Download Steroids, behavior and neural degeneration - Development

4591
Development 126, 4591-4602 (1999)
Printed in Great Britain © The Company of Biologists Limited 1999
DEV5344
The dare gene: steroid hormone production, olfactory behavior, and neural
degeneration in Drosophila
Marc R. Freeman, Anna Dobritsa, Peter Gaines*, William A. Segraves and John R. Carlson‡
Department of Molecular, Cellular, and Developmental Biology, Yale University, PO Box 208103, New Haven, CT 06520-8103,
USA
*Current address: Department of Veterinary Science, Pennsylvania State University, University Park, PA 16802, USA
‡Author for correspondence (e-mail: [email protected])
Accepted 30 July; published on WWW 27 September 1999
SUMMARY
Steroid hormones mediate a wide variety of developmental
and physiological events in insects, yet little is known about
the genetics of insect steroid hormone biosynthesis. Here
we describe the Drosophila dare gene, which encodes
adrenodoxin reductase (AR). In mammals, AR plays a key
role in the synthesis of all steroid hormones. Null mutants
of dare undergo developmental arrest during the second
larval instar or at the second larval molt, and dare mutants
of intermediate severity are delayed in pupariation. These
defects are rescued to a high degree by feeding mutant
larvae the insect steroid hormone 20-hydroxyecdysone.
These data, together with the abundant expression of dare
in the two principal steroid biosynthetic tissues, the ring
gland and the ovary, argue strongly for a role of dare in
steroid hormone production. dare is the first Drosophila
gene shown to encode a defined component of the steroid
hormone biosynthetic cascade and therefore provides a new
tool for the analysis of steroid hormone function. We have
explored its role in the adult nervous system and found two
striking phenotypes not previously described in mutants
affected in steroid hormone signaling. First, we show that
mild reductions of dare expression cause abnormal
behavioral responses to olfactory stimuli, indicating a
requirement for dare in sensory behavior. Then we show
that dare mutations of intermediate strength result in
rapid, widespread degeneration of the adult nervous
system.
INTRODUCTION
associated with the endoplasmic reticulum (ER) (Miller, 1988).
P450s require a pair of electrons and O2 to drive chemical
modifications of substrates. Adrenodoxin reductase (AR) is a
mitochondrial protein that transports electrons to all known
mitochondrial P450s. It functions by transferring a pair of
electrons from NADPH to another mitochondrial enzyme,
adrenodoxin, which in turn donates these electrons to
mitochondrial P450s (Miller, 1988), including the one required
for the first step of steroid hormone synthesis. Thus, AR is
essential for the synthesis of all vertebrate steroid hormones.
In insects, the chemical intermediates in ecdysteroid
synthesis have been extensively studied (Rees, 1985; Svoboda
and Thompson, 1985); however, molecular and genetic
characterization of the genes whose products catalyze steroid
synthesis has been lacking. As in vertebrate steroid hormone
metabolism, ecdysteroid production appears to require P450like enzymes (Grieneisen et al., 1993; Kappler et al., 1988;
Smith et al., 1979). Mitochondrial P450-like enzymes are
thought to hydroxylate ecdysteroid precursors in Locusta and
Manduca, as evidenced by the blockage of these activities in
mitochondrial extracts by inhibitors of P450 activity and the
dependence of these reactions on NADPH (Grieneisen et al.,
1993; Kappler et al., 1988). There is strong evidence that
steroid biosynthesis depends on P450s in Drosophila also:
Steroid hormones regulate a wide variety of developmental and
physiological processes in animals. The study of insect model
systems has contributed greatly to our understanding of steroid
hormone regulation. Diverse aspects of insect biology, ranging
from larval molting and metamorphosis to reproduction, are
steroid hormone-dependent, and are thought to be mediated by
a single class of steroid hormones, the ecdysteroids (Riddiford,
1993).
Great progress has been made in recent years toward
understanding the molecular and genetic mechanisms by which
ecdysteroids regulate cellular responses (reviewed in Russell
and Ashburner, 1996; Thummel, 1996). By contrast,
remarkably little is known about a higher level in the control
hierarchy: what regulates the regulator? The genes required for
ecdysteroid biosynthesis remain largely unidentified; little is
known about these genes or how they are regulated.
In vertebrates, the first and rate-limiting step in the synthesis
of all steroid hormones is the conversion of cholesterol to
pregnenolone (Miller, 1988; Stone and Hechter, 1955). This
step, like several others in steroid hormone synthesis, is
catalyzed by a member of the cytochrome P450 family of
enzymes (P450s), which are found either in mitochondria or
Key words: Steroid hormone, Drosophila, Molting, Behavior,
Neurodegeneration, dare, Olfaction
4592 M. R. Freeman and others
application of a competitive inhibitor of P450 activity potently
reduced ecdysteroid production by 80% in the Drosophila ring
gland, the main steroid-producing organ in the larva
(Grieneisen et al., 1993). Finally, antibody neutralization
experiments in Spodoptera support a role for AR and certain
P450s in insect steroid metabolism (Chen et al., 1994). AR,
acting through its substrate adrenodoxin, is the only known
electron donor for mitochondrial P450s. All well-characterized
insect ecdysteroids contain hydroxyl groups believed to be
added by mitochondrial P450s, suggesting a requirement for
AR in the synthesis of all insect steroid hormones.
Here we describe the dare gene and show that it encodes the
Drosophila homologue of AR. Our study of this mutant
provides the first genetic analysis in Drosophila of a defined
component of the steroid hormone biosynthetic machinery. dare
expression is most abundant in the two major steroid-producing
tissues of Drosophila, the larval ring gland and adult ovary. Null
mutants of dare exhibit defects in larval molting, while
moderately strong mutants show delays in pupariation. These
defects are rescued to a high degree by feeding the steroid
hormone 20-hydroxyecdysone to mutant larvae, arguing
strongly for a role for dare in steroid hormone synthesis.
Steroid hormones are known to regulate diverse aspects of
nervous system development and function (Levine et al., 1995;
Truman, 1996). In insects, developmental events such as
postembryonic neural proliferation, programmed cell death
and neuronal remodeling are coordinated by the ecdysteroids.
The role of ecdysteroids in adult nervous system function,
however, remains largely unexplored. Here we document two
phenotypes not previously described in mutants associated
with steroid hormone signaling. We show that mild reduction
of dare expression dramatically affects adult olfactory-driven
behavior, and that dare mutants of moderate strength reach
adulthood, but then exhibit rapid degeneration of the adult
nervous system.
MATERIALS AND METHODS
Drosophila stocks
The dare1 mutation was generated in a w1118 background using the
PlacW construct as an insertional mutagen (Boynton and Tully, 1992).
P-element excision lines were generated from w1118; dare1 using the
∆2-3 transposase (Robertson et al., 1988). darerv2 is an excision
chromosome in which the transposable element has excised precisely,
as determined by Southern analysis and PCR. The dare3 excision
chromosome retains a portion of the PlacW insertion, as determined
by Southern analysis, but has a disruption within the P element that
inactivates the mini-white+ marker transgene (mini-w+), as indicated
by its white eye color. dare3 responds similarly to dare1 in olfactory
behavioral assays (e.g. Fig. 1), and was used as a recipient mutant for
transformation rescue experiments: its w− eye allowed identification
of transgenic animals containing the mini-w+-marked dare rescue
constructs (described below; dare1 is mini-w+). Prior to testing in
behavioral assays, excision lines were outcrossed for three generations
to the w1118 control line and maintained as stocks over the second
chromosome balancer CyO.
Behavioral analysis
Flies were tested for response to odors in the olfactory T maze
paradigm (purchased from Parker-Hanaffin Corp., NJ) as described
previously (Helfand and Carlson, 1989). Choice periods lasted for 30
seconds. Odorants were of the highest purity available: ethyl acetate
and 3-octanol were from Fluka; 4-methylcyclohexanol was from
Aldrich. Paraffin oil, which fails to evoke any appreciable olfactory
response from Drosophila in the olfactory T maze, was used as a
diluent for odorants.
Isolation of genomic and cDNA clones and expression
analysis
Isolation and manipulation of nucleic acids were performed as
described elsewhere (McKenna et al., 1994). Genomic DNA flanking
the P-element insertion in dare1 was isolated by standard plasmid
rescue techniques (Pirrotta, 1986) using the unique PstI and SacII
restriction sites in the PlacW insert. A 13 kb PstI-SacII genomic
fragment from this region was used as a probe to screen a Drosophila
testis cDNA library that was kindly provided by T. Hazelrigg
(Columbia Univ.). Two classes of cDNA clones were isolated,
represented by 3B1 and 5A1 in Fig. 2A. The 2 kb HindIII-EcoRV
fragment of genomic DNA spanning the P insertion site in dare1 was
used to probe a Drosophila head cDNA library kindly provided by T.
