Download Sex differences in resident immune cell phenotype

From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
PHAGOCYTES, GRANULOCYTES, AND MYELOPOIESIS
Sex differences in resident immune cell phenotype underlie more efficient acute
inflammatory responses in female mice
Ramona S. Scotland,1 Melanie J. Stables,2 Shimona Madalli,1 Peter Watson,1 and Derek W. Gilroy2
1Centre for Microvascular Research, William Harvey Research Institute, Barts and The London Medical School, Queen Mary University of London, London,
United Kingdom; and 2Department of Medicine, Rayne Institute, University College London, London, United Kingdom
Females are protected against mortality
arising from severe sepsis; however, the
precise mechanisms that confer this survival advantage in females over males are
unclear. Resident leukocytes in resting
tissues have a significant influence on
circulating cytokine levels and recruitment of blood leukocytes during acute
inflammatory responses. Whether the
phenotype of resident leukocytes is distinct in females is unknown. In the present study, we show that the numbers of
leukocytes occupying the naive perito-
neal and pleural cavities is higher in female than in male mice and rats, comprising more T and B lymphocytes and
macrophages. The altered immune cell
composition of the female peritoneum is
controlled by elevated tissue chemokine
expression. Female resident macrophages also exhibit greater TLR expression and enhanced phagocytosis and
NADPH oxidase–mediated bacterial killing. However, macrophage-derived cytokine production is diminished by proportionally more resident immunomodulatory
CD4ⴙ T lymphocytes. Ovarian hormones
regulate macrophage phenotype, function, and numbers, but have no significant impact on T-lymphocyte populations
in females. We have identified a fundamental sex difference in phenotype of
resident leukocytes. We propose that the
distinct resident leukocyte population in
females allows aggressive recognition
and elimination of diverse infectious
stimuli without recruitment of circulating
neutrophils or excessive cytokine production. (Blood. 2011;118(22):5918-5927)
Introduction
The severity and incidence of innate immune conditions such as
sepsis1 and postsurgery infections are profoundly less in women
compared with age-matched men. This sex difference is evident in
multiple species such that exposure to a wide range of stimuli
(including bacteria, viruses, parasites, fungi, and vascular trauma)
results in reduced severity and minimal loss of tissue function in
females compared with males (for review, see Marriott and
Huet-Hudson2). The clinical consequences of this sexual dimorphism may extend beyond an increase in survival in women and
have important implications for the treatment of inflammatory
disorders in females. Indeed, recent evidence implies a lack of
efficacy of first-line anti-inflammatory drug treatments (including
aspirin3 and statins4) in females; supporting the notion that innate
immune responses may be inherently distinct in females. Therefore, understanding the nature of these differential innate immune
responses in males and females is essential for identifying novel
strategies to appropriately target inflammatory disorders. In addition, it will determine that human clinical trials and experimental
animal studies are designed with sex differences in mind such that
the nature and progression of immune responses to infection and
injury and responsiveness to anti-inflammatory drug treatment are
very much sex specific.
The detrimental effects of acute infections are mediated in part
by the mobilization and subsequent infiltration of leukocytes into
tissues, together with excessive production of cytokines such as
TNF␣ and IL6. The mechanisms that bestow protection from
infection in females are assumed to be mediated by female sex
hormones, in particular 17␤-estradiol, which can directly influence
synthesis and signal transduction of multiple cytokines in vitro
(for review, see Straub5). However, in vivo studies on estrogens
have given conflicting results, partly because of the multiple
actions of estrogens on several different cell types and the
limitations of experimental models with doses of sex hormones that
do not fully reflect the biologic differences between the sexes.
Indeed, 17␤-estradiol treatment can paradoxically increase the
severity of experimental sepsis6 and precipitate fatal inflammatory
cardiovascular disorders7,8 in females. Therefore, whereas it is
clear that estrogens can modulate several pro-inflammatory pathways, many fundamental aspects of the nature of sex differences in
acute inflammatory responses remain undefined. In particular,
whether inherent differences exist in the regulation of trafficking of
blood leukocytes in males and females is not known. In the current
study, we sought to determine the principle differences that endow
females with a more efficient innate immune system. Diverging
from the common approach of primarily focusing on the effects of
estrogens, we have directly examined the mechanisms that regulate
inflammatory cell recruitment and cytokine synthesis in agematched females and males.
Under resting conditions, tissues are populated by resident
leukocytes, including macrophages, which provide basal immune
surveillance necessary to mount rapid, controlled inflammatory
responses to infection or injury. Pathogens and components released from injured cells are sensed by tissue macrophage using a
repertoire of receptors including TLRs,9 which induce the release
of several cytokines (eg, TNF␣) and chemokines (eg, CCL2). The
net result is the recruitment of circulating phagocytes into inflamed
Submitted March 1, 2011; accepted August 30, 2011. Prepublished online as Blood
First Edition paper, September 12, 2011; DOI 10.1182/blood-2011-03-340281.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
An Inside Blood analysis of this article appears at the front of this issue.
The online version of this article contains a data supplement.
5918
© 2011 by The American Society of Hematology
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SEX DIFFERENCES IN RESIDENT INNATE IMMUNE CELLS
Table 1. Characteristics of C57BL/6 mice used in the study
Male
n
Body mass, g
Uterine mass, mg
Female
Sham
OVX
33
34
24
22
26.3 ⫾ 0.46
19.9 ⫾ 0.41†
20.5 ⫾ 0.39
22.1 ⫾ 0.37‡
NM
NM
103 ⫾ 12.7
18 ⫾ 2.7†
NM
NM
95.2 ⫾ 18.64
50.7 ⫾ 5.50§
Plasma 17␤-estradiol,
pg/mL*
NM indicates parameters that were not measured.
*Plasma 17␤-estradiol was measured by enzyme immunoassay.
†P ⬍ .001; ‡P ⬍ .01; and §P ⬍ .05 compared with males or Sham females by
unpaired Student t test.
tissues.10,11 Therefore, resident leukocytes represent the frontline of
innate/nonspecific host defense against infection and injury, but
whether these sentinel cells are regulated in a distinct manner in
females is not known. We hypothesized that the population of
blood leukocytes that reside in resting tissues, such as those found
in the peritoneal and pleural cavities, have a distinct phenotype
compared with male leukocytes, and that this difference enables
female tissues to mount a more robust and efficient response to
subsequent inflammatory insult.
We found that the tissue-resident leukocyte populations in
female mice and rats are more numerous and have a greater density
of pathogen/injury-sensing TLRs compared with those in males.
