Download Thesis_Last

The Pennsylvania State University
The Graduate School
College of Medicine
Lysosomotropic
Cholesterol Transport Inhibitors
As Potential Chemotherapeutic Agents
A Dissertation in
Genetics
by
Omer F. Kuzu
© 2014 Omer F. Kuzu
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
December 2014
ii
The dissertation of Omer F. Kuzu was reviewed and approved* by the following:
Gavin Robertson
Professor of Pharmacology, Pathology, and Dermatology
Dissertation Advisor
Committee Chair
Robert Levenson
Professor of Pharmacology, Pathology, and Dermatology
Jin-Ming Yang
Professor of Pharmacology
Sinisa Dovat
Associate Professor of Pediatric Hematology and Oncology
Michael Verderame, PhD
Associate Dean for Graduate Studies
*Signatures are on file at the Graduate School
iii
ABSTRACT
According to American Cancer Society’s 2014 Cancer Facts report,
cancer is the second leading cause of death in United States and over half
million people are expected to die from this deadly disease. Until 2030, it is
forecasted to be the primary cause of death with a 45 % increase in new cancer
cases. Skin cancer is the most common form of cancer in the United States with
more than 3 million cases is diagnosed, annually. Most skin cancers can be
surgically removed when detected early. However, melanoma, the malignancy of
pigment producing skin cells, is the most aggressive and dangerous of all skin
cancers. It accounts for approximately 80% of skin cancer associated deaths.
Until 2013, dacarbazine (DTIC), an alkylating chemotherapeutic agent that was
approved by U.S. Food and Drug Administration (FDA) in 1975, was the most
common drug used for the treatment of melanoma. Recently, targeted agents
such as those targeting the MAP kinase pathway have been approved by the
FDA for the treatment of melanoma. However, in nearly all cases, development
of drug resistance limits the efficacy of these agents to only few months.
Therefore, there is need for development of new melanoma therapeutics that
have long term efficacy.
Recently, we have identified Leelamine, a small natural compound as a
potential chemotherapeutic agent against melanoma. Leelamine was 3 to 5 fold
more effective at inhibiting viability of malignant melanoma cell lines compared to
iv
other skin cells. More importantly, leelamine showed efficacy in-vivo leading to
~60% decrease in the growth of xenografted melanoma tumors. However, very
few reports were available regarding the mechanism of action of this agent.
Therefore, the primary objective of my dissertation is to identify the molecular
mechanisms leading to leelamine-mediated cancer cell death. Our studies
suggested that as a weakly basic amine, leelamine displayed lysosomotropism
that lead to its accumulation inside the acidic organelles and consequently
disrupted cholesterol egress from lysosomes. Inhibition of intracellular
cholesterol transport by leelamine was the leading cause of cell death. These
findings led to the development of our secondary objective, which was to explore
the chemotherapeutic efficacy of other potential cholesterol transport inhibitors.
A class of weakly basic lysosomotropic compounds called Functional Inhibitors of
Acid Sphingomyelinases (FIASMA) were identified as potential cholesterol
transport inhibitors and shown to be effective against melanoma cells as well as
xenografted melanoma tumors.
In this dissertation, we show that as a cholesterol transport inhibitor,
leelamine and several FIASMA compounds disrupt autophagic flux and inhibit
receptor-mediated endocytosis resulting in the shutdown of key pathways to
which melanoma cells are addicted. Inhibition of lysosomotropic accumulation of
compounds by Bafilomycin-A1 co-treatment or depletion of cellular cholesterol
with β-cyclodextrin co-treatment was able to attenuate the cell death mediated by
these agents. This study is unique in terms of identification of FIASMA
v
compounds as potential chemotherapeutic agents showing efficacy through
inhibiting intracellular cholesterol transport. In fact, two FIASMA compounds,
Perphenazine and Fluphenazine, that are generic antipsychotic drugs, led to 50
to 60% inhibition of xenografted melanoma tumor development. Since most of
the FIASMA compounds were generic tricyclic antidepressants or antipsychotics
with well-known toxicity profiles, the findings of this study could open new
perspectives for repurposing these drugs for the treatment of advanced-stage
cancers.
vi
TABLE OF CONTENTS
LIST OF FIGURES……………………………………………………………………..x
LIST OF TABLES……………………………………………...….……………..……xiv
LIST OF ABBREVIATIONS…………………………………………………..……....xv
ACKNOWLEDGEMENTS …………………………………………………………..xvii
CHAPTER 1 Chemotherapeutic Potential of Lysosomotropic Compounds:
A Review from Mechanism of action to signaling ........................................ 1
1.1 Abstract .............................................................................................. 2
1.2 Introduction ......................................................................................... 4
1.3 Lysosomotropism ............................................................................... 6
1.3.1 Mechanism of lysosomotropism: Cation trapping. ....................... 6
1.3.2 Factors that influence lysosomotropism. ..................................... 7
1.3.3 The effects of lysosomotropism on cells and drug distribution .... 7
1.4 Classification of lysosomotropic compounds ...................................... 8
1.4.1 Class-I lysosomotropic compounds ............................................. 8
1.4.2 Class-II lysosomotropic compounds .......................................... 10
1.5 Class-II lysosomotropic compounds inhibit lysosomal cholesterol
transport........................................................................................... 11
1.5.1 Lysosomal cholesterol homeostasis and NPC disease ............. 11
1.5.2 Class-II lysosomotropic compounds inhibit lysosomal cholesterol
egress ....................................................................................... 12
1.6 The effects of inhibition of lysosomal cholesterol transport on cellular
cholesterol homeostasis .................................................................. 14
1.6.1 Intracellular cholesterol homeostasis ......................................... 14
1.6.2 Autophagy as a source of lysosomal cholesterol ....................... 15
1.6.3 Inhibition of intracellular cholesterol transport induces autophagy
.................................................................................................. 17
1.6.4 Inhibition of intracellular cholesterol transport blocks autophagic
flux ............................................................................................ 19
1.7 The effects of class-II lysosomotropic compounds on sphingolipid
metabolism ...................................................................................... 19
1.7.1 Acid Sphingomyelinase Deficiency and NPC disease ............... 19
1.7.2 Class-II lysosomotropic compounds inhibit ASM activity:
FIASMAs ................................................................................... 21
vii
1.8 Chemotherapeutic potential of class-II lysosomotropic compounds 22
1.9 Class-II lysosomotropic compounds increase sensitivity of multidrug
resistant cell lines to chemotherapeutic agents ............................... 25
1.10 Epidemiological studies .................................................................. 27
1.11 Cell death mediated by Class-II lysosomotropic compounds:
mechanisms of action ...................................................................... 31
1.11.1 Disruption of integrity of cellular membranes ........................... 33
1.11.2 Induction of arachidonic acid metabolism. ............................... 34
1.11.3 Increased oxysterol levels ....................................................... 34
1.11.4 Disruption of mitochondrial membrane cholesterol levels ........ 35
1.11.5 BAX mediated cell death ......................................................... 36
1.11.6 Disruption of Golgi vesiculation and caveolin transport ........... 37
1.11.7 Disruption of lipid rafts and inhibition of endocytosis ............... 37
1.11.8 Inhibition of membrane to cytosol signaling cascades ............. 38
1.11.9 Induction of endoplasmic reticulum stress ............................... 40
1.11.10 Inhibition of autophagic flux ................................................... 44
1.12 The increased sensitivity of cancer cells to class-II lysosomotropic
compounds ...................................................................................... 45