Schwarz (Stanford University), from which the W8 cDNA and several
shorter, cross-hybridizing cDNAs were obtained. The cytological
location of the P-element insertion in dare1 was determined by in situ
hybridization to polytene chromosomes as described elsewhere
(McKenna et al., 1994) using the PlacW element (Bier et al., 1989)
as a probe.
RNA isolations were performed as described elsewhere
(Chomczynski and Sacchi, 1987). Poly(A)+ RNA was isolated using
the Oligotex mRNA isolation kit (Qiagen, Chatsworth). RNAse
protection assays were performed with the RPA II kit from Ambion
(Austin, TX) according to the manufacturer’s instructions. The dare
probe used was 423 bp in length, spanning the first intron of the dare
gene. The protection of the labeled dare fragment was normalized
against an internal standard, i.e. it was compared to the protection of
a labeled 165 bp fragment that spans the first intron of the ribosomal
protein rp49 gene (O’Connell and Rosbash, 1984). Yeast RNA
provided with the Ambion RPAII kit (Austin, TX) was used as a
negative control. Results from all experiments were quantitated on a
phosphorimager (Molecular Dynamics).
For whole-mount in situ hybridizations to ring glands, CNS/ring
gland complexes were dissected from wandering third-instar larvae in
PBS, fixed in 4% paraformaldehyde/PBS for 45 minutes, and then
washed six times in 0.1% Tween 20/PBS (PBST) for 15 minutes each.
Tissue was washed for 5 minutes in 1:1 PBST:hybridization buffer
(50% formamide, 5× SSC, 50 µg/ml heparin, 0.1% Tween 20) and
prehybridized for 2 hours at 55°C in hybridization buffer.
Hybridizations were carried out for 18 hours at 55°C at probe
concentrations of 5 ng/ml. The tissue was then washed for a total of
8 hours at 55°C, with several changes of hybridization buffer.
Specimens were then washed for 5 minutes in 1:1 PBST:hybridization
buffer, followed by six washes in PBST for 10 minutes each. In situ
hybridizations to ovaries were performed as described elsewhere
(Buszczak et al., 1999). dare-specific digoxigenin-labeled RNA
probes were generated, hydrolyzed and detected according to the
manufacturer’s instructions (Boehringer Mannheim, Indianapolis).
Generation of dare transgenes
Oligonucleotide primers (5′ GAGCGAATTCGAAGATCACCTAGCAAAC 3′ and 5′ GATCTCTAGAGGCACGAGCAGGCCTCAAACG 3′, respectively), which included the 5′ and 3′ terminal
sequences of the W8 cDNA clone, were used for PCR amplification
from the W8 cDNA. The amplification product was then subcloned
into pCaSpeR-hs (Thummel and Pirrotta, 1992) using the EcoRI and
XbaI restriction sites in the above primers. This P[hs-AR, mini-w+]
construct is referred to as hs-AR.
A 6.5 kb BamHI-ClaI genomic fragment that spans the dare gene
and truncates 3B1 genomic sequences was subcloned from cosmid
DNA spanning the dare region into the pCaSpeR4 transformation
vector. A 0.5 kb SacI fragment was subsequently deleted from this
Steroids, behavior and neural degeneration 4593
construct, removing 0.5 kb of 5A1 genomic sequences. This construct,
which is expected to contain the complete dare gene but only partial
copies of the two defined transcription units that flank dare, is referred
to as GF-AR, an abbreviation for P[GF-AR, mini-w+]. GF-AR and hsAR were transformed into the w1118 background via standard germline
transformation techniques (Spradling, 1986).
Preparation of dare antibodies
The carboxy-terminal portion of Dare (amino acids 237-466) was
cloned into pMAL-c2 (New England Biolabs, Beverly). Fusion protein
expression was induced in bacteria with 0.3 mM IPTG and the protein
was affinity-purified on amylose resin according to the manufacturer’s
instructions (New England Biolabs, Beverly). Immunization of mice
and polyclonal antibody production were performed as described
elsewhere (Hekmat-Scafe et al., 1997). The immunogen was a fusion
protein containing the entire maltose binding protein (MBP) fused to
the carboxy-terminal portion of Dare. Antiserum C40 was used in the
current work; however, we note that antisera generated from three
separate mice gave similar results. C40 antiserum was affinity-purified
against MPB, using a fusion protein containing MBP and amino acids
2-208 of the Dare amino terminus coupled to nitrocellulose. Dare Cterminal-specific antibodies were then isolated by incubation of the
purified antiserum with nitrocellulose coupled with a Dare C-terminal
specific-MBP fusion protein. Bound antibodies were eluted with 4 M
MgCl2 in the presence of 1% BSA and dialyzed against TBS.
Western blot analysis
Protein extracts from adult heads and larvae were prepared by
homogenization and boiling in 50 mM Tris-HCl, pH 6.8, 2% SDS,
0.14 M β-mercaptoethanol. Mitochondrial suspensions were prepared
as described elsewhere (Chen et al., 1994). Protein concentrations in
extracts were determined using the Bio-Rad Protein Assay system.
Prior to gel electrophoresis, protein extracts were boiled briefly in
SDS sample buffer. To confirm the equal loading and transfer of
protein among the lanes of a gel, protein blots were stained with
Ponceau S. Blots were probed with affinity-purified anti-Dare at a
dilution of 1:50, followed by an HRP-conjugated secondary antibody
(Amersham, Arlington Heights) at a dilution of 1:10,000. Crossreacting bands were visualized using the ECL detection kit
(Amersham, Arlington Heights).
Developmental analysis
dare alleles were crossed into a y w genetic background and
maintained over the second chromosome balancer CyO y+. Larvae
were collected from 6 hour egg lays, and dare homozygote larvae
were distinguished from their siblings by their y− phenotype. Our
initial observations indicated that all dare mutations (with the
exception of the dare5 deletion, discussed below) cause little, if any,
lethality during the embryonic or first larval instar stages:
homozygous dare mutant larvae appeared at expected Mendelian
ratios in populations of animals (n=200-300 larvae) at the secondinstar larval stage. For dare4 homozygotes, and dare4 in heterozygous
combination with all other described alleles, viability was unaffected
until the third larval instar. In subsequent experiments, animals
collected for developmental analysis were second-instar larvae or
older as indicated. For lethal phase analysis of dare excision mutants,
groups of 20-30 larvae of the indicated genotypes were placed in fresh
culture vials and allowed to develop at 25°C. dare5 is an embryonic
lethal mutation that affects not only the dare gene (Fig. 2A) but also
another gene required during embryonic stages; neither the hs-AR, nor
GF-AR constructs rescue dare5 mutant animals beyond the embryonic
stage, while dare102 homozygotes (a null dare mutation), and
dare5/dare102 heterozygotes are rescued to adulthood by either
transgene.
Ecdysone-feeding experiments were similar to those described
elsewhere (Garen et al., 1977). Briefly, to test the effects of 20hydroxyecdysone (20HE) feeding, larvae were collected from a single
6 hour egg lay and then divided into two groups. One group was fed
20HE (1 mg/ml, dissolved in a 10% ethanol solution), while the other,
control group was fed 10% ethanol solution alone. For feeding, larvae
were transferred into plastic vials containing only a piece of
moistened filter paper on the wall of the vial to maintain humidity.
Dry yeast were then placed at the bottom of the vial and wetted with
0.3 ml of either 20HE in 10% ethanol solution or 10% ethanol alone.
Vials were then sealed with cotton plugs and incubated at 25°C. 20HE
was from the Sigma Chemical Company.
Histology
Reduced silver staining procedures were performed as described
elsewhere (Lipshitz and Kankel, 1985). Third-instar larvae were
transferred to culture vials and allowed to develop at 25°C.
Morphological markers were used to stage specimens in pupal cases
(Bainbridge and Bownes, 1981) prior to fixation and embedding in
paraffin. Animals were cut into 5 µm sections, stained and viewed by
light microscopy.
RESULTS
dare mutants have defects in olfactory behavior that
map to a P-element insertion
The dare1 mutant (defective in the avoidance of repellents) was
isolated in a screen for P-element-induced mutations that affect
olfactory-driven learning and memory (Mihalek, 1995). dare1
was subsequently found to be defective in olfactory response
per se, which is essential to the olfactory-driven learning
paradigm. In an olfactory T maze, dare1 flies display striking
abnormalities in their avoidance response to all olfactory
repellents tested. Responses to three representative odors, 3octanol, ethyl acetate and 4-methylcyclohexanol, are shown in
Fig. 1A. Control animals are strongly repelled by these stimuli,
whereas dare1 flies display a severely reduced avoidance
response.