Our findings demonstrate that this population of cells in females is
more adept at sensing and eliminating pathogens, but that cytokine
synthesis is kept in check by the increased presence of immunomodulatory CD4⫹ T lymphocytes. The fundamental nature of this
difference provides for the first time a unifying mechanism that
accounts for why females are more efficient at responding to the
multiple diverse stimuli that converge onto TLR pathways, and
suggests that reported sex differences in downstream effectors
(eg, PI3K, p38, NF␬B) are likely to be a consequence of
differential activation of TLRs in females. Our study also highlights the inherent differences in tissue and immune cell phenotype
between males and females and supports the recent calls for the
consideration of these sex differences in biomedical research and
drug development.12,13
Methods
Animals
Experiments were conducted on age-matched (8- to 10-week old) male and
female C57BL/6 or Rag2⫺/⫺ mice (Charles River Laboratories) and Wistar
rats (255-275 g; Charles River Laboratories). All animals were housed in
pathogen-free, individually ventilated cages and comparisons were made
between animals treated on the same day and samples that were processed
at the same time. To investigate the impact of ovarian sex hormones, female
C57BL/6 mice were either ovariectomized (OVX) or sham-operated
(Sham) at 4 weeks of age and allowed to recover for 4-5 weeks. Plasma
17␤-estradiol was measured in Sham and OVX mice with a commercially
available enzyme immunoassay (Cayman Chemical Company). All experiments were approved under a Project License (Animals Scientific Procedures Act 1986) issued by the Home Office (United Kingdom) and
conducted according to local guidelines. The characteristics of mice used in
this study are shown in Table 1.
5919
cytometry”). The entire mesenteric vascular bed was collected by separating the mesentery from the intestinal wall and snap-freezing for RNA
analysis.
Flow cytometry
FACS was carried out on a FACSCalibur flow cytometer (BD Biosciences)
with data analyzed by CellQuestPro Version 4.0 software. Leukocytes were
incubated for 30 minutes at 4°C with Abs to either F4/80 (clone BM8;
eBioscience), murine CD3 (clone KT3; Serotec), CD19 (clone 6C5;
Serotec), CD8 (clone YTS169.4; Serotec), CD4 (clone YTS191.1; Serotec),
CD25 (clone PC61.5.3; Serotec), ␥␦ cells (gift from Dr T. Hussell, Kennedy
Institute, London, United Kingdom), GR1 (clone RB6-8C5; BD Pharmingen), TLR2 (clone 6C2; eBioscience), TLR4 (clone UT41; eBioscience), rat
granulocytes (clone RP1; BD Pharmingen), ED1 (clone 1C7; BD Pharmingen), rat CD3 (clone 1F4; BD Pharmingen), or CD45RA (clone OX-33;
BD Pharmingen) using the respective isotype Abs as controls and compensated as appropriate for dual labeling. Cell proliferation was determined by
incorporation of bromodeoxyuridine (BrdU; 1 mg IP; BD Pharmingen)
injected 2 hours before the collection of peritoneal cells and quantified by
FACS. Apoptotic cells were identified as annexin V-positive/propidium
iodide-negative (annexin V⫹/PI⫺) using an apoptosis assay
(BD Pharmingen).
Quantification of chemokines and cytokines
Total RNA was extracted from peritoneal cell pellets and mesenteric tissue
(NucleoSpin; Macherey-Nagel), reverse transcribed using mouse Moloney
leukemia virus reverse transcriptase), and 20 ng of cDNA was submitted to
quantitative real-time PCR (7900HT; Applied Biosystems) and quantified
using SYBR Green (for primer sequences, see Table 2). For each sample,
RNA levels of the target gene were normalized to expression of the
housekeeping gene for 18S and calculated as the -fold expression relative to
mean values of the control group, as indicated in the figure legends.
Cytokines in cell-free peritoneal washouts or cell culture supernatants were
measured by ELISA according to the manufacturer’s instructions
(TNF␣, IL6, IL10, and TGF␤, eBioscience; CCL2, R&D Systems).
Induction of experimental peritonitis and pleurisy
Peritonitis was induced by IP injection of zymosan A (1 mg) or group
B streptococci (GBS; 30 ⫻ 106 per mouse). The clinical GBS isolate
NCTC10/84 (serotype V) was grown in Todd Hewitt broth without agitation
at 37°C to an OD600 of 0.4, equivalent to 108 CFU/mL. Bacteria were
collected by centrifugation and washed with sterile PBS. Mice were
inoculated IP with 30 ⫻ 106 CFU in 300 ␮L of PBS. GBS-induced sepsis
was scored at 3 hours. A score of 1 was given for ruffled fur, 2 for huddled
but active, 3 for inactive, 4 for inactive when handled, and 5 for moribund,
as described previously.6 Pleurisy was induced in male and female Wistar
rats by injection of 0.15 mL of 1% carrageenan (wt/vol) into the pleural
cavity. Peritoneal and pleural leukocytes were collected at 3 hours by lavage
of the cavity with PBS containing 0.3% citrate (wt/vol).
Bacterial survival
Blood samples from GBS-treated mice were collected into heparin from the
tail vein. To determine streptococci survival, the number of CFUs was
determined for 3 dilutions of whole blood after overnight incubation at
37°C on agar plates. The microbicidal capacity of normal mouse plasma
was assessed by determining CFUs after incubation of plasma from male
and female C57BL/6 mice in a 48-well plate with 104 GBS/well for 1 hour
at 37°C.