1.12.1 Decreased levels of LAMP-1 and LAMP-2 proteins in cancer
cells ........................................................................................... 45
1.12.2 Decreased activity of ASM in cancer cells ............................... 46
1.12.3 Oncogene addiction ................................................................. 47
1.13 Conclusion ...................................................................................... 48
CHAPTER 2: Leelamine mediates cancer cell death through inhibition of
intracellular cholesterol transport................................................................50
2.1 Abstract ............................................................................................ 51
2.2 Introduction ....................................................................................... 53
2.3 Materials and Methods ..................................................................... 55
2.3.1 Cell lines, culture conditions and plasmids. ............................... 55
2.3.2 Cell viability assay and drug treatments. ................................... 56
2.3.3 Caspase dependence, mitochondrial membrane potential and
DNA fragmentation assays. ...................................................... 58
2.3.4 Electron microscopy analyses. .................................................. 58
2.3.5 Kinexus and Receptor Tyrosine Kinase Protein Arrays. ............ 59
2.3.6 Cholesterol localization, quantitation and TLC analyses. .......... 59
viii
2.3.7 Evaluation of endocytosis. ......................................................... 60
2.3.8 Analyses of drug uptake using 3H labeled leelamine. ................ 60
2.3.9 Analyses of lysosomotropism. ................................................... 60
2.3.10 Western blot analysis. ............................................................. 61
2.3.11 siRNA transfections. ................................................................ 62
2.3.12 Statistical analysis. .................................................................. 63
2.4 Results ............................................................................................. 64
2.4.1 Leelamine inhibits autophagic flux in melanoma cells. .............. 64
2.4.2 Leelamine has lysosomotropic property leading to accumulation
in acidic organelles.................................................................... 66
2.4.3 Lysosomotropic property of leelamine mediated early caspaseindependent melanoma cell death. ........................................... 68
2.4.4 Blockage of autophagic flux mediated by leelamine. ................. 73
2.4.5 Activity of leelamine was not mediated by PDKs or Cannabinoid
receptors. .................................................................................. 74
2.4.6 Leelamine induced intracellular cholesterol accumulation and
altered cholesterol subcellular localization. ............................... 75
2.4.7 Leelamine inhibited cellular endocytosis. ................................. 78
2.4.8 Leelamine inhibited signaling pathways driving melanoma cell
survival. ..................................................................................... 80
2.4.9 Leelamine disrupted receptor tyrosine kinase signaling via
interference with intracellular vesicular transport systems, which
was reversible by cholesterol depletion..................................... 83
2.5 Discussion ........................................................................................ 86
2.6 Acknowledgements .......................................................................... 90
CHAPTER 3 Intracellular Cholesterol Transport Inhibitors as Potential
Therapeutic Agents for Melanoma.............................................................91
3.1 Abstract ............................................................................................ 92
3.2 Introduction ....................................................................................... 94
3.3 Materials and Methods ..................................................................... 97
3.3.1 Cell lines, culture conditions and plasmids. ............................... 97
3.3.2 Cell viability assay, drug treatments and IC50 determination. ... 97
3.3.3 Mitochondrial membrane potential, caspase and caspasedependence assays. ................................................................. 98
3.3.4 Annexin V- Propidium Iodide staining. ....................................... 99
3.3.5 Cholesterol localization assay. .................................................. 99
ix
3.3.6 Evaluation of cellular endocytosis............................................ 100
3.3.7 Western blot analysis. ............................................................. 100
3.3.8 Immunofluorescence analyses. ............................................... 101
3.3.9 Animal studies. ........................................................................ 102
3.3.10 Statistical analysis. ................................................................ 102
3.4 Results ........................................................................................... 103
3.4.1 Identification of compounds that kill cancer cells by inhibiting
lysosomal cholesterol transport. .............................................. 103
3.4.2 Certain FIASMA compounds inhibit export of late
endosomal/lysosomal cholesterol by accumulating in these
organelles. .............................................................................. 107
3.4.3 Cholesterol transport inhibitors effectively inhibit xenografted
melanoma tumor growth. ........................................................ 110
3.4.4 Cholesterol transport inhibitors block autophagic flux. ............. 112
3.4.5 CTIs inhibit cellular endocytosis and impair receptor tyrosine
kinase - Akt / Stat3 signaling. .................................................. 113
3.4.6 Cholesterol transport inhibitors trigger caspase-independent cell
death that involves mitochondrial localization of BAX. ............ 116
3.5 Discussion ...................................................................................... 122
3.6 Acknowledgements ........................................................................ 128
CHAPTER 4 Conclusions and Future Directions.....................................129
4.1 Conclusions .................................................................................... 130
4.2 Future Directions ............................................................................ 132
REFERENCES.........................................................................................139
x
LIST OF FIGURES
Figure 1.1
Schematic outline of lysosomotropism.................................……..6
Figure 1.2
Classification of lysosomotropic compounds........................……..9
Figure 1.3
Viability curves of UACC 903 cells for class-I and class-II
lysosomotropic compounds..........................................................10
Figure 1.4
Class-II lysosomotropic compounds accumulate in luminal
membranes and disrupt lysosomal homeostasis..........................11
Figure 1.5
Class-II lysosomotropic compounds inhibit lysosomal
cholesterol egress................................................................……..14
Figure 1.6
Lysosomal cholesterol accumulation triggers autophagy while
inhibiting autophagic flux......................................................……..17
Figure 1.7
Class-II lysosomotropic compounds inhibit ASM activity...............21
Figure 1.8
Class-II lysosomotropic compounds could revert multi-drug
resistance through inhibiting ABC family of proteins......................27
Figure 1.9
Cell death pathways triggered by class-II lysosomotropic
compounds.....................................................................................31
Figure 1.10 Leelamine mediated alterations in PKC singling............................42
Figure 1.11 Baicalein, GO6976 or Staurosporine protects UACC 903 cells
from leelamine mediated cell death................................................43
Figure 1.12 Cellular alterations that might be mediating sensitivity of cancer
cells to class-II lysosomotropic compounds..............................…..48
Figure 2.1
Vacuolization of melanoma cells following leelamine
treatment...............................................................................……..64
Figure 2.2
TEM analysis of leelamine treated UACC 903 cells………….……64
Figure 2.3
Western blot analyses of LC3B and P62 protein levels as a marker
of autophagic flux …………………………………………….……..65
Figure 2.4
