larvae the two dare phenotypes lamina (compare to E). (G) The visual system of a dare4/dare5; hs-AR animal, that could be so tested. A striking rescue effect showing normal morphology. (H) A thoracic ganglion from a control animal (w1118). was obtained in both cases, providing strong (I) Thoracic ganglion from a dare4/dare34 animal 2.5 days after eclosion. Note that evidence that hormone insufficiency was in fact the magnification in this panel and in H is lower than in other panels. Magnifications are 400× for A,B; 300× for C-G; 250× for H,I. the principal cause of these phenotypes. 4600 M. R. Freeman and others dare34 arrest developmentally during the second larval instar or at the second larval molt. dare mutants arrested at the second larval molt have a phenotype that has not previously been described to our knowledge: compound anterior spiracles whose morphology resembles those of molting wild-type second-instar larvae (Fig. 6A) (Manning and Krasnow, 1993). They also have two pairs of mouth hooks, one pair characteristic of second-instar larvae and one of third-instar larvae (Fig. 6A). This phenotype is very similar to that observed in some mutants of the ecdysone receptor, EcR (Schubiger et al., 1998), further supporting the notion that dare mutants are affected in steroid hormone signaling. Animals with intermediate levels of dare function (dare4/dare5) survive through the larval stages but are delayed in pupariation and die at the end of metamorphosis (Table 1). Thus dare is required for multiple developmental transitions that are governed by steroid hormones. The rescue of both molting and pupariation defects by ecdysone feeding (Fig. 6B,C), along with the localization of dare expression in steroid biosynthetic tissues, provides strong evidence that dare is required for steroid hormone synthesis. Our detection of dare expression in ovaries is of interest in several respects. First, dare expression in the ovary is limited to the nurse cells of developing Drosophila egg chambers. This localization was surprising in light of biochemical studies of steroid production in ovaries dissected from locusts and cockroaches, which suggested that steroid hormone synthesis takes place in the somatic follicle cells surrounding the oocyte (Lagueux et al., 1977; Zhu et al., 1983). A second interesting finding was the timing of dare expression during oogenesis. It is first detectable at stage 6-7 just prior to the onset of vitellogenesis and then increases dramatically at later stages of oogenesis. The timing of dare expression and its correlation with the onset of early ecdysone responsive gene expression (Buszczak et al., 1999) raises the interesting possibility that the induction of steroid hormone synthesis in individual egg chambers may play a role in progression to the vitellogenic phase. Indeed, germline clones of dare and other genes in the ecdysone response hierarchy each show arrest by mid oogenesis (Buszczak et al., 1999). The ovarian expression of dare may also explain another interesting finding: the survival of dare null mutants to the second instar. Ecdysteroids are believed to play important roles during embryogenesis and during the first larval molt (Hoffmann and Lagueux, 1985; Riddiford, 1993), and some mutations removing EcR gene function result in embryonic lethality (Bender et al., 1997). Why are dare mutants not blocked in embryogenesis or at the first larval molt? One possible explanation is that the ovarian expression of dare may provide a maternal contribution of AR to the embryo. Such a maternal contribution of dare protein would be consistent with our detection of Dare protein in 0-2 hour embryos by Western blotting (A. D., unpublished results), and might be sufficient to drive development of dare mutants to the second larval instar. Alternatively, the survival of null mutants to the second instar may be driven wholly or in part by maternally contributed ecdysteroids. Indeed, nurse cells are known to deposit into the Drosophila oocyte products required for embryogenesis (Spradling, 1993), and maternal contributions of ecdysteroids have been documented in many insect species (Hoffmann and Lagueux, 1985). Since nurse cells are the only cells of the female germline in which dare is expressed, nurse cells would likely be the site of synthesis of such maternally contributed ecdysteroids in Drosophila. dare mutations cause defects in sensory behavior and neural degeneration The role of steroid hormones in nervous system development and function is a major topic in contemporary neurobiology. However, the power of Drosophila genetics has only recently been brought to bear on this problem. There has been little analysis of nervous system development or function in the previously isolated ecdysone-deficient mutants described above. At the same time, it is clear that at least some of these mutations have effects on the nervous system: for example, in ecd1, the brain size of non-pupariating larvae is smaller than that of wild-type (Redfern and Bownes, 1983), and there is a disruption of the progression of the morphogenetic furrow in the developing eye (Brennan et al., 1998). A genetic analysis of the ecdysone-triggered regulatory hierarchy in the central nervous system has been performed using mutants of the Broad-Complex (BR-C) (Restifo and Merrill, 1994; Restifo and White, 1991). The BR-C is among the set of ‘early genes’ that are directly induced by ecdysone, and it encodes a set of zinc-finger transcription factors. BR-C mutants, despite their apparently normal larval CNS structure, show a variety of defects in CNS maturation during metamorphosis. Among these are the abnormal positioning of the optic lobes, abnormalities in the internal organization of the optic lobes, and failure of the right and left brain hemispheres to fuse. BR-C is also required for normal progression of the furrow in the developing eye (Brennan et al., 1998). Although the analysis of BR-C mutant defects has been highly informative, it may not reveal the full panoply of hormone action in metamorphosis: there is evidence for one or more steroid-regulated pathways that are independent of BR-C (Restifo et al., 1995). The ecdysone receptor, which lies between ecdysone and the BR-C in the steroid-triggered regulatory hierarchy, has been analyzed with respect to its expression pattern in the developing nervous system (Truman et al., 1994). The results show that different protein isoforms of the receptor are expressed in different subsets of neurons, and that there is a correlation between isoform expression and neuronal fate. Recently, a mutation of the ecdysone receptor has been shown to cause defects in the metamorphosis of larval neurons (Schubiger et al., 1998). dare provides a new tool for the analysis of steroid hormone function. Here, using dare mutants, we have identified two new potential roles for these hormones in the Drosophila nervous system. The original dare1 allele, as well as another weak dare allele, dare3, both show dramatic changes in behavioral responses to olfactory stimuli. More severe reductions in dare activity affect the nervous system more profoundly: dare4/dare5 and dare4/dare34 animals assemble an adult nervous system that appears normal in gross morphology, but that then undergoes rapid and widespread degeneration. dare is therefore required for sensory behavior and to maintain the integrity of the adult nervous system. Efforts to establish the phenocritical period of dare function by heat-shock-induced expression of dare have been unsuccessful, owing to the rescue of dare phenotypes by the Steroids, behavior and neural degeneration 4601 levels of dare produced in the absence of heat shock. However, conditional expression of dare may be accomplished by other means, and could determine whether the behavioral and neurodegenerative phenotypes of dare mutants represent a requirement for dare gene function in the nervous system during development, during the adult stage, or both. One possibility is that there are developmental abnormalities that are not severe