Collection of resident leukocytes and mesenteric tissue
Assessment of phagocytosis and antibacterial NADPH oxidase
activity
Animals were killed using CO2, and resident peritoneal or pleural leukocytes were collected in sterile phenol red-free DMEM containing 10% FBS,
and counted by hemocytometer. Leukocyte pellets were either snap-frozen
for RNA quantification or prepared for flow cytometry (see “Flow
Phagocytosis of zymosan (5 ⫻ 105 particles for 30 minutes) by murine
resident peritoneal leukocytes (5 ⫻ 104 cells/sample) was assessed using a
colorimetric assay (Cell Biolabs). Intracellular antibacterial NADPH oxidase activity of murine resident macrophages (105 cells/sample) was
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
5920
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SCOTLAND et al
Table 2. Sequence of primers used for real-time quantitative PCR with SYBR Green
Forward
Reverse
Chemokine receptors
CX3CR1
GGAGACTGGAGCCAACAGAG
CCR1
TGCAGGTGACTGAGGTGATTG
CCTGATCCAGGGAATGCTAA
TGAAACAGCTGCCGAAGGTA
CCR2
GGAAGACAATAATATGTTACCTCAGTT
TGGTGGCCCCTTCATCAA
CCR5
CGAAAACACATGGTCAAACG
TTCCTACTCCCAAGCTGCAT
CXCR1
CCCGATCCGTCATGGATGTC
CACAGGGGTGTGGCCAAAAATC
CXCR2
ATGCCCTCTATTCTGCCAGAT
GTGCTCCGGTTGTATAAGATGAC
CXCR3
CTCTTTGCCCTCCCAGATTTC
GGCATAGCAGTAGGCCATGA
CXCR4
TCCAACAAGGAACCCTGCTTC
TTGCCGACTATGCCAGTCAAG
CX3CL1/fractalkine
TCCTGGAGACGACACAGCA
TGCCACCATTTTTAGTGAGGG
CCL2/MCP1
TTAAAAACCTGGATCGGAACCAA
GCATTAGCTTCAGATTTACGGGT
CCL5/RANTES
GCTGCTTTGCCTACCTCTCC
TCGAGTGACAAACACGACTGC
CCL7/MCP3
GGATCTCTGCCACGCTTCTGT
ACTTCCATGCCCTTCTTTGTCTTG
CXCL2/KC
TGAGCTGCGCTGTCAGTGCCT
AGAAGCCAGCGTTCACCAGA
CXCL5/LIX
GCATTTCTGTTGCTGTTCACGCTG
CCTCCTTCTGGTTTTTCAGTTTAGC
CXCL12/SDF1␣
TGCATCAGTGACGGTAAACCA
TTCTTCAGCCGTGCAACAATC
Chemokines
TLRs
TLR2
GCAAACGCTGTTCTGCTCAG
AGGCGTCTCCCTCTATTGTATT
TLR3
GTGAGATACAACGTAGCTGACTG
TCCTGCATCCAAGATAGCAAGT
TLR4
ATGGCATGGCTTACACCACC
GAGGCCAATTTTGTCTCCACA
TLR6
TGAGCCAAGAACAGAAAACCCA
GGGACATGAGTAAGGTTCCTGTT
Myd88
AGGACAAACGCCGGAACTTTT
GCCGATAGTCTGTCTGTTCTAGT
Rat TLR2
CTCCTGTGAACTCCTGTCCTT
AGCTGTCTGGCCAGTCAAC
Rat TLR4
CTGGGTTTCTGCTGTGGACA
AGGTTAGAAGCCTCGTGCTCC
AGCCTGCGGCTTAATTTGAC
CAACTAAGAACGGCCATGCA
Reference gene
18S
determined by kinetic assay using Amplex Red (Invitrogen). The rate of
increase in fluorescence was calculated for 7 minutes in the absence or
presence of phorbol myristate acetate (1 pg/mL) and normalized to total
protein content.
In vitro stimulation of male and female peritoneal leukocytes
Peritoneal leukocytes (2 ⫻ 105) were plated in 24-well plates and stimulated with either TLR2 ligand Pam3CysSerLys4 (Pam3CSK4, 0.1 ␮g/mL;
InvivoGen) or TLR4-specific lipopolysaccharide (LPS; Ultrapure E coli
LPS, 0.1␮g/mL; InvivoGen) for 3 hours. To obtain pure macrophages,
peritoneal cells were depleted of CD19⫹ B lymphocytes using the Macs
CD4 isolation kit (Miltenyi Biotec) separation before plating, and the
residual lymphocytes were removed by washing with PBS. This procedure
yielded a population consisting of 95%-98% F4/80⫹ cells and no CD11c⫹
dendritic cells. CD4⫹ T cells were isolated from splenocytes by negative
selection using the Macs CD4 isolation kit (Miltenyi Biotec.). CD4⫹ T cells
(1.5 ⫻ 105) were incubated with resident peritoneal macrophage (1.5 ⫻ 105)
in a 48-well plate for 2 hours before stimulation with LPS (Salmonella
typhi, 0.1␮g/mL for 18 hours; Sigma-Aldrich).
Statistical analysis
Data are expressed as means ⫾ SEM. Comparisons between 2 groups were
made by 2-tailed unpaired t test. For comparisons between multiple groups,
a 1-way ANOVA was performed, followed by the Bonferroni post test.
Differences between time-response curves were assessed by 2-way ANOVA.
Statistical analysis was performed using Prism Version 4.0 software
(GraphPad).
Results
Fundamental sex differences in cellular composition of naive
peritoneal and pleural cavities
In male mice, we found that total resident peritoneal leukocytes
numbered 16 ⫾ 1.7 ⫻ 105 per cavity, whereas females had
31 ⫾ 2.3 ⫻ 105 cells per cavity (n ⫽ 13, P ⬍ .001, Figure 1A).
This sex difference was not confined to the peritoneum, because the
total cell number in the female pleural cavity was also double that
of males (Figure 1A). Similar sex differences were also observed in
Wistar rats, in which the resting peritoneal and pleural cavities of
females also contained more total leukocytes than in age-matched
males (supplemental Figure 1A, available on the Blood Web site;
see the Supplemental Materials link at the top of the online article).
FACS analysis revealed that this increased number of cells in
females comprised significantly greater numbers of macrophages,
T lymphocytes, and B lymphocytes compared with males (Figure
1B and supplemental Figure 1B-C). Whereas the total number of
each leukocyte subset was greater in females, the proportion of
CD3⫹ T lymphocytes was also greater in females of both species
(Figure 1C and supplemental Figure 1D-E). For example, in mice,
the ratio of peritoneal macrophage/T lymphocytes/B lymphocytes
was 1:0.7:1.5 in males and 1:1.2:1.5 in females. Furthermore, of
this T-lymphocyte population, the total number of CD4⫹ and CD8⫹
cells was significantly greater in females, with little discernible sex
difference in basal levels of CD4⫹/CD25⫹ or gamma/␦ T lymphocytes in the resting peritoneal cavity (Figure 1D).
Increased homeostatic recruitment of leukocytes into the
female peritoneal cavity
To understand why the composition of the female naive peritoneum
is different from that of males, levels of chemokines central to
monocyte and lymphocyte trafficking were measured in unstimulated mesenteric tissues of male and female mice. Female tissues
expressed significantly higher mRNA levels of CX3CL1/fractalkine (chemoattractive for CX3CR1⫹ monocytes, T lymphocytes,
dendritic cells, and natural killer cells), CCL2/MCP1 (chemoattractive for CCR2⫹ monocytes), CXCL12/SDF1␣ (chemoattractive for
CXCR4⫹ lymphocytes), and CCL5/RANTES (chemoattractive for
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SEX DIFFERENCES IN RESIDENT INNATE IMMUNE CELLS
5921
Figure 1. Distinct resident leukocyte population in the
female peritoneal cavity. (A) Increased total resident cell
number in peritoneal (n ⫽ 13 mice; 3 independent groups)
and pleural (n ⫽ 5 mice) cavities of female compared with
male mice. (B) Total cell number and (C) percentage of
F4/80⫹ macrophages, CD3⫹ T lymphocytes, CD19⫹ B lymphocytes, and GR1⫹ granulocytes in peritoneal cavity of
male and female mice were determined by flow cytometry
(n ⫽ 7 mice). (D) Increased total resident CD8⫹ and CD4⫹
T lymphocytes but not CD4⫹/CD25⫹ T-regulatory or
␦␥ T lymphocytes in female peritoneal cavity (n ⫽ 4 mice).