Light microscopic images of melanoma cells following leelamine
treatment …………………………………………..……….......….…..66
Figure 2.5
Kinetics of 3H-labeled leelamine uptake …….....…………….…....67
xi
Figure 2.6
Viability of cells exposed to conditioned media that is collected
from leelamine-treated melanoma cells..………………..….……..67
Figure 2.7
Histogram showing lysosomotropic property of leelamine, assessed
by its competition with LysoTracker Red DND-99 dye..……..…....68
Figure 2.8
Viability of melanoma cells treated with leelamine in the absence
or presence of V-ATPase inhibitors ..…………………………….…68
Figure 2.9
Abietic acid a structurally similar compound to leelamine without
an amine group fails to induce vacuolization and death of
melanoma cells ..…………………………..…………………….…..69
Figure 2.10 Caspase dependence of leelamine-mediated cell death..…….…..70
Figure 2.11 DNA laddering assay following leelamine treatment...…...…...…..70
Figure 2.12 Leelamine mediated cell death does not involve de-novo protein
synthesis or leakage of proteases from lysosome...…………...….71
Figure 2.13 Histogram showing mitochondrial membrane potential following
leelamine or FCCP (positive control) treatments....………..….…..72
Figure 2.14 Viability curves of wild-type or BAX-knockout HCT116 cells
following leelamine treatment....………………………………..…...73
Figure 2.15 Viability of melanoma cells following cotreatment of leelamine
with various apoptotic signal inhibitors....……………………..…...73
Figure 2.16 Viability curves of wild-type or atg5-knockout MEF cells
following leelamine treatment....………………………………..…...74
Figure 2.17 Leelamine mediated cell death does not involve activity of the
PDK isoforms....…………………………………………………..…...75
Figure 2.18 Leelamine mediated cell death does not involve activity of the
cannabinoid receptors....…….…………………………………...…..75
Figure 2.19 Leelamine-mediated intracellular cholesterol accumulation...........76
Figure 2.20 Dependence of leelamine mediated cell death to intracellular
cholesterol accumulation....…….…………… …………..……...…..78
Figure 2.21 Effect of statins on melanoma cell death melanoma cells.......…...78
Figure 2.22 Inhibition of cellular endocytosis by leelamine ...........………..…...79
xii
Figure 2.23 Schematic summary of leelamine mediated alterations in
signaling pathways....…….…………………………………….…..…82
Figure 2.24 Analyses of the Kinexus protein array data with IPA software…...82
Figure 2.25 Western blot analysis of melanoma cells treated with increasing
concentrations of leelamine with or without BafA1..................…...83
Figure 2.26 RTK protein array analysis of various RTKs following leelamine
treatment.....………………..….…………………………………..…...83
Figure 2.27 Western blot analysis of leelamine treated cells.……………...…..84
Figure 2.28 Immunofluorescence staining of members of receptor tyrosine
kinase signaling following leelamine treatment ....…..………...…..84
Figure 2.29 Western blot analysis shows restoration of leelamine mediated
signaling alterations by cholesterol depletion…………….…..…....85
Figure 2.30 Schematic summary of cellular alterations mediated by
leelamine....…….………………………..………………………...…..88
Figure 3.1
Distribution of IC50 values of FIASMAs for various melanoma
cell lines and FF2441 fibroblasts.....…….……...……………...…..105
Figure 3.2
Histogram showing distribution of calculated pKa values of
FIASMAs.....…….……...…………….......................................…..106
Figure 3.3
Viability curves of UACC 903 melanoma and fibroblast cells
following 24 hours of treatment with various FIASMAs…...…......107
Figure 3.4
FIASMAs trigger melanoma cell vacuolization….…………....…..108
Figure 3.5
BafA1 protects cells from FIASMA-mediated cell death...............108
Figure 3.6
Subcellular cholesterol accumulation following Leelamine,
U18666A or FIASMA treatments.....…….……...……………...…..109
Figure 3.7
Viability of UACC 903 melanoma cells following FIASMA
treatment alone or in combination with -cyclodextrin.....…...…..110
Figure 3.8
Effect of FIASMAs on xenografted melanoma tumor growth.…...111
Figure 3.9
FIASMAs inhibit autophagic flux.....…….……...….…………...…..112
xiii
Figure 3.10 FIASMAs inhibit cellular endocytosis.......……...……………...…..114
Figure 3.11 Immunofluorescence staining of IGF1R-…...……...………...…..115
Figure 3.12 Western blot analysis of UACC 903 cells treated with
various FIASMA compounds..........…….……...……………...…..116
Figure 3.13 FACs analysis showing annexin V- APC/PI staining of CTI
treated UACC 903 cells......…….……...……….......................…..117
Figure 3.14 Viability of cells treated with leelamine or CTIs in the absence or
presence of necrosis inhibitors IM54 and/or Necrostatin-V..........118
Figure 3.15 Histogram showing mitochondrial membrane potential
following CTI or FCCP treatments................................................118
Figure 3.16 Viability of wild-type or BAX-knockout HCT116 cells after
treatment with increasing concentrations of CTIs........................119
Figure 3.17 Viability of cells treated with leelamine or CTIs in the absence
or presence of apoptosome inhibitor NS3694..............................120
Figure 3.18 Caspase-dependence of CTI mediated cell death.......................121
xiv
LIST OF TABLES
Table 2.1:
Compounds and sources………........……………………...………..57
Table 2.2:
Antibodies and sources...……………........…………………...……..62
Table 2.3:
siRNA sequences and sources...…………........…..………………..63
Table 2.4:
Alterations in protein expression or activity following leelamine
treatment....……………..……….........…………………….....….…..81
Table 3.1:
Compounds and sources……………………………...........………..98
Table 3.2:
Antibodies and sources...…………........…………………...……...101
Table 3.3:
Biochemical properties and IC50 values of FIASMA compounds for
fibroblasts and various melanoma cell lines.………… ………......104
xv
LIST OF ABBREVIATIONS
AA
Arachidonic acid
ABC
ATP-binding cassette
AEBSF
4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride
AKT
protein kinase B
ALLN
Calpain Inhibitor I
AO
Acridine orange
ASM
Acid Sphingomyelinase
ASMD
Acid Sphingomyelinase Deficiency
ATP
Adenosine triphosphate
BAX
Bcl-2-associated X protein
BBB
Blood-brain-barrier
BCA
Bicinchoninic acid assay
BRAF
B-Raf proto-oncogene, serine/threonine kinase
CAD
Cationic amphiphilic drugs
CERP
Cholesterol efflux regulatory protein
CNS
Central Nervous System
CTI
Cholesterol transport inhibitor
DMEM
Dulbecco's Modified Eagle Medium
ER
Endoplasmic reticulum
FACS
Fluorescence-activated cell sorting
FCCP
Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone
FDA
Food and Drug Administration
FIASMA
Functional inhibitors of acid sphingomyelinase activity
GFP
Green flourscent protein
GPRD
General Practice Research Database
HGFR
Hepatocyte growth factor receptor
IGFIR
Insulin-like growth factor type-I receptor
IPA
Ingenuity Pathway Analyses
LDL
Low-density-lipoprotein
LMP
Lysosomal membrane permeabilization
xvi
LSD
Lysosomal storage diseases
MAPK
Mitogen-activated protein kinase
MDR
Multi-drug resistant
MEF
Mouse embryonic fibroblast
MMP
Mitochondrial membrane potential
MOMP
Mitochondrial outer membrane permeabilization
MTS
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
NPC
Niemann-Pick Disease
PARP
Poly ADP ribose polymerase
PBS
Phosphate-buffered saline
PDGFR
Platelet-derived growth factor receptor
PDK
Pyruvate dehydrogenase kinases
PE
Phosphatidylethanolamine
PI
Propidium iodide
PKC
Protein Kinase C
PTEN
Phosphatase and tensin homolog
PVDF
Polyvinylidene fluoride
QSAR
Quantitative structure–activity relationship
RAW
Mouse leukaemic monocyte macrophage cell line
RFP
Red flourscent proteins
RIPA
Radioimmunoprecipitation assay buffer
ROS
Reactive oxygen species
RTK
Receptor tyrosine kinases
SREBP
Sterol regulatory element-binding protein
SSRI
Selective serotonin reuptake inhibitor
STAT
Signal Transducers and Activators of Transcription
TCA
Tricyclic antidepressants
TLC
Thin layer chromatography
TMRE
Tetramethylrhodamine, ethyl ester
UPR
Unfolded protein response
WB
Western blot
xvii
Acknowledgements
I shall be failing in my duty if I do not mention the generous help and
guidance received from following persons throughout my study. Hence, I would
like to like to offer my heartfelt thanks to each of them. But first of all, cordial
thanks to my supervisor Dr. Gavin P. Robertson for his continues support and
mentoring. He was the person who accepted me as a Ph.D student and
encouraged me to move forward in my career.
I would also like to thank previous and current members of my dissertation
committee: Dr. Jin-Ming Yang, Dr. Robert Levenson, Dr. Sinisa Dovat, Dr. Philip
Lazarus and Dr. Jiyue Zhu for their thoughtful guidance, comments and support.