The dare1 mutation was induced by insertional mutagenesis
using the PlacW transposable element. In situ hybridization of
a PlacW probe to polytene chromosomes from dare1 revealed
a single hybridization signal, located in cytogenetic region
47E. Southern analysis of dare1 genomic DNA confirmed that
a single P-element insertion exists in the dare1 line. In order to
determine whether the olfactory defects of dare1 are caused by
the P insertion, we analyzed stocks derived from excision of
the P element (Fig. 1B). The darerv2 precise excision line
responds to the tested odors at control levels. In contrast, the
dare3 excision stock (which was generated in parallel to darerv2
but which retained most of the P-element insertion) behaves
similarly to dare1, displaying a reduced avoidance response to
all odors tested. These data indicate that the dare1 olfactory
defects result from the insertion of the P element.
dare encodes adrenodoxin reductase, an enzyme
required for steroid hormone synthesis
We isolated genomic DNA surrounding the P insertion in dare1
and used it to screen Drosophila cDNA libraries. cDNA clones
representing three transcriptional units were obtained and
mapped to the dare insertion region (Fig. 2A). Multiple crosshybridizing cDNAs representing the transcriptional unit
mapping closest to the P insertion in dare1 were recovered from
a Drosophila head cDNA library. The 5′ end of one of these
cDNAs, referred to as W8, maps 44 bp 3′ of the P-element
insertion site. 5′ RACE experiments suggested that the 5′ end
4594 M. R. Freeman and others
A
1
Response Index
0.8
0.6
+
dare1
0.4
0.2
0
OCT
Response Index
B
EA
MCH
1
0.8
0.6
+
darerv2
dare3
0.4
0.2
0
OCT
EA
MCH
Fig. 1. The olfactory defects in dare map to a P-element insertion.
Behavioral responses of flies to repellent odors were tested in an
olfactory T maze. For all experiments, one arm of the T maze
contained an air stream that passed over the indicated odor, while the
other arm contained a control airstream that passed over the paraffin
oil diluent. The response index is the number of flies in the control
arm minus the number in the repellent arm, divided by the total
number of flies. Thus, positive values indicate repulsion. All stocks
were in a w1118 genetic background, including the control stock,
which is labeled ‘+’. The odors were diluted v/v in paraffin oil as
follows: 10−2 for 3-octanol (OCT); 5×10−2 for ethyl acetate (EA);
10−1 for 4-methylcyclohexanol (MCH). Error bars indicate s.e.m.
Each value represents n=10 groups of 25-35 flies. (A) The dare1
mutant shows a reduced avoidance response to all olfactory
repellents. For all odors, differences between the dare mutant and the
control are significant at the P<0.0004 level. (B) Flies homozygous
for the precise excision darerv2 respond to olfactory repellents at
control levels, while flies homozygous for the dare3 insertion retain
the olfactory defects. Differences between dare3 and the other two
lines are significant at the P<0.005 level.
of this transcriptional unit maps ~10 bp upstream from the P
insertion. Consistent with these results, the sequence of an EST
corresponding to W8 (ref. num. LD17269; Berkeley Drosophila
Genome Project) contains a 5′ end which lies 14 bp 5′ of the P
insertion in dare1. Analysis of cDNA sequences and
hybridization patterns to northern blots of RNA isolated from
whole flies has revealed only a single splice form for this gene.
Quantitative RNAse protection assays using a W8 probe
with whole-fly RNA revealed that transcript levels from this
gene are reduced by ~40% in the dare1 mutant relative to
control animals (Fig. 2B). W8 sequences are expressed in
heads, where their transcript levels are reduced by ~45% in
dare1 compared to control heads (Fig. 2C). Northern blots of
whole-fly poly(A)+ RNA isolated from dare mutants and
control lines indicate that the expression of 5A1 and 3B1, the
two genes that flank the W8 gene, are unaffected by the dare1
mutation (data not shown). These data suggested that the W8
gene was likely to correspond to dare, a suggestion tested
rigorously as described below.
The W8 cDNA encodes a predicted Drosophila homologue
of vertebrate adrenodoxin reductase (AR) (Fig. 2D) (Lin et al.,
1990; Solish et al., 1988). In mammals, AR is required for
synthesis of all steroid hormones (see Introduction). The amino
acid sequence of Drosophila AR is 42% identical to human AR
and shares conserved binding sites for an FAD moiety, and for
NADPH (Fig. 2D).
To determine whether dare encodes AR, we attempted to
rescue the olfactory behavioral defects using two AR
transgenes: an AR cDNA (hs-AR) and a genomic fragment that
spans the AR gene but that truncates flanking genes (GF-AR).
We found that the olfactory defects of dare3 were rescued by
each of two AR constructs tested (Fig. 3). Taken together with
the reduction of AR transcript levels in dare mutants, these
results clearly indicate that dare mutations affect the AR gene
and lead us to conclude that the AR gene and dare are the same.
Henceforth, we will refer to the Drosophila adrenodoxin
reductase gene as dare.
dare expression is enriched in tissues that
synthesize steroid hormones
Steroid hormone synthesis in Drosophila occurs primarily in
two organs, the larval ring gland and the adult ovary. In situ
hybridization of dare RNA probes to third-instar larval ring
glands and adult ovaries revealed that dare expression is
greatly enriched in these tissues (Fig. 4A-C). Strong expression
is observed within the portion of the ring gland referred to as
the prothoracic gland, where the steroid hormone ecdysone is
synthesized (Riddiford, 1993). Expression in the ovary is
limited to the nurse cells of developing egg chambers. It is first
detectable by in situ hybridization in stage 6-7 egg chambers.
Expression levels rise until approximately stage 10 (Fig. 4C),
and then remain high until nurse cell cytoplasmic dumping,
which occurs at the end of oogenesis (data not shown). Low
levels of expression have been observed in all adult tissues
examined, including heads (Figs 2C, 5A, discussed below),
dissected brain tissue, male bodies and adult antenna, by these
methods, RT-PCR or RNAse protection.
To characterize dare expression and localization further, we
generated antibodies specific to the carboxy-terminal half of
the Dare protein. On western blots of head protein extracts,
anti-Dare antibodies react with a polypeptide band of
approximately 55 kDa (Fig. 5A), which corresponds to the
predicted size of Dare: 55 kDa. The identity of this 55 kDa
species as the dare gene product is supported by two lines of
genetic evidence. First, heat shock of a transformant line
bearing the hs-AR construct led to an increase in the abundance
of this band (Fig. 5A). Second, levels of this band are
substantially reduced in dare mutants, but not in the precise
excision darerv2. Moreover, the most severe reductions are
observed in the most severe mutant combinations: animals
bearing strong combinations of dare alleles (dare4/dare34 and
dare4/dare5, described below), which die at late pupal stages
or very shortly after eclosion, exhibit more severe reductions
than do the viable mutants dare1 and dare3. In addition to these
Steroids, behavior and neural degeneration 4595
1
dare
A
1 kb
CV
B S BS SV H
5'
P
3'
dare (W8)
5A1
P
C P Sa C
dare102
dare 34
dare5
dare4
75
50
0
+
dare1
Yeast RNA
25
Head
100
75
50
25
0
+
dare1
Yeast RNA
Whole-fly
100
Relative Protection
of Labelled W8
Fragment (%)
C
Relative Protection
of Labelled W8
Fragment (%)
B
3B1
D
Dros
DrosARAR
Human
Human AR
AR
MGINC----- LNIFRRG-LH --TSSARL-Q VIQSTTPTKR ICIVGAGPAG
MASRCWRWWG WSAWPRTRLP PAGSTPSFCH HFSTQEKTPQ ICVVGSGPAG
41
50
DrosARAR
Dros
Human AR
AR
Human
FYAAQLILKQ LDNCVVDVVE KLPVPFGLVR FGVAPDHPEV KNVINTFTKT
FYTAQHLLKH PQAHV-DIYE KQPVPFGLVR FGVAPDHPEV KNVINTFTQT
91
99
Dros
DrosARAR
Human
Human AR
AR
AEHPRLRYFG NISLGTDVSL RELRDRYHAV LLTYGADQDR QLELENEQLD
AHSGRCAFWG NVEVGRDVTV PELQEAYHAV VLSYGAEDHR ALEIPGEELP
141
149
Dros
DrosARAR
Human
Human AR
AR
NVISARKFVA WYNGLPGAEN LAPDLSGRDV TIVGQGNVAV DVARMLLSPL
GVCSARAFVG WYNGLPENQE LEPDLSCDTA VILGQGNVAL DVARILLTPP
191
199
Dros
ARAR
Dros
Human
Human AR
AR
DALKTTDTTE YALEALSCSQ VERVHLVGRR GPLQAAFTIK ELREMLKLPN
EHLERTDITK AALGVLRQSR VKTVWLVGRR GPLQVAFTIK ELREMIQLPG
241
249
Dros
DrosARAR
Human
Human AR
AR
VDTRWRTEDF SGIDMQLDKL QRPRKRLTEL MLKSLKEQ-G RISGSKQFLP
ARPILDPVDF LGLQDKIKEV PRPRKRLTEL LLRTATEKPG PAEAARQASA
290
299
Dros
DrosARAR
Human
Human AR
AR
I------FLR APKAIAPGEM EFSVTELQQE AAVPTSSTER LPSHLILRSI
SRAWGLRFFR SPQQVLPSPD GRRAAGVRLA VTRLEGVDEA TRAVPTGDME
334
349
Dros
DrosARAR
Human
Human AR
AR
GYKSSCVDTG INFDTRR-GR VHNINGRI-L KDDATGEV-D -PGLYVAGWL
DLPCGLVLSS IGYKSRPVDP SVPFDSKLGV IPNVEGRVMD VPGLYCSGWV
380
399
Dros
DrosARAR
Human
Human AR
AR
GTGPTGVIVT TMNGAFAVAK TICDDINTNA LDTSSVKPGY DA-------D
KRGPTGVIAT TMTDSFLTGQ MLLQDLKAGL L-PSGPRPGY AAIQALLSSR
423
448
Dros
DrosARAR
Human
Human AR
AR
GKRVVTWDGW QRINDFESAA GKAKGKPREK IVSIEEMLRV AGV
GVRPVSFSDW EKLDAEEVAR GQGTGKPREK LVDPQEMLRL LGH
466
491
reductions observed in adult heads, the levels of this 55 kDa
band are reduced in extracts from dare second-instar larvae,
with no product detectable in the strong allele dare34 (Fig. 5B).