All values are expressed as means ⫾ SEM. All comparisons are relative to male. *P ⬍ .05; **P ⬍ .01; and
***P ⬍ .001 by Student t test.
lymphocytes, dendritic cells, and natural killer cells expressing
CCR1, CCR2, or CCR5) compared with males (Figure 2A). In
addition to increased expression of tissue chemokines, female
leukocytes in the peritoneal cavity also had elevated expression of
chemokine receptors. These data demonstrate that on a cell-for-cell
basis, female resident leukocytes selectively express more chemokine receptor CCR1 (receptor for CCL5), CCR2 (receptor for
CCL2), and CXCR4 (receptor for CXCL12), but relatively less
chemokine receptor CX3CR1 (receptor for CX3CL1). No mRNA
expression of CXCL5/LIX (chemoattractant for CXCR2⫹ neutrophils) was detected in the mesenteric tissue of either sex (Figure
2A). To assess whether the rate of cell turnover was responsible for
the differential leukocyte numbers in males and females, we
measured the incorporation of BrdU or the expression of apoptotic
indices (annexin V⫹/PI⫺) in resident peritoneal leukocytes. BrdU
incorporation was low (⬍0.4%) in both sexes, but was significantly
less in females (0.31% ⫾ 0.04% and 0.15% ⫾ 0.04%, respectively,
P ⬍ .05, n ⫽ 6) whereas the proportion of resident leukocytes
undergoing spontaneous apoptosis was similar in males and
females (8.8% ⫾ 1% and 9.0% ⫾ 0.8%, respectively, n ⫽ 6).
Increased expression of TLRs and elevated phagocytosis by
female macrophages
TLRs interact with conserved structures in pathogens and have a
critical role in host defense.9 Female peritoneal leukocytes of mice
and rats expressed significantly higher mRNA levels of TLRs,
including TLR2 (stimulated by zymosan, gram-positive bacteria,
and heat-shock proteins), TLR3 (stimulated by viruses), TLR4
(stimulated by gram-negative bacteria, fibronectin, hyaluronan,
oxidized LDL, heparan sulfate, and heat-shock proteins), and
Myd88 (activated by the IL1 receptor and most TLRs except
TLR3) compared with males but not TLR6 (forms heterodimer
with TLR2; Figure 3A and supplemental Figure 1F). Cell-surface
expression of murine TLR2 and TLR4 protein was predominantly
expressed on F4/80⫹ macrophages, with little TLR expression
evident on lymphocytes (supplemental Figure 2A-B). Whereas the
total proportion of macrophages expressing TLRs was similar
between the sexes (⬎ 90%), on a cell-for-cell basis, female
macrophages had significantly greater TLR2 and TLR4 expression
(Figure 3B).
Figure 2. Increased homeostatic leukocyte recruitment into female peritoneal cavity. (A) Basal mRNA
expression of chemokines CX3CL1, CCL2, CCL7,
CXCL12, CXCL5, and CCL5 in mesenteric tissue
(n ⫽ 6 mice). (B) Chemokine receptor mRNA expression
in resident peritoneal cells (n ⫽ 4-6 mice). Levels of
mRNA for each sample are normalized to corresponding
mRNA levels of housekeeping gene for small 18S and
calculated as the -fold expression relative to the mean
value in males, except CX3CR1 (relative to female). All
values are expressed as means ⫾ SEM. *P ⬍ .05 and
**P ⬍ .01 by Student t test. ND denotes chemokine
expression that was not detected within 35 PCR cycles.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
5922
SCOTLAND et al
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
Figure 3. Elevated pathogen-sensing and phagocytosis by female macrophages. (A) Basal mRNA expression of TLRs and Myd88 in naive peritoneal cells (n ⫽ 5-6 mice)
and (B) Flow cytometric analysis of surface TLR2 and TLR4 protein expression on resident F4/80⫹ peritoneal macrophages (n ⫽ 6-8; 2 independent experiments).
(C) Phagocytosis of zymosan A (5 ⫻ 106 particles/105 cells, 30 minutes) by equivalent numbers of resident peritoneal leukocytes (macrophage and lymphocytes), measured in
vitro by a colorimetric assay (n ⫽ 5 mice). Basal levels of TLR mRNA in (D) mesenteric tissue and (E) aortae of male and female mice (n ⫽ 6 mice). Levels of mRNA for each
sample are normalized to corresponding mRNA levels of housekeeping gene for small 18S and calculated as the -fold expression relative to the mean value in females. All
results are shown as means ⫾ SEM. *P ⬍ .05; **P ⬍ .01; and ***P ⬍ .001 compared with male by Student t test.
Because macrophage TLRs promote phagocytosis through a
Myd88-dependent pathway,14,15 in addition to increased cytokine
synthesis and inflammatory signaling, one biologic consequence of
greater TLR expression on female leukocytes is efficient phagocytosis. In investigating this hypothesis, we found that the uptake of
zymosan was significantly greater (Figure 3C) in female compared
with male peritoneal leukocytes. Differential TLR expression was
only evident on leukocytes, because assessment of tissue TLRs in
the mesentery and aorta revealed similar TLR levels in both sexes
(Figure 3D-E).
Blunted acute inflammatory responses in females
To determine the impact of the sex-specific basal resident leukocyte
composition of the peritoneal cavity on subsequent pathogenstimulated inflammatory cell recruitment, we examined peritonitis
severity and duration in male and female mice. An intraperitoneal
injection of GBS resulted in the accumulation of 9.5 ⫾ 1.19 ⫻ 106
cells (n ⫽ 7) in the male peritoneal cavity at 3 hours, with only
3.8 ⫾ 0.78 ⫻ 106 cells (n ⫽ 7) recovered from females (P ⬍ .01,
Figure 4A). Together with dampened leukocyte influx, the sepsis
severity score was also significantly less in females (Figure 4B),
with fewer recoverable live bacteria in their peripheral blood
compared with males (Figure 4C). Consistent with increased
macrophage-dependent bacterial killing in females, intracellular
antibacterial NADPH oxidase activity was significantly elevated in
female resident peritoneal macrophages (Figure 4D), whereas the
microbicidal activity of female plasma was not greater than that of
males (Figure 4E). Whereas levels of IL6 in the peritoneal washout
of GBS-treated mice were lower in females (Figure 4F), the
production of other cytokines (including CCL2/MCP1, IL10, and
TGF␤) were not directly correlated with severity of sepsis or
neutrophil recruitment, because there were no discernible differences in peritoneal inflammatory cytokine levels between the
groups (Figure 4F).
Because of the lytic nature of GBS, we used 1 mg of zymosan
(which triggers a resolving peritonitis16) in mice and carrageenaninduced rat pleurisy to discern precise leukocyte subtypes recruited
to inflamed female tissues. Similar to GBS, zymosan- and carrageenan-stimulated inflammatory cell recruitment was significantly
dampened in females compared with males (Figure 4G and
supplemental Figure 1G). This difference in cell number in both
peritonitis and pleurisy in females was accounted for by reduced
trafficking of neutrophils into the cavity at the onset phase (3 hours)
of the response (Figure 4H and supplemental Figure 1H).