enough to produce gross structural defects during assembly, but which lead eventually to disintegration of nervous system morphology. Alternatively, dare may be required during adulthood for the normal physiology of the nervous system. Steroid hormones are apparently synthesized within the mammalian nervous system (Baulieu, 1997), in which AR, adrenodoxin and mitochondrial P450s are expressed (Brentano et al., 1992; Le Goascogne et al., 1987; Mellon and Deschepper, 1993; Stromstedt and Waterman, 1995). Moreover, steroid hormones have a variety of welldocumented effects on mammalian neurophysiology (Paul and Purdy, 1992) and behavior (e.g. Flood et al., 1992; Kelley, 1997; Moore and Miller, 1984; Weeks and Levine, 1995). Our characterization of dare lays a foundation for further studies that should provide valuable insight into the role of steroid hormones in nervous system development and function. We are extremely grateful to Mike Buszczak, other members of the Segraves laboratory, and members of the Carlson laboratory for insight, discussion and advice. We thank Tim Tully for generously providing us with the dare1 allele, Elizabeth Vallen for isolation of clones, help with in situ hybridizations to polytene chromosomes, and electrophysiology, Greg Fitzgerald for expert technical advice with the histochemistry, Doug Kankel for helpful discussions, and Lapulapu Tiro for superb technical assistance. This work was supported by grants from the NSF and the NIH to J. R. C. and by a predoctoral fellowship to M. F. (NIH F31-MH11839). REFERENCES Bainbridge, S. P. and Bownes, M. (1981). Staging the metamorphosis of Drosophila melanogaster. J. Embryol. Exp. Morph. 66, 57-80. Baulieu, E. E. (1997). Neurosteroids: Of the nervous system, by the nervous system, for the nervous system. Rec. Prog. Hormone Res. 82, 1-32. Bender, M., Imam, F. B., Talbot, W. S., Ganetzky, B. and Hogness, D. S. (1997). Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell 91, 777-788. Bier, E., Vaessin, H., Shepherd, S., Lee, K., McCall, K., Barbel, S., Ackerman, L., Carretto, R., Uemura, T., Grell, E. et al. (1989). Searching for pattern and mutation in the Drosophila genome with a P-lacZ Vector. Genes Dev. 3, 1273-1287. Boynton, S. and Tully, T. (1992). latheo, a new gene involved in associative learning and memory in Drosophila melanogaster, identified from P element mutagenesis. Genetics 131, 655-672. Brennan, C. A., Ashburner, M. and Moses, K. (1998). Ecdysone pathway is required for furrow progression in the developing Drosophila eye. Development 125, 2653-2664. Brentano, S. T., Black, S. M., Lin, D. and Miller, W. L. (1992). cAMP posttranscriptionally diminishes the abundance of adrenodoxin reductase mRNA. Proc. Nat. Acad. Sci. USA 89, 4099-4103. Buszczak, M., Freeman, M. R., Carlson, J. R., Bender, M., Cooley, L., and Segraves, W. A. (1999). Ecdysone response genes govern egg chamber development during mid-oogenesis in Drosophila. Development 126, 45814589. Capovilla, M., Eldon, E. and Pirrotta, V. (1992). The giant gene of Drosophila encodes a βZIP DNA-binding protein that regulates the expression of other segmentation gap genes. Development 114, 99-112. Chen, J.-H., Hara, T., Fisher, M. J. and Rees, H. W. (1994). Immunological analysis of developmental changes in ecdysone 20-mono-oxygenase expression in the cotton leafworm, Spodoptera littoralis. Biochem. J. 299, 711-717. Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159. Flood, J. F., Morley, J. E. and Roberts, E. (1992). Memory-enhancing effects in male mice of pregnenolone and steroids metabolically derived from it. Proc. Nat. Acad. Sci. USA 89, 1567-1571. Garen, A., Kauvar, L. and Lepesant, J.-A. (1977). Roles of ecdysone in Drosophila development. Proc. Nat. Acad. Sci. USA 74, 5099-5103. Grieneisen, M. L., Warren, J. T. and Gilbert, L. I. (1993). Early steps in ecdysteroid biosynthesis: Evidence for the involvement of cytochrome P450 enzymes. Insect Biochem. Molec. Biol. 23, 13-23. Helfand, S. and Carlson, J. (1989). Isolation and characterization of an olfactory mutant with a chemically specific defect. Proc. Nat. Acad. Sci. USA 86, 2908-2912. Hekmat-Scafe, D., Steinbrecht, R. and Carlson, J. R. (1997). Co-expression of two odorant-binding protein homologs in Drosophila. J. Neurosci. 