Cell fractionation experiments with Drosophila heads
suggest that dare is localized primarily to mitochondria, and
not to the ER (Fig. 5C), consistent with the mitochondrial
localization of AR in vertebrate cells.
dare is required for steroid-mediated developmental
transitions
Pulses of ecdysteroids govern many developmental transitions
Fig. 2. Molecular characterization of dare. (A) The dare insertion
region. The intron-exon maps of the dare gene (to which the W8
cDNA corresponds) and other genes in the region are shown below
the restriction map. The structures of the other genes have not been
examined in as much detail as dare. For dare, black boxes represent
coding regions, and open boxes represent untranslated regions. The
PlacW element is not drawn to scale. The 5′ to 3′ orientation of the
lacZ reporter gene is from left to right. The dare deletions are shown
below the restriction map. The solid lines indicate regions that are
present; dashed lines represent regions of uncertainty. The dare102
deletion was defined precisely by PCR amplification and sequence
analysis (the deletion begins 8 bp 3′ of the dare1 P-element insertion
site). For dare34, dare4 and dare5, 3′ deletion breakpoints were
determined by Southern analysis. The 5′ deletion endpoints for
dare34, dare4, and dare5 have not been mapped. It is possible that
some of the DNA indicated as deleted in dare34 may be present in a
rearranged form elsewhere in the genome. P, PstI; V, EcoRV; B,
BamHI; S, SacI; H, HindIII; C, ClaI; Sa, SalI. (B) Quantitative
RNase protection assays reveal a reduction of ~40% in levels of dare
RNA in whole fly poly(A)+ RNA. Values indicate the means of two
independent experiments. (C) Reduction of 45% in levels of dare
RNA in head poly(A)+ RNA. n=3 independent experiments.
(D) Alignment of the predicted amino acid sequence of dare (Dros
AR) and human adrenodoxin reductase (Human AR). Amino acid
identities are boxed. The first and second black bars underline the
conserved FAD binding (GXGXXG) and NADPH binding sites
(GXGXXA), respectively. Sequences were aligned using GeneWorks
(IntelliGenetics, Mountain View, CA). The GenBank accession
number for the dare cDNA sequence is AF168685.
in Drosophila including larval molting, pupariation and
metamorphosis (Riddiford, 1993). To determine whether the
dare gene plays a role in these processes, we generated stronger
dare alleles by excision of the P-element insertion in dare1 and
investigated their effects on development.
The dare102 mutation is a deletion that begins in the dare 5′
untranslated region and ends in the dare 3′ untranslated region,
thereby removing the entire dare coding region (Fig. 2A).
Thus, the dare102 mutation is a molecular null for the dare
gene, and does not extend into other genes lying beyond the 5′
and 3′ boundaries of dare.
The dare34 excision mutation is also a deletion that likely
removes the entire dare gene, although it has not been defined
as precisely as dare102 in molecular terms (Fig. 2A). Dare
protein is undetectable in western blots of dare34 second-instar
larvae (Fig. 5B), indicating that dare34 is also a molecular null
allele.
dare102 causes lethality primarily during the second larval
instar (Table 1; see also Fig. 6B below). 91% of dare102
animals die as second instar larvae, 6% die at the second to
third instar larval molt, and only 3% survive to the third larval
instar. Animals that die at the second larval molt have a distinct
morphology (Fig. 6A). They have two pairs of mouth hooks,
one pair with morphology similar to those of second-instar
larvae, and a second pair similar to those of third-instar larvae.
These animals also have compound anterior spiracles that are
a combination of those from second instar and third instar
larvae. The death of many dare102 animals prior to the second
larval molt is consistent with a requirement for dare in the
initiation of this molt. In addition, as many of these mutants
die in the late stages of the molting process (as in Fig. 6A),
dare also appears to be required for the completion of the
second larval molt.
4596 M. R. Freeman and others
0.7
Response Index
0.6
0.5
0.4
0.3
0.2
0.1
0
3-OCT
EA
MCH
+
dare 3; hs-AR
dare 3
dare 3; GF-AR
Fig. 3. Olfactory responses are rescued by adrenodoxin reductase
transgenes. (A) The hs-AR and GF-AR transgenes were crossed into
the dare3 mutant background and tested in the T maze. All lines were
in a w1118 genetic background. Error bars indicate s.e.m. Each value
represents n=10 groups of 25-35 flies. Odors were diluted v/v in
paraffin oil as follows: 10−2 for 3-octanol (OCT); 5×10−2 for ethyl
acetate (EA); 5×10−2 for 4-methylcyclohexanol (MCH). Flies were
reared and tested at 22°C. The hs-AR transgene was not induced by
heat shock in this experiment, i.e. the levels of AR RNA transcribed
from the leaky heat-shock promoter were sufficient to rescue the
phenotype. Differences between dare3 and all other lines for 3-OCT,
EA, and MCH are significant at the P<0.04, P<0.03 and P<0.002
levels, respectively.
The dare34 mutation also causes lethality during larval
stages, again with most animals dying either at the second
instar or at the second to third instar larval molt, with the
remaining individuals dying as third instar larvae, failing to
pupariate (Table 1; see also Fig. 6B below). Both dare102
(Table 1) and dare34 (not shown) mutant animals are rescued
to adulthood by either the hs-AR or GF-AR transgene,
indicating that the developmental lethality of both mutations
arises exclusively from mutation of the dare gene. Rescue of
developmental lethality with the hs-AR construct occurred even
Fig. 5. Anti-Dare antibodies reveal the reduction or absence of Dare
protein in dare mutants. Within each blot, equal amounts of protein
were loaded in each lane. (A) Head protein extracts. Molecular
weight markers (kDa) are indicated on the left. The arrowhead
indicates Dare. The fainter band visible below Dare in most tracks is
likely to be a Dare degradation product; its abundance correlates with
the amount of Dare protein except in the case of heat-shocked
animals. A long exposure of the immunoblot (not shown) reveals
very weak bands in lanes 5 and 6, indicating that these mutants do
not completely lack Dare protein. Dare protein level is increased
following heat shock (1 hour at 37°C) in the dare4/dare5; hs-AR
construct (lane 8); the uninduced level in this strain is greater than
that in the dare4/dare5 strain, indicating some expression in the
absence of induction. (B) Dare protein levels in extracts from second
instar larvae are reduced in dare4 and undetectable in dare34.
(C) Cellular fractionation of Drosophila heads reveals that Dare is
found primarily in the fraction containing mitochondria. W, whole
tissue; M, mitochondrial fraction; S, supernatant.
Fig. 4. dare is expressed in tissues that synthesize steroid hormones.
Antisense (A,C) and sense (B) dare RNA probes were hybridized to
ring glands dissected from wandering third-instar larvae (A,B) and
adult ovaries (C) from the w1118 control line. Note the lack of
staining in the cells adjacent to the ring gland (A, bottom). dare
expression in the ovary is only detected in the nurse cells of
developing egg chambers. No label was detected in ovaries
hybridized with the dare sense strand control probe (not shown).
in the absence of heat shock, as if low levels of leaky dare
expression were sufficient for full rescue (evidence for low
levels of expression in the absence of heat shock is shown in
Fig. 5A).