Resident lymphocytes control the severity of innate
inflammatory responses in females
Resident macrophages are an important source of the proinflammatory cytokines (eg, TNF␣ and IL6) the overproduction of
which is responsible for detrimental effects in sepsis. Despite
finding twice as many total resident peritoneal macrophages in
females compared with males and elevated basal TLR expression
on these cells, total cytokine levels in cell-free peritoneal exudates
after GBS administration in vivo was similar in both sexes (Figure
4E). Similarly, equivalent numbers of total peritoneal washouts
(comprising macrophages and lymphocytes) from males and
females incubated ex vivo with either TLR2 ligand
Pam3CysSerLys4 or TLR4-specific LPS released quantitatively
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SEX DIFFERENCES IN RESIDENT INNATE IMMUNE CELLS
5923
Figure 4. Reduced severity and neutrophil recruitment in peritonitis in females. (A-C and F) Male and female mice were treated with GBS (30 ⫻ 106 bacteria per mouse
IP; n ⫽ 7 mice) for 3 hours. (A) Total cell number recovered from the peritoneal cavity, (B) sepsis severity score, and (C) whole-blood bacterial count. (D) Phorbol myristate
acetate (1 pg/mL)–induced NADPH oxidase activity in male and female resident peritoneal macrophages (105 cells/sample), measured in vitro by Amplex Red for 7 minutes
(n ⫽ 3 mice). (E) GBS levels after incubation in vitro (104 bacteria/sample) for 1 hour at 37°C with normal mouse plasma (n ⫽ 3 samples from 6 mice in each group).
(F) Concentration of GBS-induced cytokines in cell-free peritoneal lavage (n ⫽ 7 mice). (G-H) Male and female mice were injected with zymosan A (1 mg IP). (G) Total
peritoneal cell number (n ⫽ 5-10; 2 independent experiments) and (H) number of F4/80⫹ macrophages, CD3⫹ T lymphocytes, CD19⫹ B lymphocytes, and GR1⫹ granulocytes
in peritoneal cavity of male and female mice 3 hours after injection of zymosan A (n ⫽ 6 mice). All values (A-H) are expressed as means ⫾ SEM. All comparisons are relative to
male. *P ⬍ .05; **P ⬍ .01; and ***P ⬍ .001 by Student t test; §P ⬍ .05 by 2-way ANOVA followed by Bonferroni posttest; #P ⬍ .001.
equivalent amounts of pro-inflammatory TNF␣, IL6, CCL2/MCP1
and anti-inflammatory IL10 and TGF␤ (Figure 5A). Recent
evidence indicates that T lymphocytes can suppress splenocyte
cytokine production and modulate neutrophil trafficking in vivo.17,18
Questioning whether the increased proportion of resident T lymphocytes curb pro-inflammatory cytokine synthesis by resident macrophages, isolated macrophages were incubated with CD4⫹ T lymphocytes and their ability to generate cytokine TNF␣ was compared
with macrophages alone (Figure 5B). Adding CD4⫹ lymphocytes
to the isolated macrophage population in a 1:1 ratio (as found in the
female peritoneal cavity, Figure 1C) significantly suppressed
LPS-stimulated TNF␣ synthesis (Figure 5B). Similarly, GR1⫹
neutrophil recruitment in vivo was significantly elevated in zymosan-induced peritonitis in the absence of T lymphocytes in lymphocyte-deficient Rag2-knockout mice (Figure 5C).
Ovarian sex hormones contribute to sex differences in resident
immune cell population
To determine the relative impact of female ovarian sex hormones
on the naive resident peritoneal cell population in female mice,
ovaries from 4-week-old female mice were removed. This procedure significantly decreased plasma 17␤-estradiol and prevented
increases in uterine mass (Table 1). Compared with Sham treatment, OVX caused a significant reduction in total resident immune
cells in the peritoneal cavity due to reduced numbers of F4/80⫹
macrophages and CD19⫹ B cells but not CD3⫹ or CD8⫹ T lymphocytes (Figure 6A). Tissue expression of chemokines CCL2/MCP1,
CX3CL1/fractalkine, and CXCL12/SDF1␣ were also significantly
suppressed in OVX females (Figure 6B), with the greatest impact
on monocyte-attracting CCL2. In contrast, OVX had no effect on
tissue expression of lymphocyte-attracting CCL5/RANTES
(Figure 6B). The elevated expression of CCR1, CCR2, and CXCR4
in female leukocytes was also significantly suppressed by OVX
(Figure 6C). Surprisingly, whereas CX3CR1 expression was found
to be low in female resident leukocytes, its expression was lower in
OVX (Figure 6C). OVX also significantly reduced leukocyte
mRNA expression of TLR2, TLR3, TLR4, and Myd88 (Figure 6D)
and protein expression of TLR2 and TLR4 on female resident
macrophages (Figure 6E), along with phagocytosis of zymosan
(Figure 6F). These OVX-induced changes in peritoneal leukocyte
composition and phenotype resulted in increased leukocyte recruitment into the peritoneal cavity by GBS (Figure 6G).
Discussion
There are substantial sex differences in the incidence of several
inflammatory disorders. Females overwhelmingly account for the
majority of cases of autoimmune disease,19 but are relatively
protected from diseases that involve excessive or uncontrolled
activation of innate immune responses, including inflammatory
cardiovascular diseases and severe infections such as sepsis.1
However, females have predominantly been underrepresented or
excluded from clinical trials, and male and female animals are
often used interchangeably in experimental studies with little
consideration given to differences in innate immune responses to
infection/injury between the sexes. Therefore, despite changes in
US Food and Drug Administration regulations20 and numerous
reports outlining the importance of consideration of sex differences
in biomedical research,12,13 little specific information is available
on the mechanisms of innate immune responses in females and how
they differ from responses elicited in males. In the present study,
we demonstrate a sex difference in the phenotype and quantity of
leukocytes resident within the unstimulated peritoneal and pleural
cavities of mice and rats. Compared with males, female resident
macrophages express higher levels of pathogen-/injury-sensing
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
5924
SCOTLAND et al
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
Figure 5. T lymphocytes control the severity of innate inflammatory responses. (A) Cytokine production in vitro by male and female resident peritoneal cells (2 ⫻ 105
cells/sample, n ⫽ 6 mice) after 3 hours of stimulation by TLR4-specific LPS (0.1 ␮g/mL) or the TLR2 agonist Pam3CSK4 (Pam3, 0.1␮g/mL). (B) TNF␣ production by isolated
resident male peritoneal macrophages (1.5 ⫻ 105 cells/sample, n ⫽ 3 mice) treated with LPS (0.1␮g/mL, 18 hours) in the absence or presence of CD4⫹ T lymphocytes
(1.5 ⫻ 105 cells). (C) Zymosan-induced (1 mg IP for 3 hours) recruitment of GR1⫹ granulocytes into the peritoneal cavity of C57BL/6 (wild-type) and T-lymphocyte–deficient
Rag2 knockout (KO) mice (n ⫽ 5 mice). All values are expressed as means ⫾ SEM. #P ⬍ .05 by 1-way ANOVA compared with male; §P ⬍ .05 by 1-way ANOVA relative to
macrophages alone; and *P ⬍ .05 by Student t test relative to wild-type.