I would like to extend my thanks to my lab seniors, who taught me all of
the laboratory techniques that I performed throughout this dissertation. Before
joining this lab I did not had opportunity to practice these techniques and Dr. Arati
Sharma, Dr. Raghavendra Gowda and Dr. SubbaRao Madhunapantula were
much more than kind to support and guide me during my studies. There is no
doubt that, this dissertation would not have been possible without them.
I would like to take this opportunity to thank Gregory Kardos, Ian
Huffnagle, Yu-Chi Chen and all other previous Robertson Lab members for their
help, patience and their valuable advices while I worked on this project.
Finally, I would like to thank wife, Imran Kuzu who was always there to
encourage me up and stood by me with her spiritual supports and best wishes.
xviii
This study is dedicated to my dear parents;
Fikriye and Mehmet Kuzu.
Both of them gave me unconditional love and sacrificed so much that I am the
person I am today because of them.
Their teachings to me are invaluable.
1
CHAPTER 1
Chemotherapeutic Potential of Lysosomotropic
Compounds: A Review from Mechanism of Action to
Signaling
2
1.1 Abstract
Weak bases that readily penetrate through the lipid bilayer and accumulate
inside the acidic organelles are known as lysosomotropic molecules. These
molecules are protonated in low pH environments and lose lipophilicity causing
entrapment in these environments. Many lysosomotropic compounds are
approved as drugs and have been being used as antidepressant, antipsychotic,
antihistamine, antifungal and antimalarial agents for several decades. Notably,
studies have also suggested their potential as anti-cancer agents. These agents
have been reported to inhibit viability of cancer cell lines in significantly lower
concentrations compared to normal counterparts. Several of them were able to
increase sensitivity of multidrug resistant cancer cells to certain
chemotherapeutic agents. Chemotherapeutic potential of these agents was also
supported by a number of epidemiological studies, while some of these agents
were tested in clinical trials with promising results. Studies regarding the
mechanism of these lysosomotropic compounds suggest that effects can be
distinct depending on cell line and chemical structure. Therefore, understanding
the common molecular alterations mediated by lysosomotropic compounds has
significant importance for revealing their chemotherapeutic potential.
This review introduces the concept of lysosomotropism and separates
lysosomotropic compounds into two major groups according to cytotoxicity. In
this classification, in contrast to class-I, class-II lysosomotropic compounds
display significant toxicity against certain cancer cells. Therefore, this review
mainly focuses on class-ii lysosomotropic compounds. Briefly, the mechanism of
3
inhibition of intracellular cholesterol transport by class-II lysosomotropic
compounds, its effect on intracellular cholesterol homeostasis, chemotherapeutic
potential of these agents, their mechanism of action to induce cancer cell death
and mediators of the increased sensitivity of cancer cells to these agents is
discussed.
4
1.2 Introduction
Weakly basic, lipophilic amine compounds that induce rapid vacuolization of
cells following accumulation inside the acidic cell compartments are known as
lysosomotropic molecules (1, 2). The term “lysosomotropism” was first
introduced in 1974 by de Duve et al. to define compounds that accumulate to
several hundred fold higher concentrations within the lysosomes compared to the
cytosol (1). Lysosomotropic molecules are protonated at low pH environments
(e.g. lysosomes and endosomes) and consequently lose lipophilicity leading to
entrapment inside these organelles. The degree of drug accumulation depends
on pH of the cellular compartment, and physicochemical properties of the
compound such as pKa and membrane permeability. Approximately 40% of a
model lysosomotropic amine gets trapped inside the lysosomes following its
treatment (3). Lysosomal trapping also affects distribution of compounds in body
tissues. Lysosomotropic agents preferentially tend to accumulate in the liver
and lungs ,as these organs have the highest abundance of lysosomes (4).
Lysosomes, endosomes and the golgi apparatus are the major acidic
organelles of the cells that are found virtually in all mammalian cells. Lysosomes
are the digestion and recycling centers, containing over 50 hydrolytic proteases
(such as glycosidases, sulfatases, nucleases and lipases) that have optimal
activity in acidic environments (5). On the other hand, endosomes are
compartments of the endocytic transport system that is primarily involved in
internalization of material from the plasma membrane(6). They function as a
sorting compartment of the cell where ingested material is sorted before it
5
reaches the lysosomes for degradation. During this process early endosomes
bud from the plasma membrane and then mature into late endosomes before
fusing with lysosomes. Both lysosomes and late endosomes are formed from a
number of intraluminal membranes and a layer of external limiting membrane.
The acidic lumen of both organelles are established by the activity of the
vacuolar H+ ATPase (V-ATPase) proteins that are located at the external
membrane (5). These proteins hydrolyze ATP to transport protons (hydrogen
ions) across the external limiting membrane.
Lysosomotropic compounds are ubiquitously found between approved
therapeutic drug molecules (7). Currently, several of them are being used as
antimalarial (e.g. Chloroquine, Pyrimethamine); antipsychotic (e.g.
Trifluoperazine, Fluphenazine) antidepressant (e.g. amitriptyline, Maprotiline);
antihistamine (e.g. Mebhydrolin, Terfenadine); antibiotic (e.g.) or antifungal
compounds. Lysosomotropic properties of these drugs contribute to therapeutic
activities (8). For instance, chloroquine, the most frequently used antimalarial
drug, shows its therapeutic activity partially due to its lysosomotropic property (9).
It accumulates inside the acidic food vacuoles of the malaria parasite and
interferes with essential processes that are required for the parasite’s life-cycle.
Additionally, preclinical studies have suggested potential anti-cancer
properties of lysosomotropic compounds. Especially tricyclic antidepressants
and antipsychotic compounds exhibited anti-proliferative, anti-metastatic and proapoptotic effects as well as restored sensitivity of multidrug resistant cancer cells
to certain chemotherapeutic agents (10-13). In this review, the concept of
6
lysosomotropism will be briefly introduced, but the primary focus will be on the
molecular alterations mediated by lysosomotropic compounds and
chemotherapeutic potential as anti-cancer agents.
1.3 Lysosomotropism
1.3.1 Mechanism of lysosomotropism: Cation trapping.
Compounds with basic moieties
Figure 1.1
tend to accumulate inside the acidic
environments (7). Although they have
diverse structures, many
lysosomotropic compounds harbor a
nitrogen atom that is responsible for
weakly basic properties. With a low
pH lumen, acidic organelles attract
these basic compounds and trigger
accumulation inside the lumen.
Briefly, as described in Figure 1.1,
Figure 1.1 Protonation of weakly basic
amines triggers their accumulation in acidic
organelles. Lipophilic, weak bases can
readily diffuse through membranes in neutral
form. However, upon protonation in acidic
environments, these compounds lose
membrane permeability becoming trapped in
these organelles.
weakly basic compounds can readily
diffuse through the limiting membrane of the lysosomes in unionized form (B),
however in acidic lumen they become protonated (HB+) and lose their membrane
permeability. Due to their decreased membrane permeability, these molecules
cannot cross-back to the cytosol hence become trapped in the acidic lumen.
Thus, this phenomenon has also been called as “ion trapping” (14).
7
1.3.2 Factors that influence lysosomotropism.
There are many factors that influence the degree of lysosomotropism.
Among these are: pH of the environment, dissociation constant (pKa) and
lipophilicity of the compound. The increase in difference between pH of the
lumen and cytosol positively correlates with accumulation of protonated amine in
the acidic lumen. pKa is a quantitative measure of the strength of an acid (or
base) in a solution. As they are weak bases, lysosomotropic compounds tend to
have a basic pKa value between 6.5 and 11 (15). Lipophilicity of a compound is
an important factor that determines its passive diffusion through the lipid bilayer.
Partition-coefficient (logP) is the measure of the solubility of a compound in
hydrophobic and hydrophilic environments. Hence, it is a useful quantity in
estimating the distribution of drugs between hydrophobic compartments (such as
lipid membranes) and hydrophilic compartments (such as cytosol).