Do dare mutants exhibit defects in larval molting because of
a steroid deficiency? To test this possibility, we collected
dare102 and dare34 larvae at the second instar and fed them the
insect molting hormone 20-hydroxyecdysone (20HE). For both
mutants, feeding with 20HE had a striking effect, providing
substantial rescue of the development defects (Fig. 6B).
Specifically, the per cent of dare102 larvae progressing to or
beyond the second larval molt increased from 7% in control
dare102 animals to 70% in dare102 animals fed 20HE. Similarly,
the per cent of dare34 larvae progressing to or beyond the
Steroids, behavior and neural degeneration 4597
Fig. 6. dare mutants have defects in larval molting and pupariation
that are rescued by 20-hydroxyecdysone (20HE) feeding. (A) A
dare34 larva, with two pairs of mouth hooks, one pair resembling
those of a second-instar larva (small arrows), and the other pair
resembling those of a third-instar larva (large arrows). The larva also
has compound anterior spiracles, composed of spiracles
characteristic of a second-instar larva (small arrowhead) and
spiracles characteristic of a third-instar larva (large arrowheads).
(B) dare mutant defects in molting are rescued by 20HE feeding. A
total of 107-180 larvae were tested per genotype per condition. All
larvae were fed yeast paste wetted with a 10% ethanol solution with
(+) or without (−) 1 mg/ml 20HE. Animals were scored as dying at
the second larval molt (i.e. 2/3 molt) if they had either two sets of
mouth hooks or compound anterior spiracles, as shown in (A). 2nd,
second instar larval stage; 2/3 molt, second larval molt; 3rd, third
instar larval stage. (C) dare mutants exhibit a delay in pupariation
that is rescued by 20HE feeding or by a dare transgene. Each value
represents n=5 groups of 10-12 larvae. Error bars indicate s.e.m. The
percentage of animals pupariating was calculated 48 hours after
control animals began pupariating.
B
Percent Animals Dying
at Indicated Larval Stage
100
- 20HE
+ 20HE
75
50
25
0
2nd
2/3
molt
3rd
dare102
Percent Animals
Pupariating @ 48hrs APF
C
2nd
2/3 3rd
molt
dare34
100
75
50
25
0
+
dare 4
dare 5
dare 4 dare 4 ; hs-AR
dare 5 dare 5
(+ 20HE)
second larval molt increased from 21% in control dare34
animals to 93% in animals fed 20HE.
To expand our understanding of dare gene function at
other developmental times, we sought to analyze mutations
intermediate in severity between the weak, homozygous viable
alleles dare1 and dare3, and the strong, presumptive null alleles
dare102 and dare34. One such intermediate allele is dare4. The
dare4 mutation is a deletion that removes genomic sequences
5′ to the P-element insertion site, presumably removing dare
regulatory sequences, but leaving the dare coding region
entirely intact. Western blot analysis of protein extracts from
dare4 mutant larvae indicates that this mutation reduces, but
does not abolish, Dare protein levels (Fig. 5B). However, the
dare4 mutation is not dare-specific. While the molecular extent
of the deletion has not been determined, it clearly affects at
least one transcription unit besides dare (5A1 in Fig. 2A).
Moreover, the hs-AR and GF-AR transgenes do not rescue the
lethality of dare4 homozygotes. We therefore have analyzed
dare4 in heterozygous combination with two other deletions,
dare34 (described above) and dare5 (Fig. 2A); the
developmental lethality of both of these combinations is
rescued by both hs-AR and GF-AR transgenes (not shown),
indicating that their developmental defects map to dare. The
utility of these heterozygotes is that they contain intermediate
levels of dare function, allowing us to gain insight into
additional roles of dare.
Interestingly, dare4/dare5 heterozygote larvae exhibit a delay
in pupariation, the steroid-mediated transition from the thirdinstar larval stage to the prepupal stage. In synchronous
cultures of larvae, only 34% of dare4/dare5 larvae pupariate
during the 48 hour period following the pupariation of the first
control larva (Fig. 6C). By contrast, 100% of control larvae
pupariate during this 48 hour period. To confirm that this
pupariation defect does in fact derive from a lack of dare
function, and more particularly from a lack of steroid hormone
consequent to insufficient dare function, we performed two
additional rescue experiments. We first tested the ability of the
hs-AR transgene to rescue the phenotype, and found that
dare4/dare5 pupariation rates increased dramatically to 80%
(Fig. 6C). We then tested whether feeding with 20HE could
rescue the defect, and again found that pupariation increased
to 80%. These results confirm a role for dare in pupariation,
and provide further strong support for a role of dare in steroid
hormone synthesis.
Although pupariation is delayed, all or nearly all dare4/dare5
and dare4/dare34 eventually pupariate (Table 1). These animals
4598 M. R. Freeman and others
Table 1. Lethal phases of dare P-element excision mutants
Larval stages
Genotype1
+
dare102
dare34
dare4
dare4/dare5
dare4/dare34
dare102; hs-AR
2nd Instar
(%)
2/3M2
(%)
3rd Instar
(%)
Prepupa3
(%)
Early/mid
pupa3
(%)
0
91
51
05
05
05
2
0
6
30
05
05
05
0
0
3
19
0
0
0
1
0
0
0
14
2
1
1
0
0
0
86
6
2
1
Late pupa/
pharate
adult3,4
(%)
Eclosed
(%)
Total
no. of
larvae
0
0
0
0
39
30
1
100
0
0
0
546
676
94
152
205
201
105
206
207
164
1All stocks were in a y w genetic background.
2Indicates animals that died during the second larval molt.
3Morphological markers representative of the indicated developmental stages were scored according to Bainbridge and Bownes (1981).
4Animals were categorized as late pupae or pharate adults if they had undergone bristle pigmentation.
5Larvae of these genotypes were selected at the third larval instar, as early larval lethality was not observed in previous experiments (see
methods).
6100% of these animals died within 7 days of eclosion.
then undergo premature lethality, with a lethal phase
intermediate between those of null and viable dare genotypes.
Specifically, the majority of these heterozygotes die late in
metamorphosis or early in adult life (Table 1). A large fraction,
39% of dare4/dare5 and 30% of dare4/dare34 mutant animals,
die late in pupation, most of these while attempting to eclose.
Most animals, however, successfully eclose, but all eclosed
flies then die within 7 days. While alive, these adult animals
show an extreme behavioral phenotype: they are unable to
stand, lying on the substratum with legs and wings twitching.
The adult lethality and behavioral uncoordination were rescued
by either the hs-AR or GF-AR transgenes. Rescue was complete
in quantitative measurements of olfactory response for the one
genotype examined, dare4/dare5, following introduction of the
hs-AR transgene: response of the transformants to 4-methyl
cyclohexanol was indistinguishable from control levels (not
shown).
dare mutations cause degeneration of the adult
nervous system
The severe uncoordination of dare4/dare5 and dare4/dare34
mutants, a phenotype that could be rescued by dare transgenes,
prompted us to examine the gross nervous system morphology
of these animals. Striking degeneration was observed in the
nervous systems of both mutants. Particularly prominent was
the appearance of large vacuoles in a variety of brain regions,
including the antennal lobes (Fig. 7A), the optic lobes (e.g. 7F),
the ellipsoid body and fan-shaped body of the central complex
(not shown), and the thoracic nervous system (Fig. 7I).
Examination of the nervous system at several developmental
times indicated that the vacuoles in the optic lobes appear after
optic lobe assembly is complete, or largely complete. Fig. 7C
shows wild-type optic lobes; Fig. 7D shows the optic lobes of a
mutant, which appear similar, at the end of pupal development
(the pharate adult stage). Thus at a gross scale, visual system
morphology appears to develop normally in the mutants.
However, shortly after eclosion, small vacuoles can be seen in
all regions of the optic lobes except the lamina (Fig. 7E, note
inset). The vacuoles enlarge as the animal ages: by 2.5 days
after eclosion the vacuoles are much larger, and are readily
observed in the lamina (Fig. 7F). These defects were observed
both in dare4/dare5 and dare4/dare34, and map to the dare gene,
since they are fully rescued by animals bearing the hs-AR
transgene (Fig. 7G).
Similarly, other brain regions and the thoracic nervous
system appear to assemble normally and then undergo
degeneration. The earliest evidence of vacuoles that we have
observed was in the ellipsoid body and fan-shaped body, where
degeneration first became apparent during the late pupal stages.
We have not detected gross degeneration in the antenna, either
by silver staining or by immunohistochemistry with an antiElav antibody; these results are consistent with the normal
physiology that we have observed in measurements of
electroantennogram and electropalpogram amplitude and
kinetics following stimulation with odorants (e.g. EAG
response amplitude to a 10−2 dilution of ethyl acetate was
12.2±1.0 mV for dare1 and 13.0±1.0 mV for the control; n=5
animals in each case). In all portions of the nervous system
where degeneration was observed, the anatomical phenotype
was fully rescued by the hs-AR transgene. We have not
observed neural degeneration in the weaker alleles dare1 and
dare3, even when animals are aged 3-4 weeks.