17, 1616-1629. Hoffmann, J. A. and Lagueux, M. (1985). Endocrine aspects of embryonic development in insects. In Comprehensive Insect Physiology,Biochemistry, and Pharmacology, vol. 1 (ed. G. A. Kerkut and L. I. Gilbert), pp. 435-460. Oxford: Pergamon Press. Holden, J. J. A. and Suzuki, D. T. (1973). Temperature sensitive mutations in Drosophila melanogaster. XII. The genetic and developmental effects of dominant lethals on chromosome 3. Genetics 73, 445-458. Kappler, C., Kabbouh, M., Hetru, C., Durst, F. and Hoffman, J. A. (1988). Characterization of three hydroxylases involved in the final steps of biosynthesis of the steroid hormone ecdysone in Locusta migratoria (Insecta, orthoptera). J. Steroid Biochem. 31, 891-898. Kelley, D. B. (1997). Generating sexually differentiated songs. Curr. Opin. Neurobiol. 7, 839-843. Lagueux, M., Hirn, M. and Hoffmann, J. A. (1977). Ecdysone during ovarian development in Locusta migratoria. J. Insect Physiol. 23, 109-119. Le Goascogne, C., Robel, P., Gouezou, M., Sananes, N., Baulieu, E.-E. and Waterman, M. (1987). Neurosteroids: Cytochrome P-450scc in rat brain. Science 237, 1212-1215. Levine, R. B., Morton, D. B. and Restifo, L. L. (1995). Remodeling of the insect nervous system. Curr. Opin. Neurobiol. 5, 28-35. Lin, D., Shi, Y. and Miller, W. L. (1990). Cloning and sequence of the human adrenodoxin reductase gene. Proc. Nat. Acad. Sci. USA 87, 85168520. Lipshitz, H. D. and Kankel, D. R. (1985). Specificity of gene action during central nervous system development in Drosophila melanogaster: Analysis of the lethal(1) optic ganglion reduced locus. Dev. Biol. 108, 56-77. Manning, G. and Krasnow, M. A. (1993). Development of the Drosophila tracheal system. In The Development of Drosophila melanogaster, vol. 1 (ed. M. Bate and A. Martinez-Arias), pp. 609-689. Plainview, NY: Cold Spring Harbor Press. McKenna, M., Hekmat-Scafe, D., Gaines, P. and Carlson, J. R. (1994). Putative Drosophila pheromone-binding proteins expressed in a subregion of the olfactory system. J. Biol. Chem. 269, 16340-16347. Mellon, S. H. and Deschepper, C. F. (1993). Neuorsteroid biosynthesis: genes for adrenal steroidogenic enzymes are expressed in the brain. Brain Res. 629, 283-292. Mihalek, R. M. (1995). Characterization of mutations affecting associative learning in Drosophila melanogaster. Ph.D. dissertation, Brandeis University. Miller, W. L. (1988). Molecular biology of steroid hormone synthesis. Endocrin. Rev. 9, 295-318. Moore, F. L. and Miller, L. J. (1984). Stress-induced inhibition of sexual behavior; Corticosterone inhibits courtship behaviors of a male amphibian (Taricha granulosa). Horm. Behav. 18, 400-410. O’Connell, P. and Rosbash, M. (1984). Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Research 12, 5495-5513. Paul, S. M. and Purdy, R. H. (1992). Neuroactive steroids. FASEB 6, 23112322. Pirrotta, B. (1986). Cloning Drosophila Genes. Washington, DC: IRL Press, Oxford. Redfern, C. P. F. and Bownes, M. (1983). Pleiotropic effects of the ecdysoneless-1 mutation of Drosophila melanogaster. Mol. Gen. Genet. 189, 432-440. Rees, H. H. (1985). Biosynthesis of ecdysone. In Comprehensive Insect 4602 M. R. Freeman and others Physiology, Biochemistry, and Pharmacology, vol. 7 (ed. G. A. Kerkut and L. I. Gilbert), pp. 249-293. Oxford: Pergamon Press. Restifo, L., Estes, P. and Dello Russo, C. (1995). Genetics of ecdysteroidregulated central nervous system metamorphosis in Drosophila (Diptera:Drosophilidae). Eur. J. Entomol. 