1.3.3 The effects of lysosomotropism on cells and drug distribution
Lysosomotropic compounds trigger cellular vacuolization following treatment.
Although the details of the vacuolar response were not well understood, it has
been shown that both late endosomal and lysosomal proteins co-localize with
amine induced vacuoles. Based on this observation, it is hypothesized that these
vacuoles could be greatly expanded into hybrid organelles that were formed by
fusion of lysosomes with late endosomes through trafficking in a retro-grade
manner (7).
Lysosomotropism also affects drug distribution in the body. Lysosomotropic
drugs can accumulate in various tissues due to uptake by acidic organelles and
8
the lipophilic character of the compound (16). Competition for acidic organelles
affects their distribution thus lysosomotropic drugs such as tricyclic
antidepressants, phenothiazine neuroleptics and selective serotonin reuptake
inhibitors mutually decrease tissue uptake of each other when they are taken
together (17, 18).
1.4 Classification of lysosomotropic compounds
Lysosomotropic compounds can be classified into two major groups based on
cytotoxic activities. Hydrophilic lysosomotropic molecules such as ammonium
(NH3), methylamine (CH3NH2), ethylamine (CH3CH2NH2), propylamine
(C2H5CH2NH2) can be classified as class-I compounds while lysosomotropic
molecules with at least one or more hydrophobic rings and a hydrophilic tail that
generally harbors polarizable amine group can be classified as class-II
compounds (Fig. 1.2). Tricyclic antidepressants (Imipramine, Nortriptyline,
Amitriptyline, Trimipramine), phenothiazine antipsychotics (e.g., Promazine,
Fluphenazine, Perphenazine, Thioridazine), antihistamines (e.g., Desloratadine,
Promethazine), SSRIs,(e.g., Sertraline, Fluvoxamine, Fluoxetine) U18666A,
leelamine, monodansylcadaverine (MDC), acridine orange (AO) and chloroquine
are examples of class-II lysosomotropic compounds.
1.4.1 Class-I lysosomotropic compounds
The members of the class-I lysosomotropic compounds are generally well
tolerated by cells. Although they induce vacuolization, they do not trigger cell
death up to millimolar concentrations. For instance, the viability curves for UACC
903 melanoma cells for various class-I lysosomotropic molecules are shown in
9
Figure 1.2
Figure 1.2 Classification of lysosomotropic compounds. Lysosomotropic compounds
can be classified into two groups according to their cytotoxicity. Class-I lysosomotropic
compounds do not induce cell death up to mililmolar concentrations. Class-II
lysosomotropic compounds are more lipophilic molecules and tend to accumulate in
luminal membranes of the acidic organelles.
Figure 1.3. The IC50 values for these compounds were in millimolar range.
These hydrophilic lysosomotropic compounds accumulate inside the lumen of
acidic organelles in which they raise the pH and disrupt organelles homeostatic
balance only at very high concentrations (19). In fact, at millimolar
concentrations they block the lysosomal pathway of protein degradation and
suppress new protein synthesis (20, 21).
10
Figure 1.3
Figure 1.3 Viability curves UACC 903 melanoma cells
following 24 hour treatment with increasing concentrations of
various lysosomotropic agents.
1.4.2 Class-II lysosomotropic compounds
On the other hand, class-II lysosomotropic compounds are significantly more
toxic to the cells and they are able to induce cancer cell death in micromolar
concentrations. The major difference between this group and the
aforementioned one is hypothesized to be the localization of these compounds to
the intralysosomal membranes. Most of these class-II agents exhibit an
amphiphilic character. These agents harbor hydrophobic rings that give lipophilic
character and a hydrophilic domain with an ionizable amine group that gives
lysosomotropic character. Hydrophobic portion of these compounds allows their
accumulation in the internal membranes of the lysosome, that perturbs activity of
lysosomal membrane proteins such as acid sphingomyelinase, NPC2 (Niemann-
11
Pick disease, type C2) and phospholipases (22, 23) (Fig. 1.4). As a
consequence, lysosomal lipid homeostasis becomes disrupted and lipids such as
cholesterol, sphingomyelin and
other phospholipids accumulate
inside the lysosomal cell
compartments, eventually leading
to cell death (23).
Figure 1.4
Figure 1.4 Class-II
lysosomotropic
compounds
accumulate in luminal
membranes and
disrupt lysosomal
homeostasis. Due to
their hydrophobic
structures, class-II
lysosomotropic
compounds tend to
accumulate in luminal
membranes where they
disrupt the function of
lysosomal proteins
leading to lysosomal
lipid accumulation.
1.5 Class-II lysosomotropic compounds inhibit lysosomal
cholesterol transport
1.5.1 Lysosomal cholesterol homeostasis and NPC disease
Lysosomes play crucial role in intracellular cholesterol homeostasis.
Mammalian cells acquire cholesterol as low-density-lipoprotein (LDL) bound
cholesteryl esters through receptor-mediated endocytosis (24). Following
uptake, LDLs are transported to the lysosomes through endosomes. In
lysosomes, lysosomal acid cholesterol esterase (Lipase A, LIPA) hydrolyses
cholesteryl esters to unesterified free cholesterol molecules which get rapidly
distributed to endoplasmic reticulum (ER) and plasma membrane. Two
lysosomal proteins, NPC1 and NPC2 play crucial roles in lysosomal cholesterol
homeostasis. NPC2 is a soluble protein that is localized in the lumen of
12
lysosomes and late endosomes. It extracts and transports cholesterol from
internal membranes to NPC1 protein, which is localized at the limiting membrane
of the organelles. Therefore, NPC1 and NPC2 proteins cooperate to transport
free cholesterol molecules to out of lysosomes.
Loss of function mutations in NPC1 (95 % of the cases) and NPC2 (5% of the
cases) proteins leads to a fatal, neurodegenerative disorder called Niemann-Pick
Type C disease(25). In consistent with the function of these two proteins, the
hallmark of NPC disease is elevated levels of free cholesterol in lysosomes and
late endosomes. Under steady-state conditions, lysosomes of cultured human
fibroblasts constitute 6% of the total cellular cholesterol. However, this pool of
lysosomal cholesterol was increased up to 10-fold in NPC fibroblasts (26, 27).
1.5.2 Class-II lysosomotropic compounds inhibit lysosomal
cholesterol egress
A variety of class-II lysosomotropic compounds such as imipramine,
stearylamine and U18666A have been reported to induce a NPC-like cellular
phenotype. In fact, U18666A is a widely used agent to study NPC disease.
U18666A causes several fold increase in cholesterol levels of late endosomes
and lysosomes without affecting the pH of these organelles (26, 27). LloydEvans and colleagues have published an elegant study that reveals the
molecular basis of NPC1 disease (27). They identified that dysfunctional NPC1
protein initially causes a 2-fold increase in sphingosine levels in lysosomal/late
endosomal cell compartments leading to calcium depletion in these organelles,
followed by cholesterol and sphingomyelin accumulations. Treatment of RAW
13
macrophages with U18666A elevated the sphingosine levels within 10 minutes,
which remained high for 24 hours. 30 minutes after treatment calcium levels in
the acidic compartments was reduced 50% and continued to decrease up to 20%
of the control within the first two hours. 2 and 8 hours after treatment,
sphingolipid and cholesterol levels were elevated, respectively. Furthermore
they also discovered that sphingosine was the only lipid that was capable of
inducing these cellular abnormalities. Treatment of RAW macrophages with
sphingosine dose-dependently decreased the lysosomal calcium levels and
triggered lysosomal cholesterol accumulation. Inhibition of sphingosine synthesis
through myriocin (an inhibitor of serine palmitoyl transferase 1) treatment was
able to overcome all of the abnormalities that were observed in NPC1-mutant
cells. The significance of sphingosine accumulation was consistent with the
findings that, lysosomal sphingosine levels were increased up to 24-fold in the
liver and spleen of NPC patients (28). Lloyd-Evans et al. suggested that
sphingosine was an initiating factor in NPC disease; however, the link between
NPC1 protein and sphingosine has not yet been elucidated.