DISCUSSION
dare is defective in a defined component of the
steroid hormone synthesis pathway
We have shown that the dare mutant is defective in AR, an
enzyme that acts in the synthesis of all mammalian steroid
hormones. We have found that, in Drosophila, the gene is
expressed at highest levels in the two tissues that are the
primary sites of steroid hormone synthesis. Genetic analysis of
dare shows that its activity is required for the molt from second
to third larval instars, and for pupariation; both of these
developmental transitions follow pulses of steroid hormone in
wild-type. Both of these phenotypes are rescued, to a high
degree, by feeding steroid hormone to dare larvae. These
results indicate that the molting and pupariation defects are due
either exclusively or primarily to a reduction in steroid
hormone levels. Taken together, the simplest interpretation of
all our data is that AR, the product of the Drosophila dare gene,
plays an essential role in the steroid hormone synthetic
pathway. Thus we have provided genetic and molecular
evidence that AR is required for steroid hormone synthesis in
Steroids, behavior and neural degeneration 4599
insects, and that AR is required both for molting and
Requirements for dare in steroid hormone-mediated
pupariation.
developmental transitions
Several other Drosophila mutants associated with
Pulses of steroid hormones during larval life initiate molts and
abnormal ecdysone metabolism have been described
pupariation in insects (Riddiford, 1993). Consistent with a role
previously, but none has been shown to contain a defined
for dare in steroid metabolism, the null mutants dare102 and
lesion in the ecdysteroid biosynthetic pathway.
These mutants have been widely used to analyze
the role of steroid hormones in Drosophila
development and have been very informative in
a variety of ways, but they suffer the limitation
that the molecular nature of their defects either
has not been defined or has been shown not to
lie in the steroid biosynthetic pathway. Such
mutants include ecdysoneless1 (ecd1), a
temperature-sensitive (ts) mutant that fails to
pupariate if shifted to the restrictive temperature
during the early third instar (Garen et al., 1977).
Subsequent work showed ecd1 to exhibit a
wide variety of phenotypes not necessarily
attributable to an ecdysone deficiency (Redfern
and Bownes, 1983; Sliter, 1989). It has been
proposed that ecd1 may affect the intracellular
transport of steroid hormone precursors (Warren
et al., 1996). It has also been proposed that the
ecdysone deficiency in ecd1 results from cell
death and an inhibition of tissue growth
(Redfern and Bownes, 1983) and the molecular
nature of ecd1 remains unknown. Another useful
mutation has been l(3)DTS3, a dominant ts
mutant which, under restrictive conditions,
causes developmental arrest at the third instar
and ultimately lethality (Holden and Suzuki,
1973). A third mutation, giant (gt), is also
associated with abnormal ecdysone production
and molecular analysis has revealed that it
encodes a b-ZIP transcription factor expressed in
a variety of tissues and developmental times
(Capovilla et al., 1992; Schwartz et al., 1984).
In addition to these three mutants, there are
several others associated with abnormal Fig. 7. Degeneration of the adult
ecdysone metabolism, but we are aware of none nervous system in dare mutants. All
in which the defect has been shown to lie in the images are of 5 µm horizontal sections
of animals embedded in paraffin,
steroid biosynthesis pathway.
In addition to the fact that the dare defect has stained by a reduced silver method, and
been assigned to a defined step of ecdysteroid viewed by phase contrast microscopy.
(A) Vacuoles (arrowheads) are apparent
biosynthesis, dare is also of interest in that it is in the antennal lobe in a dare4/dare34
likely to affect production of all steroid hormones adult 2.5 days posteclosion. The star
(see Introduction). If hormones other than 20HE indicates the antennal nerve, visible on
play important roles in Drosophila development, one half of the preparation in this plane of section. (B) Control antennal lobe (w1118,
then genetic analysis of components that respond the control for the dare genetic background) at <5 days posteclosion. (C) The visual
only to 20HE may give an incomplete system of a control animal (w1118). r, retina; l, lamina; m, medulla; lc, lobula
understanding of the role of steroid hormones as complex. (D) a dare4/dare34 animal at the late pupal/pharate adult stage. The
a class. At the same time, we note the possibility morphology appears normal in all portions of the visual system at this stage.
4
34
that genetic manipulation of dare may have (E) dare /dare , within minutes after eclosion. Degeneration is apparent in the
lobula
complex
and medulla. The inset is a higher magnification view of the boxed
pleiotropic effects unrelated to steroid
region; arrowheads indicate vacuoles. (F) A dare4/dare34 animal 2.5 days after
metabolism; we therefore attempted to rescue by eclosion shows severe degeneration throughout the visual system, including the
20HE feeding of larvae the two dare phenotypes lamina (compare to E). (G) The visual system of a dare4/dare5; hs-AR animal,
that could be so tested. A striking rescue effect showing normal morphology. (H) A thoracic ganglion from a control animal (w1118).
was obtained in both cases, providing strong (I) Thoracic ganglion from a dare4/dare34 animal 2.5 days after eclosion. Note that
evidence that hormone insufficiency was in fact the magnification in this panel and in H is lower than in other panels. Magnifications
are 400× for A,B; 300× for C-G; 250× for H,I.
the principal cause of these phenotypes.
4600 M. R. Freeman and others
dare34 arrest developmentally during the second larval instar
or at the second larval molt. dare mutants arrested at the second
larval molt have a phenotype that has not previously been
described to our knowledge: compound anterior spiracles
whose morphology resembles those of molting wild-type
second-instar larvae (Fig. 6A) (Manning and Krasnow, 1993).
They also have two pairs of mouth hooks, one pair
characteristic of second-instar larvae and one of third-instar
larvae (Fig. 6A). This phenotype is very similar to that
observed in some mutants of the ecdysone receptor, EcR
(Schubiger et al., 1998), further supporting the notion that dare
mutants are affected in steroid hormone signaling.
Animals with intermediate levels of dare function
(dare4/dare5) survive through the larval stages but are delayed
in pupariation and die at the end of metamorphosis (Table 1).
Thus dare is required for multiple developmental transitions
that are governed by steroid hormones. The rescue of both
molting and pupariation defects by ecdysone feeding (Fig.
6B,C), along with the localization of dare expression in steroid
biosynthetic tissues, provides strong evidence that dare is
required for steroid hormone synthesis.
Our detection of dare expression in ovaries is of interest in
several respects. First, dare expression in the ovary is limited
to the nurse cells of developing Drosophila egg chambers. This
localization was surprising in light of biochemical studies of
steroid production in ovaries dissected from locusts and
cockroaches, which suggested that steroid hormone synthesis
takes place in the somatic follicle cells surrounding the oocyte
(Lagueux et al., 1977; Zhu et al., 1983). A second interesting
finding was the timing of dare expression during oogenesis. It
is first detectable at stage 6-7 just prior to the onset of
vitellogenesis and then increases dramatically at later stages of
oogenesis. The timing of dare expression and its correlation
with the onset of early ecdysone responsive gene expression
(Buszczak et al., 1999) raises the interesting possibility that the
induction of steroid hormone synthesis in individual egg
chambers may play a role in progression to the vitellogenic
phase. Indeed, germline clones of dare and other genes in the
ecdysone response hierarchy each show arrest by mid
oogenesis (Buszczak et al., 1999).
The ovarian expression of dare may also explain another
interesting finding: the survival of dare null mutants to the
second instar. Ecdysteroids are believed to play important roles
during embryogenesis and during the first larval molt
(Hoffmann and Lagueux, 1985; Riddiford, 1993), and some
mutations removing EcR gene function result in embryonic
lethality (Bender et al., 1997). Why are dare mutants not
blocked in embryogenesis or at the first larval molt? One
possible explanation is that the ovarian expression of dare may
provide a maternal contribution of AR to the embryo. Such a
maternal contribution of dare protein would be consistent with
our detection of Dare protein in 0-2 hour embryos by Western
blotting (A. D., unpublished results), and might be sufficient
to drive development of dare mutants to the second larval
instar. Alternatively, the survival of null mutants to the second
instar may be driven wholly or in part by maternally
contributed ecdysteroids. Indeed, nurse cells are known to
deposit into the Drosophila oocyte products required for
embryogenesis (Spradling, 1993), and maternal contributions
of ecdysteroids have been documented in many insect species
(Hoffmann and Lagueux, 1985). Since nurse cells are the only
cells of the female germline in which dare is expressed, nurse
cells would likely be the site of synthesis of such maternally
contributed ecdysteroids in Drosophila.
dare mutations cause defects in sensory behavior
and neural degeneration
The role of steroid hormones in nervous system development
and function is a major topic in contemporary neurobiology.