92, 169-187. Restifo, L. L. and Merrill, V. K. L. (1994). Two Drosophila regulatory gene, Deformed and the Broad-Complex, share common functions in development of adult CNS, head, and salivary glands. Dev. Biol. 162, 465485. Restifo, L. L. and White, K. (1991). Mutations in a steroid hormone-regulated gene disrupt the metamorphosis of the central nervous system in Drosophila. Dev. Biol. 148, 174-194. Riddiford, L. M. (1993). Hormones and Drosophila Development. In The Development of Drosophila melanogaster, vol. 2 (ed. M. Bate and A. Martinez Arias), pp. 899-939. Plainview,NY: Cold Spring Harbor Laboratory Press. Robertson, H., Preston, C., Phillis, R., Johnson-Schlitz, D., Benz, W. and Engels, W. (1988). A stable source of P element transposase in Drosophila melanogaster. Genetics 118, 461-470. Russell, S. and Ashburner, M. (1996). Ecdysone-regulated chromosome puffing Drosophila melanogaster. In Metamorphosis: Postembryonic Reprogramming of Gene Expression in Amphibian and Insect Cells, (ed. L. I. Gilbert, J. R. Tata and B. G. Atkinson), pp. 109-144. San Diego, CA: Academic Press, Inc. Schubiger, M., Wade, A. A., Carney, G. E., Truman, J. W. and Bender, M. (1998). Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development 125, 2053-2062. Schwartz, M. B., Imberski, R. B. and Kelly, T. J. (1984). Analysis of metamorphosis in Drosophila melanogaster: Characterization of giant, an ecdysteroid-deficient mutant. Dev. Biol. 103, 85-95. Sliter, T. J. (1989). Imaginal disc-autonomous expression of a defect in sensory bristle patterning caused by the lethal(3)ecdysoneless1 (l(3)ecd1) mutation of Drosophila melanogaster. Development 106, 347-354. Smith, S. L., Bollenbacher, W. E., Cooper, D. Y., Schleyer, H., Wielgus, J. J. and Gilbert, L. I. (1979). Ecdysone 20-monooxygenase: characterization of an insect cytochrome P-450 dependent steroid hydroxylase. Molec. Cell. Endocr. 15, 111-133. Solish, S. B., Picado-Leonard, J., Morel, Y., Kuhn, R. W., Mohandas, T. K., Hanukoglu, I. and Miller, W. L. (1988). Human adrenodoxin reductase: Two mRNas encoded by a single gene on chromosome 17cen–>q25 are expressed in steroidogenic tissues. Proc. Nat. Acad. Sci. USA 85, 7104-7108. Spradling, A. (1986). P Element Mediated Transformation. Washington, DC/ Oxford: IRL Press. Spradling, A. C. (1993). Developmental genetics of oogenesis. In The Development of Drosophila melanogaster, vol. 1 (ed. M. Bate and A. Martinez Arias), pp. 1-70. Plainview, NY: Cold Spring Harbor Laboratory Press. Stone, D. and Hechter, O. (1955). Studies on ACTH action in perfused bovine adrenals: aspects of progesterone as an intermediary in corticosteroidogenesis. Arch. Biochem. Biophys. 54, 121-128. Stromstedt, M. and Waterman, M. R. (1995). Messenger RNAs encoding steroidogenic enzymes are expressed in rodent brain. Mol. Brain Res. 34, 75-88. Svoboda, J. A. and Thompson, M. J. (1985). Steroids. In Comprehensive Insect Physiology, Biochemistry, and Pharmacology, vol. 7 (ed. G. A. Kerkut and L. I. Gilbert), pp. 137-175. Oxford: Pergamon Press. Thummel, C. and Pirrotta, V. (1992). New pCaSpeR4 P Element Vectors. Dros. Info. Serv. 71, 150. Thummel, C. S. (1996). Flies on Steroids: Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends in Genet. 12, 306-310. Truman, J. W. (1996). Metamorphosis of the insect nervous system. In Metamorphosis: Postembryonic Reprogramming of Gene Expression in Amphibian and Insect Cells, (ed. L. I. Gilbert, J. R. Tata and B. G. Atkinson), pp. 283-320. New York: Academic Press. Truman, J. W., Talbot, W. S., Fahrbach, S. E. and Hogness, D. S. (1994). Ecdysone receptor expression in the CNS correlates with stage-specific responses to ecdysteroids during Drosophila and Manduca development. Development 120, 219-234. Warren, J. T., Bachmann, J. S., Dai, J.-D., and Gilbert, L. I. (1996). Differential incorporation of cholesterol and cholesterol derivatives into ecdysteroids by the larval ring glands and adult ovaries of Drosophila melanogaster: a putative explanation for the l(3)ecd1 mutation. Insect Biochem. Molec. Biol. 26, 931-943. Weeks, J. C. and Levine, R. B. (1995). Steroid hormone effects on neurons subserving behavior. Curr. Opin. Neurobio. 5, 809-815. Zhu, X. X., Gfeller, H. and Lanzrein, B. (1983). Ecdysteroids during oogenesis in the ovoviviparous cockroach Nauophoeta cinerea. J. Insect Physiol. 29, 225-235.