In lysosomes, sphingosine is a product of sphingolipid degradation by
ceramidase (aCERase) enzyme. The primary amino group of the sphingosine is
protonated at the acidic pH of lysosomes, hence has low permeability through
the lysosomal membrane (29). Thus, sphingosine requires a transporter to aid
its exit from lysosomes and NPC1 was suggested to be the key protein regulating
this process. However, studies by Tomas and colleagues eliminated this
possibility by showing evidence against possible involvement of NPC1 in
14
sphingosine export (30, 31). Therefore, further studies are required to clarify the
significance of sphingosine accumulation, and to elucidate the link between
NPC1 protein and sphingosine in NPC disease.
1.6 Effects of inhibition of lysosomal cholesterol transport on
cellular cholesterol homeostasis
1.6.1 Intracellular cholesterol homeostasis
The disruption of lysosomal cholesterol transport not only alters lysosomal
cholesterol levels but also disrupts cholesterol homeostasis in whole cell. In
steady-state conditions, free cholesterol is transported from lysosomes to plasma
membrane and then from plasma
Figure 1.5
membrane to endoplasmic reticulum
(Fig. 1.5). An increase in ER
cholesterol triggers a signaling
cascade that induces acyl-CoA
cholesterol acyltransferase (ACAT)
enzyme for esterification of free
cholesterol molecules to cholesterol
esters. Free cholesterol molecules
in ER also inhibit sterol regulatory
element-binding protein (SREBP)
cleavage. When it is cleaved,
SREBP translocates to nucleus and
Figure 1.5 Class-II lysosomotropic
compounds inhibit lysosomal cholesterol
egress. This causes a decrease in ER
cholesterol levels. Cells respond by
decreasing cholesterol esterification and
inducing cholesterol synthesis and import..
triggers transcription of genes involved in cholesterol synthesis and import, such
15
as HMG-CoA reductase, and LDL receptors, respectively. Therefore, excess
cholesterol not only triggers its own esterification but also inhibits new cholesterol
synthesis and import. Inhibition of lysosomal cholesterol rapidly reduces ER
cholesterol which in turn inhibits ACAT activity and triggers cholesterol synthesis
through HMG-CoA reductase activation. In fact, 5 uM U18666A has been shown
to inhibit ACAT activity by ~65% in fibroblast cells (32).
It is important to note that, exogenous LDL-cholesterol is not the only source
for lysosomal cholesterol. In fact, U18666A was able to trigger lysosomal
cholesterol accumulation in the absence of exogenous LDL-cholesterol (26).
There is significant evidence suggesting that cholesterol flows between different
compartments (e.g. plasma membrane, lysosome, ER, Golgi, mitochondria) of
the cell. It is reported that, 65 to 80% of the cellular cholesterol is located in the
plasma membrane and this pool constantly moves between cell interior and
surface (33). For instance, lipid rafts are important signaling domains located in
plasma membrane and enriched in cholesterol levels. Inductions of the many
receptors trigger their internalization to lysosomes through the endocytic
pathway. Hence, during the lipid-raft-involved endocytosis significant amount of
cholesterol is transported to the lysosomes.
1.6.2 Autophagy as a source of lysosomal cholesterol
Autophagy is a self-digestion process that involves recycling of cellular
compartments through their degradation in lysosomes and strictly regulated by
multiple signaling cascades (34, 35). Autophagy has been classified in to three
major groups based on the autophagic process and mechanism of delivery of
16
targeted substrates to lysosomes (36, 37). In this classification, microautophagy
involves the direct uptake of cytoplasmic substrates into the lysosome through
invagination of the lysosomal membrane (38, 39). Chaperone mediated
autophagy involves autophagy of extremely selective protein material through
recognition of hsc70 containing protein complex by lysosomal membrane
proteins which is followed by unfolding and translocation of the targeted protein
across the lysosomal membrane (40). On the other hand, macroautophagy is
the main pathway of autophagy that is characterized by formation of double
membrane structures around the targeted cytoplasmic substrates (41). The
formed structure is known as an autophagosome and fuses with lysosomes for
the degradation of encapsulated material. This allows recycling of unnecessary
or dysfunctional cellular components that promotes cellular survival during
nutrient starvation. Macroautophagy is further classified into two types as
selective and nonselective autophagy. In contrast to the nonselective, selective
autophagy mediates the elimination of particular damaged or excessive
organelles. Therefore, these autophagic processes are also called with particular
names such as ribophagy (autophagy of ribosomes), pexophagy (autophagy of
peroxisomes), mitophagy (autophagy of mitochondria), reticulophagy or ERphagy (autophagy of parts of the ER), micronucleophagy (autophagy of
segments of the nucleus), lipophagy (autophagy of lipid droplets) and
aggrephagy (autophagy of protein aggregates) (36).
Autophagy has been reported to be another important source for lysosomal
cholesterol. Ouimet and colleagues discovered that autophagy plays essential
17
roles in delivering cholesteryl esters to lysosomes for hydrolyzation into free
cholesterol molecules for their efflux (42). Cholesterol efflux from ATG5-null
autophagy-deficient macrophages was significantly diminished in contrast to wildtype counterparts. These findings were consistent with previous reports that
shows, ATG5-null-MEF cells accumulate less cholesterol levels following
U18666A treatment in contrast to wild-type counterparts (43). Furthermore, we
have observed that ATG5-null-MEF cells were also more resistant to cell death
mediated by inhibition of lysosomal cholesterol transport (44).
1.6.3 Inhibition of
Figure 1.6
intracellular cholesterol
transport induces autophagy
While autophagy is an
important source for lysosomal
cholesterol, it has also been
shown that lysosomal cholesterol
accumulation; itself triggers
autophagy (Fig. 1.6). It is
suggested that the decreased
levels of cholesterol in cellular
organelles, such as ER, could
trigger autophagy as a nutritional
deficiency response (45, 46). In
fact, activation of Sterol
Figure 1.6 Lysosomal cholesterol
accumulation triggers autophagy while inhibiting
autophagic flux. Decrease in ER cholesterol
induces autophagic pathways through Beclin-1.
Induction of autophagy could enhance lysosomal
cholesterol accumulation creating a viscous
cycle. Disruption of lysosomal homeostasis
inhibits autophagic flux. Inhibition of autophagy
through knockdown of BECN1 or ATG5 protects
cells from cell death.
18
Regulatory Element-Binding Proteins (SREBP) in NPC1-deficient cells indicates
that accumulated cholesterol is invisible to the cells regulatory circuits and could
trigger autophagic pathways (47). In wild-type fibroblasts, U18666A treatment
induces Beclin-1 (BECN1) levels which is required for the initiation and
maturation of autophagosomes (48). This induction has been reported to cause
a modest increase in autophagic flux as observed through the degradation of
endogenous long-lived proteins(48). It is noteworthy that, while imipramine,
another class-II lysosomotropic compound, has been shown to stimulate
autophagosome formation, siRNA mediated knockdown of BECN1 was able to
suppress imipramine mediated cell death (49). Furthermore, autophagy in NPC
disease depends on BECN1 expression and accumulation of autophagosomes
was observed in the brains of NPC mice as well as in the fibroblasts of NPC
patients (48). Since lysosomal cholesterol accumulation triggers autophagy and
autophagy carries cholesteryl esters to the lysosomes, autophagic process
creates a positive feedback loop where induction exacerbates the NPC disease
via increased lipid storage (43). In fact, inhibition of autophagy decreases
cholesterol in NPC1-deficient cells and restores lysosomal processes (43).