However, the power of Drosophila genetics has only recently
been brought to bear on this problem. There has been little
analysis of nervous system development or function in the
previously isolated ecdysone-deficient mutants described
above. At the same time, it is clear that at least some of these
mutations have effects on the nervous system: for example, in
ecd1, the brain size of non-pupariating larvae is smaller than
that of wild-type (Redfern and Bownes, 1983), and there is a
disruption of the progression of the morphogenetic furrow in
the developing eye (Brennan et al., 1998).
A genetic analysis of the ecdysone-triggered regulatory
hierarchy in the central nervous system has been performed
using mutants of the Broad-Complex (BR-C) (Restifo and
Merrill, 1994; Restifo and White, 1991). The BR-C is among
the set of ‘early genes’ that are directly induced by ecdysone,
and it encodes a set of zinc-finger transcription factors. BR-C
mutants, despite their apparently normal larval CNS structure,
show a variety of defects in CNS maturation during
metamorphosis. Among these are the abnormal positioning of
the optic lobes, abnormalities in the internal organization of the
optic lobes, and failure of the right and left brain hemispheres
to fuse. BR-C is also required for normal progression of the
furrow in the developing eye (Brennan et al., 1998). Although
the analysis of BR-C mutant defects has been highly
informative, it may not reveal the full panoply of hormone
action in metamorphosis: there is evidence for one or more
steroid-regulated pathways that are independent of BR-C
(Restifo et al., 1995).
The ecdysone receptor, which lies between ecdysone and the
BR-C in the steroid-triggered regulatory hierarchy, has been
analyzed with respect to its expression pattern in the
developing nervous system (Truman et al., 1994). The results
show that different protein isoforms of the receptor are
expressed in different subsets of neurons, and that there is a
correlation between isoform expression and neuronal fate.
Recently, a mutation of the ecdysone receptor has been shown
to cause defects in the metamorphosis of larval neurons
(Schubiger et al., 1998).
dare provides a new tool for the analysis of steroid hormone
function. Here, using dare mutants, we have identified two new
potential roles for these hormones in the Drosophila nervous
system. The original dare1 allele, as well as another weak dare
allele, dare3, both show dramatic changes in behavioral
responses to olfactory stimuli. More severe reductions in dare
activity affect the nervous system more profoundly:
dare4/dare5 and dare4/dare34 animals assemble an adult
nervous system that appears normal in gross morphology, but
that then undergoes rapid and widespread degeneration. dare
is therefore required for sensory behavior and to maintain the
integrity of the adult nervous system.
Efforts to establish the phenocritical period of dare function
by heat-shock-induced expression of dare have been
unsuccessful, owing to the rescue of dare phenotypes by the
Steroids, behavior and neural degeneration 4601
levels of dare produced in the absence of heat shock. However,
conditional expression of dare may be accomplished by other
means, and could determine whether the behavioral and
neurodegenerative phenotypes of dare mutants represent a
requirement for dare gene function in the nervous system
during development, during the adult stage, or both. One
possibility is that there are developmental abnormalities that
are not severe enough to produce gross structural defects
during assembly, but which lead eventually to disintegration of
nervous system morphology. Alternatively, dare may be
required during adulthood for the normal physiology of the
nervous system. Steroid hormones are apparently synthesized
within the mammalian nervous system (Baulieu, 1997), in
which AR, adrenodoxin and mitochondrial P450s are
expressed (Brentano et al., 1992; Le Goascogne et al., 1987;
Mellon and Deschepper, 1993; Stromstedt and Waterman,
1995). Moreover, steroid hormones have a variety of welldocumented effects on mammalian neurophysiology (Paul and
Purdy, 1992) and behavior (e.g. Flood et al., 1992; Kelley,
1997; Moore and Miller, 1984; Weeks and Levine, 1995). Our
characterization of dare lays a foundation for further studies
that should provide valuable insight into the role of steroid
hormones in nervous system development and function.
We are extremely grateful to Mike Buszczak, other members of the
Segraves laboratory, and members of the Carlson laboratory for
insight, discussion and advice. We thank Tim Tully for generously
providing us with the dare1 allele, Elizabeth Vallen for isolation of
clones, help with in situ hybridizations to polytene chromosomes, and
electrophysiology, Greg Fitzgerald for expert technical advice with
the histochemistry, Doug Kankel for helpful discussions, and
Lapulapu Tiro for superb technical assistance. This work was
supported by grants from the NSF and the NIH to J. R. C. and by a
predoctoral fellowship to M. F. (NIH F31-MH11839).
REFERENCES
Bainbridge, S. P. and Bownes, M. (1981). Staging the metamorphosis of
Drosophila melanogaster. J. Embryol. Exp. Morph. 66, 57-80.
Baulieu, E. E. (1997). Neurosteroids: Of the nervous system, by the nervous
system, for the nervous system. Rec. Prog. Hormone Res. 82, 1-32.
Bender, M., Imam, F. B., Talbot, W. S., Ganetzky, B. and Hogness, D. S.
(1997). Drosophila ecdysone receptor mutations reveal functional
differences among receptor isoforms. Cell 91, 777-788.
Bier, E., Vaessin, H., Shepherd, S., Lee, K., McCall, K., Barbel, S.,
Ackerman, L., Carretto, R., Uemura, T., Grell, E. et al. (1989). Searching
for pattern and mutation in the Drosophila genome with a P-lacZ Vector.
Genes Dev. 3, 1273-1287.
Boynton, S. and Tully, T. (1992). latheo, a new gene involved in associative
learning and memory in Drosophila melanogaster, identified from P
element mutagenesis. Genetics 131, 655-672.
Brennan, C. A., Ashburner, M. and Moses, K. (1998). Ecdysone pathway
is required for furrow progression in the developing Drosophila eye.
Development 125, 2653-2664.
Brentano, S. T., Black, S. M., Lin, D. and Miller, W. L. (1992). cAMP posttranscriptionally diminishes the abundance of adrenodoxin reductase
mRNA. Proc. Nat. Acad. Sci. USA 89, 4099-4103.
Buszczak, M., Freeman, M. R., Carlson, J. R., Bender, M., Cooley, L., and
Segraves, W. A. (1999). Ecdysone response genes govern egg chamber
development during mid-oogenesis in Drosophila. Development 126, 45814589.
Capovilla, M., Eldon, E. and Pirrotta, V. (1992). The giant gene of
Drosophila encodes a βZIP DNA-binding protein that regulates the
expression of other segmentation gap genes. Development 114, 99-112.
Chen, J.-H., Hara, T., Fisher, M. J. and Rees, H. W. (1994). Immunological
analysis of developmental changes in ecdysone 20-mono-oxygenase
expression in the cotton leafworm, Spodoptera littoralis. Biochem. J. 299,
711-717.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation
by acid guanidium thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162, 156-159.
Flood, J. F., Morley, J. E. and Roberts, E. (1992). Memory-enhancing effects
in male mice of pregnenolone and steroids metabolically derived from it.
Proc. Nat. Acad. Sci. USA 89, 1567-1571.
Garen, A., Kauvar, L. and Lepesant, J.-A. (1977). Roles of ecdysone in
Drosophila development. Proc. Nat. Acad. Sci. USA 74, 5099-5103.
Grieneisen, M. L., Warren, J. T. and Gilbert, L. I. (1993). Early steps in
ecdysteroid biosynthesis: Evidence for the involvement of cytochrome P450 enzymes. Insect Biochem. Molec. Biol. 23, 13-23.
Helfand, S. and Carlson, J. (1989). Isolation and characterization of an
olfactory mutant with a chemically specific defect. Proc. Nat. Acad. Sci.
USA 86, 2908-2912.
Hekmat-Scafe, D., Steinbrecht, R. and Carlson, J. R. (1997). Co-expression
of two odorant-binding protein homologs in Drosophila. J. Neurosci. 17,
1616-1629.
Hoffmann, J. A. and Lagueux, M. (1985). Endocrine aspects of embryonic
development in insects. In Comprehensive Insect Physiology,Biochemistry,
and Pharmacology, vol. 1 (ed. G. A. Kerkut and L. I. Gilbert), pp. 435-460.
Oxford: Pergamon Press.
Holden, J. J. A. and Suzuki, D. T. (1973). Temperature sensitive mutations
in Drosophila melanogaster. XII. The genetic and developmental effects of
dominant lethals on chromosome 3. Genetics 73, 445-458.
Kappler, C., Kabbouh, M., Hetru, C., Durst, F. and Hoffman, J. A. (1988).
Characterization of three hydroxylases involved in the final steps of
biosynthesis of the steroid hormone ecdysone in Locusta migratoria
(Insecta, orthoptera). J. Steroid Biochem. 31, 891-898.
Kelley, D. B. (1997). Generating sexually differentiated songs. Curr. Opin.
Neurobiol. 7, 839-843.