TLRs and are more efficient at phagocytosis and bacterial killing.
This increased capacity to detect and eliminate infectious stimuli is
restrained by proportionally more CD4⫹ T lymphocyte, which limit
excessive cytokine production and recruitment of tissue-damaging
neutrophils.
The naive peritoneal and pleural cavities are populated by
resident CD3⫹ T lymphocytes, B1 and B2 lymphocytes, and
macrophages, with few monocytes and neutrophils. In females, we
consistently found greater numbers of total leukocytes in both the
peritoneal and pleural cavities. In mice, total numbers of macrophage and B lymphocytes in females was approximately twice that
found in males. However, T lymphocytes (mainly CD4⫹ Th cells
and CD8⫹ cytotoxic T cells) are proportionally higher in females
such that the total number of this cell type in females is more than
double the number in males. Our data imply that this differential
cellular composition in females is governed by increased activity of
tissue chemokines.
Mobilization and recruitment of blood leukocytes into tissues
under homeostatic or inflammatory conditions is governed by the
activity of chemokines (for review, see Baggiolini21). Female
mesenteric tissues expressed greater levels of specific chemokines
that are typically chemoattractive for both monocytes/macrophages
and lymphocytes (ie, CCL2/MCP1, CX3CL1/fractalkine, CXCL12/
SDF1␣, and CCL5/RANTES). Chemokine CXCL5/LIX is a potent
chemoattractant for CXCR2⫹ neutrophils, but was not detectable in
unstimulated mesenteric tissue of either sex, consistent with a
paucity of GR1⫹ neutrophils in the unstimulated peritoneal cavity
of both sexes. In parallel with elevated production of tissue
chemokines, female resident leukocytes also had higher expression
of the corresponding target chemokine receptors. Therefore, we
suspect that the increased expression of these specific chemokine
pathways by both naive mesenteric tissue and resident peritoneal
immune cells underpins the fundamental difference in leukocyte
composition of peritoneal cavities of female versus male mice. Our
conclusion is further supported by the findings that the rate of
proliferation of peritoneal leukocytes is not greater in females and
that the extent of spontaneous apoptosis is similar in both sexes.
In addition to a quantitative difference in resident tissue
leukocyte numbers in females, we also found differential expression of pathogen- and injury-sensing TLRs and the TLR/IL1receptor adapter signaling molecule Myd88 on resident macrophage. TLRs are activated by numerous pathogens that harbor
“pathogen-associated molecular patterns,” but also by host-derived
“danger signals” released from stressed tissue,22,23 to cause de novo
cytokine/chemokine synthesis and phagocytosis.14,15 In the context
of acute infection, detection and elimination of invading pathogens
by TLRs is at the frontline of host defense. However, prolonged or
excessive TLR activity is also responsible for overexuberant
proinflammatory cytokine production and neutrophil recruitment24
in systemic inflammatory disorders such as bacterial sepsis,25,26 in
which the influx of neutrophils contributes to vascular damage
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SEX DIFFERENCES IN RESIDENT INNATE IMMUNE CELLS
5925
Figure 6. Ovarian sex hormones contribute to sex differences in resident immune cell population. OVX or sham operation was performed on female mice at 4 weeks of
age and they were allowed to recover for 4-5 weeks. (A) Total number of resident F4/80⫹ macrophages, CD3⫹ or CD8⫹ T lymphocytes, and CD19⫹ B lymphocytes in peritoneal
cavity (n ⫽ 5 mice). Basal mRNA expression of (B) mesenteric tissue chemokines (n ⫽ 6-7 mice), (C) chemokine receptors on resident peritoneal leukocytes (n ⫽ 6 mice), and
(D) peritoneal leukocyte TLR expression (n ⫽ 6 mice). (E) Surface expression of TLR2 or TLR4 on F4/80⫹ resident peritoneal macrophages (n ⫽ 3-5 mice). (F) Phagocytosis
of zymosan A (5 ⫻ 106 particles/105 cells, 30 minutes, n ⫽ 4 mice) by resident peritoneal cells in vitro. (G) GBS-induced (30 ⫻ 106 bacteria/mouse IP for 3 hours, n ⫽ 7 mice)
accumulation of leukocytes in peritoneal cavity. All values (A-G) are expressed as means ⫾ SEM. Expression of mRNA for each sample is normalized to corresponding levels
of the housekeeping gene for small 18S and is calculated as the -fold expression relative to OVX females. All comparisons are relative to Sham females. *P ⬍ .05; **P ⬍ .01;
and ***P ⬍ .001 by Student t test; NS denotes P ⬎ .05.
through the production of destructive reactive oxygen intermediates.27 In the current study, we show that female resident peritoneal
macrophages have significantly higher total expression of TLR2,
TLR3, and TLR4 that collectively recognize several diverse
pathogens, including various bacteria, yeast, viruses, and injuryelicited danger signals. The elevated expression of TLRs on tissue
macrophages in females implies that these cells have a greater
capacity to detect and eliminate pathogens, as confirmed by their
increased capacity to engulf zymosan particles (TLR2 agonist).
Indeed, exposure of peritoneal macrophages in males and females
in vivo to equivalent amounts of live TLR-activating bacteria (by
IP administration of GBS) resulted in a less severe sepsis and lower
blood bacteria in females. The reduced bacterial load arose from
elevated intracellular antibacterial NADPH oxidase activity of
female resident peritoneal macrophages coupled with enhanced
phagocytosis, and was not a consequence of increased influx of
phagocytic neutrophils into the peritoneum or enhanced microbicidal factors in female plasma. In fact, in females, zymosan-induced
peritonitis was accompanied by substantially less neutrophil recruitment than in males, thereby sparing female tissues from the
deleterious effects of neutrophil-derived mediators.
TLRs are not restricted to cells of the immune system, but have
also been described in the vasculature. The function of these
receptors in the vasculature is not well established, but one study
suggests that TLRs located on the vascular endothelium can
directly bind bacteria and contribute to vascular dysfunction and
granulocyte recruitment during sepsis.28 To determine whether
female blood vessels also exhibit high TLR expression, we
measured TLR mRNA expression in mesenteric tissue and in the
aorta, but no sex difference in expression was evident in either
vascular bed. Therefore, sex-specific up-regulation of TLR expression in females is restricted to expression on leukocytes, an effect
that permits heightened sensitivity to diverse infectious agents
while protecting the vasculature from TLR-mediated vascular
dysfunction.