19
1.6.4 Inhibition of intracellular cholesterol transport blocks
autophagic flux
Lysosomal cholesterol accumulation not only induces autophagy but also
blocks autophagic flux due to the inhibition of lysosomal protease activity by
stored lipids (Fig. 1.6) (43). Accumulation of LC3B labeled autophagosomes
following treatment with various lysosomotropic agents including U18666A has
been reported (14). In our studies, we have also observed the accumulation of
LC3B following treatment of melanoma cells with lysosomal cholesterol transport
inhibitors such as leelamine and Perphenazine (44, 50). Accumulation occurred
as a result of failed fusion of autophagosomes with lysosomes. Therefore, the
accumulation of LC3B is likely due to inhibition of autophagic flux, rather than
induction of autophagy. Impairment of autophagic flux is potentially detrimental
to the cells due to the loss of intracellular homeostasis related to accumulation of
damaged intracellular components. Thus, inhibition of lysosomal cholesterol
transport leads to both induction of autophagy and disruption of autophagic flux,
which can induce cell death.
1.7
The effects of class-II lysosomotropic compounds on
sphingolipid metabolism
1.7.1 Acid Sphingomyelinase Deficiency and NPC disease
Late endosomes and lysosomes are important organelles for sphingolipid
metabolism. Sphingolipids are essential components of plasma membrane and
involved in various membrane functions, such as cell recognition and signaling.
Consistent with these functions, sphingomyelins (a type of sphingolipid that
20
contains phosphocholine or phosphoethanolamine polar head groups) are
enriched to 50 % in lipid rafts compared to the surrounding plasma membrane
(51). Following internalization, their degradation takes place on the surface of
luminal membranes of the late endosomes and lysosomes (52). Altered
sphingolipid metabolism and lysosomal/late endosomal cholesterol accumulation
are tightly linked to each other. In fact, types A and B form of Niemann-Pick
disease are caused by deficiency of acid sphingomyelinase enzyme (ASM) and
is therefore also known as Acid Sphingomyelinase Deficiency (ASMD) disorder.
Under steady-state conditions, ASM is localized to the inner membranes of late
endosomes/lysosomes and hydrolyses sphingomyelin to generate
phosphocholine and ceramide (5). It is a water-soluble glycoprotein and contains
positively charged regions promoting its attachment to the intraluminal
membranes enriched in negatively charged lipids such as BMP (bismonoacylglycero phosphate). This attachment not only brings the enzyme to the
close proximity to its substrate but also protects the enzyme from the degradation
by cathepsins (53, 54).
Deficiency of ASM causes accumulation of sphingomyelin in lysosomal/late
endosomal cell compartments. As discussed earlier, NPC2 protein transfers
cholesterol from intraluminal membranes to NPC1 to export the cholesterol out of
late endosomes. Abdul-Hammed and colleagues studied the effects of various
lipid-binding proteins and late endosomal lipids on the transfer of cholesterol
between liposomes (55). In this study, they discovered that, NPC2 was the only
lipid-binding protein capable of transferring cholesterol between liposomes that
21
was greatly inhibited by addition of sphingomyelin. Moreover, ASM-mediated
degradation of liposomal sphingomyelin was able to reverse the inhibition of
cholesterol transport (56). These
Figure 1.7
observations might explain the
accumulation of cholesterol in type A
and B forms of the NPC disease.
Cholesterol accumulation creates a
vicious cycle by suppressing
saposins (sphingolipid activator
proteins) that are essential proteins
for sphingolipid degrading enzymes
(Fig. 1.7) (57). In fact, in cultured
cells cholesterol accumulation was
reported to hinder lysosomal acid
sphingomyelinase activity without
affecting total ASM protein levels
Figure 1.7 Class-II lysosomotropic
compounds and type A & B form of NPC
disease inhibits ASM activity. Inhibition of
ASM activity causes lysosomal sphingomyelin
accumulation. This accumulation inhibits
lysosomal cholesterol egress. As a
consequence, lysosomal cholesterol inhibit
sphingolipids activator proteins leading to
further accumulation of sphingolipids.
(58).
1.7.2 Class-II lysosomotropic compounds inhibit ASM activity:
FIASMAs
Recently, Kornhuber et al. coined the term “FIASMA” (Functional Inhibitors of
Acid Sphingomyelinase), to characterize a large group of pharmacological
agents that are able to inhibit lysosomal acid sphingomyelinase activity without
altering ASM protein itself (59). In the literature these compounds are also
22
referred as cationic amphiphilic drugs (CADs) (60). Since they are weakly basic
lysosomotropic compounds with hydrophobic rings, they fall into class-II
lysosomotropic compounds. These compounds get protonated in acidic
environment decreasing membrane permeability. However, protonation of these
compounds have also been suggested to trigger their interaction with negatively
charged intraluminal membranes. This interaction displaces ASM by disrupting
electrostatic attraction between ASM and membrane leading to its inactivity as
well as degradation by cathepsins (61). As expected, the disruption of ASM
activity was only observed with CAD’s and not with neutral or anionic
lysosomotropic (class-I) compounds (62). As a note, class-II lysosomotropic
compounds were shown to interfere not only with ASM activity but also with
several other lysosomal enzymes, such as lysosomal acid ceramidase and
lysosomal phospholipases (63).
1.8
Chemotherapeutic potential of class-II lysosomotropic
compounds
Recently, we identified leelamine, a small lysosomotropic compound that can
effectively kill melanoma cells. Leelamine was able to kill melanoma cell lines at
3 to 4 fold lower concentrations compared to normal cells. More importantly, it
caused a 50 to 60 % reduction in the xenografted melanoma tumor growth
without any obvious systemic toxicity. We have shown that, leelamine
accumulates in lysosomal/late endosomal cell compartments and induced
cholesterol accumulation in these organelles. Based on its chemical and
biological properties, leelamine is a class-II lysosomotropic compound. We have
23
also investigated further investigated the chemotherapeutic potential of FIASMA
compounds, which are also class-II lysosomotropic compounds. We have shown
that, FIASMA compounds display lysosomotropic property and inhibit lysosomal
cholesterol transport. Leelamine and certain FIASMA compounds induce
melanoma cell death at several fold lower concentrations compared to normal
fibroblasts. Additionally, chemotherapeutic potential of the some of the FIASMA
compounds were investigated in vivo. 50 to 60 % reduction in xenografted
melanoma tumor development was observed following Perphenazine (50 mg/kg,
every 4 day) or Fluphenazine (25 mg/kg, every 4 day) treatments. Studies
related to the mechanism of action of leelamine, and screening of FIASMA
compounds are presented in the second and third chapters of this dissertation,
respectively.
Studies with leelamine and FIASMA compounds have indicated
chemotherapeutic potential of class-II lysosomotropic compounds. Including
Perphenazine and Fluphenazine, most of the FIASMA compounds are CNS
(central nervous system) active drugs such as tricyclic antidepressants and
antipsychotics. Although these drugs are prescribed to control depression or to
manage psychosis, their anti-cancer potential has also been investigated in invitro, in-vivo and epidemiological studies. These drugs were reported to induce
cancer cell death with various mechanisms in different cancer types.
Amitriptyline, a generic antidepressant that has been suggested to be used as a
supportive care to decrease cancer-associated pain and has been shown to
display cytotoxicity against several cancer cell lines including glioma, hepatoma,
24
multiple myeloma, lung cancer, cervical cancer, osteosarcoma and melanoma
(64, 65). In multiple myeloma tumors, amitriptyline was shown to induce p53 and
activate Caspase 3 levels while decreasing Bcl-2 and Mcl-1 (two anti-apoptotic
proteins) levels. Furthermore, it extended the survival of mice bearing multiple
myeloma (65).