Lagueux, M., Hirn, M. and Hoffmann, J. A. (1977). Ecdysone during
ovarian development in Locusta migratoria. J. Insect Physiol. 23, 109-119.
Le Goascogne, C., Robel, P., Gouezou, M., Sananes, N., Baulieu, E.-E. and
Waterman, M. (1987). Neurosteroids: Cytochrome P-450scc in rat brain.
Science 237, 1212-1215.
Levine, R. B., Morton, D. B. and Restifo, L. L. (1995). Remodeling of the
insect nervous system. Curr. Opin. Neurobiol. 5, 28-35.
Lin, D., Shi, Y. and Miller, W. L. (1990). Cloning and sequence of the
human adrenodoxin reductase gene. Proc. Nat. Acad. Sci. USA 87, 85168520.
Lipshitz, H. D. and Kankel, D. R. (1985). Specificity of gene action during
central nervous system development in Drosophila melanogaster: Analysis
of the lethal(1) optic ganglion reduced locus. Dev. Biol. 108, 56-77.
Manning, G. and Krasnow, M. A. (1993). Development of the Drosophila
tracheal system. In The Development of Drosophila melanogaster, vol. 1
(ed. M. Bate and A. Martinez-Arias), pp. 609-689. Plainview, NY: Cold
Spring Harbor Press.
McKenna, M., Hekmat-Scafe, D., Gaines, P. and Carlson, J. R. (1994).
Putative Drosophila pheromone-binding proteins expressed in a subregion
of the olfactory system. J. Biol. Chem. 269, 16340-16347.
Mellon, S. H. and Deschepper, C. F. (1993). Neuorsteroid biosynthesis: genes
for adrenal steroidogenic enzymes are expressed in the brain. Brain Res.
629, 283-292.
Mihalek, R. M. (1995). Characterization of mutations affecting associative
learning in Drosophila melanogaster. Ph.D. dissertation, Brandeis
University.
Miller, W. L. (1988). Molecular biology of steroid hormone synthesis.
Endocrin. Rev. 9, 295-318.
Moore, F. L. and Miller, L. J. (1984). Stress-induced inhibition of sexual
behavior; Corticosterone inhibits courtship behaviors of a male amphibian
(Taricha granulosa). Horm. Behav. 18, 400-410.
O’Connell, P. and Rosbash, M. (1984). Sequence, structure, and codon
preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids
Research 12, 5495-5513.
Paul, S. M. and Purdy, R. H. (1992). Neuroactive steroids. FASEB 6, 23112322.
Pirrotta, B. (1986). Cloning Drosophila Genes. Washington, DC: IRL Press,
Oxford.
Redfern, C. P. F. and Bownes, M. (1983). Pleiotropic effects of the
ecdysoneless-1 mutation of Drosophila melanogaster. Mol. Gen. Genet.
189, 432-440.
Rees, H. H. (1985). Biosynthesis of ecdysone. In Comprehensive Insect
4602 M. R. Freeman and others
Physiology, Biochemistry, and Pharmacology, vol. 7 (ed. G. A. Kerkut and
L. I. Gilbert), pp. 249-293. Oxford: Pergamon Press.
Restifo, L., Estes, P. and Dello Russo, C. (1995). Genetics of ecdysteroidregulated central nervous system metamorphosis in Drosophila
(Diptera:Drosophilidae). Eur. J. Entomol. 92, 169-187.
Restifo, L. L. and Merrill, V. K. L. (1994). Two Drosophila regulatory
gene, Deformed and the Broad-Complex, share common functions in
development of adult CNS, head, and salivary glands. Dev. Biol. 162, 465485.
Restifo, L. L. and White, K. (1991). Mutations in a steroid hormone-regulated
gene disrupt the metamorphosis of the central nervous system in Drosophila.
Dev. Biol. 148, 174-194.
Riddiford, L. M. (1993). Hormones and Drosophila Development. In The
Development of Drosophila melanogaster, vol. 2 (ed. M. Bate and A.
Martinez Arias), pp. 899-939. Plainview,NY: Cold Spring Harbor
Laboratory Press.
Robertson, H., Preston, C., Phillis, R., Johnson-Schlitz, D., Benz, W. and
Engels, W. (1988). A stable source of P element transposase in Drosophila
melanogaster. Genetics 118, 461-470.
Russell, S. and Ashburner, M. (1996). Ecdysone-regulated chromosome
puffing Drosophila melanogaster. In Metamorphosis: Postembryonic
Reprogramming of Gene Expression in Amphibian and Insect Cells, (ed. L.
I. Gilbert, J. R. Tata and B. G. Atkinson), pp. 109-144. San Diego, CA:
Academic Press, Inc.
Schubiger, M., Wade, A. A., Carney, G. E., Truman, J. W. and Bender, M.
(1998). Drosophila EcR-B ecdysone receptor isoforms are required for
larval molting and for neuron remodeling during metamorphosis.
Development 125, 2053-2062.
Schwartz, M. B., Imberski, R. B. and Kelly, T. J. (1984). Analysis of
metamorphosis in Drosophila melanogaster: Characterization of giant, an
ecdysteroid-deficient mutant. Dev. Biol. 103, 85-95.
Sliter, T. J. (1989). Imaginal disc-autonomous expression of a defect in
sensory bristle patterning caused by the lethal(3)ecdysoneless1 (l(3)ecd1)
mutation of Drosophila melanogaster. Development 106, 347-354.
Smith, S. L., Bollenbacher, W. E., Cooper, D. Y., Schleyer, H., Wielgus, J.
J. and Gilbert, L. I. (1979). Ecdysone 20-monooxygenase: characterization
of an insect cytochrome P-450 dependent steroid hydroxylase. Molec. Cell.
Endocr. 15, 111-133.
Solish, S. B., Picado-Leonard, J., Morel, Y., Kuhn, R. W., Mohandas, T.
K., Hanukoglu, I. and Miller, W. L. (1988). Human adrenodoxin
reductase: Two mRNas encoded by a single gene on chromosome
17cen–>q25 are expressed in steroidogenic tissues. Proc. Nat. Acad. Sci.
USA 85, 7104-7108.
Spradling, A. (1986). P Element Mediated Transformation. Washington, DC/
Oxford: IRL Press.
Spradling, A. C. (1993). Developmental genetics of oogenesis. In The
Development of Drosophila melanogaster, vol. 1 (ed. M. Bate and A.
Martinez Arias), pp. 1-70. Plainview, NY: Cold Spring Harbor Laboratory
Press.
Stone, D. and Hechter, O. (1955). Studies on ACTH action in perfused bovine
adrenals: aspects of progesterone as an intermediary in
corticosteroidogenesis. Arch. Biochem. Biophys. 54, 121-128.
Stromstedt, M. and Waterman, M. R. (1995). Messenger RNAs encoding
steroidogenic enzymes are expressed in rodent brain. Mol. Brain Res. 34,
75-88.
Svoboda, J. A. and Thompson, M. J. (1985). Steroids. In Comprehensive
Insect Physiology, Biochemistry, and Pharmacology, vol. 7 (ed. G. A.
Kerkut and L. I. Gilbert), pp. 137-175. Oxford: Pergamon Press.
Thummel, C. and Pirrotta, V. (1992). New pCaSpeR4 P Element Vectors.
Dros. Info. Serv. 71, 150.
Thummel, C. S. (1996). Flies on Steroids: Drosophila metamorphosis and the
mechanisms of steroid hormone action. Trends in Genet. 12, 306-310.
Truman, J. W. (1996). Metamorphosis of the insect nervous system. In
Metamorphosis: Postembryonic Reprogramming of Gene Expression in
Amphibian and Insect Cells, (ed. L. I. Gilbert, J. R. Tata and B. G. Atkinson),
pp. 283-320. New York: Academic Press.
Truman, J. W., Talbot, W. S., Fahrbach, S. E. and Hogness, D. S. (1994).
Ecdysone receptor expression in the CNS correlates with stage-specific
responses to ecdysteroids during Drosophila and Manduca development.
Development 120, 219-234.
Warren, J. T., Bachmann, J. S., Dai, J.-D., and Gilbert, L. I. (1996).
Differential incorporation of cholesterol and cholesterol derivatives into
ecdysteroids by the larval ring glands and adult ovaries of Drosophila
melanogaster: a putative explanation for the l(3)ecd1 mutation. Insect
Biochem. Molec. Biol. 26, 931-943.
Weeks, J. C. and Levine, R. B. (1995). Steroid hormone effects on neurons
subserving behavior. Curr. Opin. Neurobio. 5, 809-815.
Zhu, X. X., Gfeller, H. and Lanzrein, B. (1983). Ecdysteroids during
oogenesis in the ovoviviparous cockroach Nauophoeta cinerea. J. Insect
Physiol. 29, 225-235.