In contrast to phagocytosis, elevated expression of macrophage
TLR in females was not correlated with elevated TLR-induced
cytokine production in vivo or in vitro. Indeed, the amount of IL6
released into the peritoneal cavity after GBS challenge was
suppressed in females; a finding that concurs with other reports of
direct modulation of this cytokine by endogenous estrogens.29 As
noted earlier, the proportion of resident T lymphocytes is significantly greater in female than male peritoneal cavities of mice.
Similarly, circulating CD4⫹ T lymphocytes are also significantly
greater in women30 and other female primates,31 indicating that this
is a common feature across female species. The presence of this
additional population of CD4⫹ T lymphocytes in females is likely
to modulate macrophage function. We found that coincubation of
murine resident peritoneal macrophages with CD4⫹ T lymphocytes
significantly suppressed the macrophage-derived LPS-induced release of cytokine TNF␣ in vitro. However, this dampening of
TLR-induced macrophage function does not appear to affect
TLR-induced phagocytosis, because zymosan uptake by female
macrophages was greater than in males despite the presence of
resident T lymphocytes. Previous studies have demonstrated that
T lymphocytes can modulate neutrophil recruitment in innate
immune responses.17 Similarly, neutrophil influx in zymosanperitonitis was enhanced in lymphocyte-deficient mice; supporting
a role for resident peritoneal T lymphocytes in the suppression of
TLR-induced neutrophil recruitment. Therefore, the increased
number of resident peritoneal T lymphocytes in female mice may
act as an endogenous “brake” on resident macrophages to control
the severity of cytokine production and granulocyte recruitment in
the face of elevated TLR activation and phagocytosis.
In women, menopause initiates complex biologic changes that are
also thought to be associated with the loss of survival benefit over men
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
5926
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
SCOTLAND et al
with respect to inflammatory conditions. The precise mechanisms
affected by reduced ovarian function that lead to menopause-induced
changes in immune responses are not clear. Therefore, we investigated
whether ovarian hormones influence the differential resident leukocyte
population in females and how these changes affect the subsequent
response to infection. Tissue expression of the monocyte-attracting
chemokines CCL2, CX3CL1, and CXCL12 were significantly suppressed by OVX. However, these differences in tissue chemokine levels
(particularly lymphocyte/monocyte-attracting CXCL12) compared with
sham-operated females were substantially less than the difference
between males and females, indicating only a partial transition toward
the male phenotype in OVX females. This partly reflects the fact that
whereas OVX suppresses circulating levels of ovarian hormones such as
17␤-estradiol, it does not eliminate all sources of sex steroid hormones
(ie, the adrenal cortex and adipocytes). The reduction of expression of
chemokines that are central to trafficking of leukocytes was accompanied by a reduction in resident macrophage and B lymphocytes in OVX
females. However, OVX had no effect on tissue expression of
lymphocyte-attracting CCL5 and consequently did not affect the
number of resident peritoneal T lymphocytes. Therefore, reduction
of functional ovarian hormone activity in females alters basal
chemokine function and thereby trafficking of monocytes and
B lymphocytes, but not T lymphocytes, into healthy tissues. The
elevated expression of the chemokine receptors CCR1, CCR2, and
CXCR4 in female leukocytes was also significantly suppressed by
OVX, which is consistent with previous studies implicating
estrogen-dependent up-regulation of CCRs on CD4⫹ splenocytes.32
However, whereas CX3CR1 expression was found to be low in
female resident leukocytes, its expression was further suppressed
by removal of ovarian sex hormones, indicating that CX3CR1 is
regulated in a distinct manner from other chemokine receptors. It is
possible that endogenous testosterone levels that are high in males
but reduced by OVX in females influence CX3CR1 expression.
Overall, our study shows that ovarian hormones affect the specific
chemokine pathways that are differentially expressed between
males and females in both tissue and resident immune cells such
that the composition of peritoneal cavity of OVX females was
similar but not equivalent to that in males.
In addition to controlling homeostatic recruitment of leukocytes, ovarian hormones also influenced the expression and activity
of macrophage TLRs. Whereas OVX affects physiologic levels of
several steroid hormones and gonadotropins, it is likely that the
hormone responsible for altered TLR expression in females is
17␤-estradiol, because estrogen response elements have been
reported in the promoters of murine TLR2 and TLR4 genes.33
Similarly, other recent studies demonstrate elevation of TLR4 on
OVX macrophages after chronic exposure to 17␤-estradiol but not
progesterone.6 In agreement with a reduced expression of TLRs,
OVX also diminished the phagocytic capacity of resident macrophage. Therefore, ovarian hormones have a profound impact on the
female macrophage population with respect to their homeostatic
recruitment, TLR expression, and phagocytosis, but have no
significant effect on T-lymphocyte populations. The change in
macrophage phenotype in OVX females also affected neutrophil
influx into the peritoneal cavity in bacterial peritonitis. The total
number of leukocytes recruited in GBS-induced peritonitis was
significantly greater in OVX females. However, consistent with a
partial transition to the male phenotype, elevations in leukocyte
influx were substantially less in OVX females than in males. The
modest effect of OVX on GBS-peritonitis is likely to be due to the
unaltered T-lymphocyte population in the peritoneal cavity that
suppresses cytokine production and granulocyte recruitment. Therefore, the abundant resident T lymphocytes in females appear to
have a dominant inhibitory role in modulating the magnitude of
recruitment of blood leukocytes into inflamed tissues.
In summary, our results explain why females exhibit a dampened inflammatory response and suffer less tissue injury to a broad
range of noxious stimuli because they possess all of the following:
(1) heightened sensitivity to infectious and injurious stimuli (in the
form of an increased number of tissue macrophages with a greater
density of pathogen/injury-sensing TLRs); (2) more efficient
phagocytosis and NADPH oxidase–mediated killing by resident
macrophages that eliminate pathogens faster than in males; and
(3) an increased population of resident anti-inflammatory T lymphocytes that selectively prevents excessive macrophage-derived cytokine production without affecting phagocytosis. Therefore, the
mechanisms that regulate leukocyte function in females are more
efficient than that in males, because rapid detection and elimination
of pathogens increases the threshold for pathogen-induced tissue
injury in females. Ultimately, this robust response in females
circumvents the need to recruit substantial numbers of neutrophils
from the circulation and therefore protects tissues from collateral
damage incurred by neutrophil-derived mediators that contribute to
tissue injury and loss of function.
Acknowledgments
R.S.S. is the recipient of a Wellcome Trust Career Development
Fellowship and D.W.G. of a Wellcome Trust Senior Fellowship.
M.J.S. was funded by an MRC Studentship, S.M. by a Barts & The
London Studentship, and P.W. by a Barts & The London Vacation
Scholarship.
Authorship
Contribution: R.S.S. and D.W.G. designed the project, performed
the experiments, analyzed the data, interpreted the results, and
wrote the manuscript; M.J.S. designed and performed the experiments; and S.M. and P.W. performed the experiments.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Ramona S. Scotland, Centre for Microvascular Research, William Harvey Research Institute, Barts & The
London School of Medicine and Dentistry, Queen Mary University
of London, Charterhouse Square, London EC1M 6BQ, United
Kingdom; e-mail: [email protected].
References
1. Adrie C, Azoulay E, Francais A, et al. Influence of
gender on the outcome of severe sepsis: a reappraisal. Chest. 2007;132:1786-1793.
2. Marriott I, Huet-Hudson YM. Sexual dimorphism
in innate immune responses to infectious organisms. Immunol Res. 2006;34(3):177-192.
3. Ridker PM, Cook NR, Lee I-M, et al. A randomized trial of low-dose aspirin in the primary pre-
vention of cardiovascular disease in women.
N Engl J Med. 2005;352(13):1293-1304.
4. Rosenberg H, Allard D. Women and statin use: a
women’s health advocacy perspective. Scand
Cardiovasc. 2008;42(4):268-273.
5. Straub RH. The complex role of estrogens in inflammation. Endocr Rev. 2007;28:521-574.
6. Rettew JA, Huet YM, Marriott I. Estrogens aug-
ment cell surface TLR4 expression on murine
macrophages and regulate sepsis susceptibility
in vivo. Endocrinology. 2009;150:38773884.
7. Rossouw JE, Anderson GL, Prentice RL, et al; Writing Group for the Women’s Health Initiative Investigators. Risks and benefits of estrogen plus progestin
in healthy postmenopausal women: principal results
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 24 NOVEMBER 2011 䡠 VOLUME 118, NUMBER 22
from the Women’s Health Initiative randomized controlled trial. JAMA. 2002;288:321-333.
8. Vickers MR, Maclennan AH, Lawton B, et al.
Main morbidities recorded in the women’s international study of long duration oestrogen after
menopause (WISDOM): a randomised controlled trial of hormone replacement therapy in
postmenopausal women. BMJ. 2007;
335(7613):239-239.
9. Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on
Toll-like receptors. Nat Immunol. 2010;11(5):
373-384.
10. Cailhier JF, Sawatzky DA, Kipari T, et al. Resident
pleural macrophages are key orchestrators of neutrophil recruitment in pleural inflammation. Am J
Resp Crit Care Med. 2006;173(5):540-547.
11. Soehnlein O, Lindbom L. Phagocyte partnership
during the onset and resolution of inflammation.
Nat Rev Immunol. 2010;10(6):427-439.
12. Check Hayden E. Sex bias blights drug studies.
Nature. 2010;464:332-333.
13. Kim AM, Tingen CM, Woodruff TK. Sex bias in
trials and treatment must end. Nature. 2010;465:
688-689.
14. Amiel E, Alonso A, Uematsu S, Akira S, Poynter ME,
Berwin B. Pivotal advance: Toll-like receptor
regulation of scavenger receptor-A-mediated
phagocytosis. J Leukoc Biol. 2009;85:595-605.
15. Doyle SE, O’Connell RM, Miranda GA, et al. Tolllike receptors induce a phagocytic gene program
through p38. J Exp Med. 2004;199:81-90.
SEX DIFFERENCES IN RESIDENT INNATE IMMUNE CELLS
16. Rajakariar R, Lawrence T, Bystrom J, et al. Novel
biphasic role for lymphocytes revealed during resolving inflammation. Blood. 2008;111(8):41844192.
17. Kipari T, Watson S, Houlberg K, Lepage S,
Hughes J, Cailhier JF. Lymphocytes modulate
peritoneal leukocyte recruitment in peritonitis.
Inflam Res. 2009;58:553-560.
18. Kim KD, Zhao J, Auh S, et al. Adaptive immune
cells temper initial innate responses. Nat Med.
2007;13:1248-1252.
26.
27.
28.
19. Whitacre CC. Sex differences in autoimmune disease. Nat Immunol. 2001;2:777-780.
20. Merkatz RB, Temple R, Subel S, Feiden K,
Kessler DA. Women in clinical trials of new drugs.
A change in Food and Drug Administration policy.
The Working Group on Women in Clinical Trials.
N Engl J Med. 1993;329(4):292-296.
29.
30.
21. Baggiolini M. Chemokines and leukocyte traffic.
Nature. 1998;392:565-568.
22. Piccinini AM, Midwood KS. DAMPening inflammation by modulating TLR signalling. Mediators
Inflamm. 2010;2010. pii: 672395.
23. Medzhitov. Origin and physiological roles of inflammation. Nature. 2008;454:428-435.
24. Lefebvre JS, Marleau S, Milot V, et al. Toll-like
receptor ligands induce polymorphonuclear leukocyte migration: key roles for leukotriene B4 and
platelet-activating factor. FASEB J. 2010;24(2):
637-647.
25. Meng G, Rutz M, Schiemann M, et al. Antagonistic antibody prevents toll-like receptor 2-driven
31.
32.
33.
5927
lethal shock-like syndromes. J Clin Invest. 2004;
113(10):1473-1481.
Poltorak A, He X, Smirnova I, et al. Defective LPS
signaling in C3H/HeJ and C57BL/10ScCr mice:
mutations in Tlr4 gene. Science. 1998;282(5396):
2085-2088.
Nathan C. Neutrophils and immunity: challenges
and opportunities. Nat Rev Immunol. 2006;6:173182.
Andonegui G, Bonder CS, Green F, et al. Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-induced neutrophil sequestration
into lungs. J Clin Invest. 2003;111:1011-1020.
Naugler WE, Sakurai T, Kim S, et al. Gender disparity in liver cancer due to sex differences in
MyD88-dependent IL-6 production. Science.
2007;317(5834):121-124.
Amadori A, Zamarchi R, De Silvestro G, et al. Genetic control of the CD4/CD8 T-cell ratio in humans. Nat Med. 1995;1:1279-1283.
Xia H-J, Zhang G-H, Wang R-R, Zheng Y-T. The
influence of age and sex on the cell counts of peripheral blood leukocyte subpopulations in Chinese rhesus macaques. Cell Mol Immunol. 2009;
6:433-440.
Mo R, Chen J, Grolleau-Julius A, Murphy HS,
Richardson BC, Yung RL. Estrogen regulates
CCR gene expression and function in T lymphocytes. J Immunol. 2005;174:6023-6029.
Bourdeau V, Deschênes J, Métivier R, et al. Genome-wide identification of high-affinity estrogen
response elements in human and mouse. Mol
Endocrinol. 2004;18:1411-1427.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2011 118: 5918-5927
doi:10.1182/blood-2011-03-340281 originally published
online September 12, 2011
Sex differences in resident immune cell phenotype underlie more
efficient acute inflammatory responses in female mice
Ramona S. Scotland, Melanie J. Stables, Shimona Madalli, Peter Watson and Derek W. Gilroy
Updated information and services can be found at:
http://www.bloodjournal.org/content/118/22/5918.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Phagocytes, Granulocytes, and Myelopoiesis (616 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.