Wiklund and colleagues investigated the effect of antipsychotic agents
(reserpine, chlorpromazine, haloperidol, pimozide, risperidone and olanzapine)
on the viability of lymphoblastoma, neuroblastoma, non-small cell lung cancer,
breast adenocarcinoma cell lines and their normal counterpart cell lines (66).
Other than risperidone, all five antipsychotic agents selectively decreased
viability of cancer cell lines in contrast to normal counterparts. Moreover,
microarray and quantitative real-time polymerase chain reaction (QRT-PCR)
based gene expression analysis showed upregulation of several genes that are
involved in cholesterol synthesis, indicating the response of cell to inhibition of
intracellular cholesterol transport. Interestingly they also demonstrated that
combining these drugs with mevastatin (a cholesterol synthesis inhibitor) was
able to increase general cytotoxicity.
In another study, Levkovitz et al. reported the activity of paroxetine and
fluoxetine, two selective serotonin reuptake inhibitors, clomipramine, a TCA,
against rat glioma and human neuroblastoma cell lines (67). A rapid increase in
phosphorylated c-Jun levels and subsequent release of cytochrome C from
mitochondria was observed. In contrast to primary brain tissue and neuronal
cultures, cancer cells displayed increased sensitivity. These findings were later
25
confirmed by Daley and colleagues, who demonstrated that clomipramine
triggers death of human glioma cells by increasing activated caspase 3 levels
and inhibiting oxygen consumption (68).
Desipramine, another class-II lysosomotropic antidepressant has been
reported to be effective at killing human HT29 colon carcinoma cells (69). In
these cells, it disrupted mitochondrial membrane potential, triggered cytochrome
C release and induced cell cycle arrest either at G0/G1-phase or G2/M-phase in
a dose-dependent manner. Nortriptyline, a second generation tricyclic
antidepressant and class-II lysosomotropic agent, has been reported to kill
human osteosarcoma cells by stimulating both extracellular Ca2+ influx and
intracellular Ca2+ release (70).
1.9
Class-II lysosomotropic compounds increase sensitivity of
multidrug resistant cell lines to chemotherapeutic agents
Multidrug resistance (MDR) of cancer is an important reason for the failure of
cancer chemotherapeutics. It involves development of resistance to multiple
chemotherapeutic agents, even to the ones to which the cells have not been
exposed to previously (71). Many class-II lysosomotropic compounds increase
sensitivity of MDR cancer cell lines to chemotherapeutic agents such as
doxorubicin (5, 11, 72). Thioridazine, a typical antipsychotic drug, has been
reported to reverse the resistance of KB-ChR-24 (a multidrug resistant oral
carcinoma cell line) cells to doxorubicin, vinblastine, dactinomycin, and
daunorubicin. Trifluoperazine and chlorpromazine showed similar but somewhat
weaker activity against drug resistance (11). The effect of chlorpromazine on
26
MDR cell lines was also observed in in-vivo studies, where it reversed
doxorubicin-resistance in xenografted solid tumors (73).
ATP-binding cassette transporter (ABC) family of genes are known to be
associated with multidrug resistance (74). Many of the proteins synthesized from
these genes are called as multidrug resistance proteins (for instance ABCB1
gene encodes MDR1 protein etc.). Interestingly, some members of this gene
family are also involved in intracellular cholesterol homeostasis. For instance,
ABCA1 protein is known as the cholesterol efflux regulatory protein (CERP) and
functions as a cholesterol efflux pump. This relation could explain the efficacy of
class-II lysosomotropic compounds on the reversal of multidrug resistance
phenotype of cancer cell lines. For instance, amitriptyline was reported to
reverse the multidrug resistance of MDR mouse lymphoma cells by decreasing
rhodamine-123 efflux (75). The efflux of rhodamine-123 was suggested to be
regulated by two members of the ABC family of proteins, ABCB1 and ABCB4
(76). Both of these proteins were associated with cholesterol homeostasis (7780). ABCB1 encodes for MDR1 protein and its activity was reported to be
reduced by the depletion of cellular cholesterol (81). ABCB4 encodes MDR2/3
protein and mice deficient with MDR2 expression (MDR2-/-) showed a defect in
biliary phospholipid and cholesterol secretion (80). In addition, in humans,
mutation of this gene was associated with cholestasis, which is also transiently
observed in NPC1 disease (82, 83). It was suggested that in NPC1 disease, as
a response to depletion of ER cholesterol, activity and expression of cholesterol
efflux proteins (ABC family of transporters) are decreased (84). Thus class-II
27
lysosomotropic compounds seem to be able to revert multidrug resistance by
decreasing expression and activity of the ABC family of drug efflux proteins (Fig.
1.8).
1.10 Epidemiological studies
The chemotherapeutic potential of class-II lysosomotropic compounds, such
as tricyclic antidepressants, SSRIs and antihistamines have been studied in
epidemiological settings. In a recent study, Walker et al. used the General
Practice Research Database (GPRD) to conduct a correlative case-control study
to examine whether previous tricyclic usage was associated with reduced
incidence of breast, colorectal, glioma, lung and prostate cancers (85). In this
Figure 1.8
Figure 1.8 Class-II lysosomotropic compounds could revert multi drug resistance
through inhibiting ABC family of proteins.
28
study, a significant reverse association between TCA usage and glioma (odds
ratio (OR) = 0.59, 95% confidence interval (95%CI) = 0.42–0.81) and colorectal
cancer (OR= 0.84, 95%CI= 0.75-0.94) was observed. Importantly, these effects
were reported to be dose and time dependent. However, no association was
detected for lung, breast or prostate cancers.
In another case-control study, Xu and colleagues investigated whether any
association existed between SSRI or TCA usage and risk of colorectal cancer
(86). Although they were unable to detect any association between TCA usage
and colorectal cancer risk (OR= 0.96, 95%CI= 0.84-1.10), they detected a
significant association between decreased risk of colorectal cancer and high daily
SSRI usage (OR= 0.70, 95%CI= 0.50-0.96). This data was confirmed by
Coogan et al. who reported odds ratios of 0.47 (95%CI= 0.26-0.85) and 0.77
(95%CI= 0.52-1.16) for SSRI and TCA usage, and colorectal cancer, respectively
(87). Another group reported decreased risk of colorectal cancer for persons
who used antidepressants (either SSRI or TCA) (OR= 0.7, 95%CI= 0.5-0.9) (88).
However, these studies were contradicted by another study which was
conducted on a larger dataset that found no association between colorectal
cancer and TCA (OR= 0.94, CI= 0.84-1.05) or SSRI (OR= 0.97, CI= 0.90-1.05)
usage (89).
Antidepressant treatment might promote mammary tumor growth in-vivo (90).
Therefore many case-control studies have been conducted to assess whether
antidepressant or antipsychotic medication increases breast cancer risk (91-94).
Although some of these studies showed a significant association between breast
29
cancer and antidepressants, most of them contradicted these results (95-107).
Indeed, an inverse relation between Paroxetine (an SSRI type antidepressant)
use and breast cancer risk (OR= 0.64, 95%CI= 0.45-0.92) was reported (91).
Linos and colleagues reported an interesting association between decreased
risk of glioma and allergies (OR= 0.61, 95%CI= 0.55-0.67), asthma (OR= 0.68,
95%CI= 0.58-0.80) or eczema (OR= 0.69, 95%CI= 0.58-0.82) (108). Based on
this report a potential association between glioma risk and antihistamine usage
has been investigated in several studies. McCarthy et al. found an inverse
association between glioma risk and antihistamine use (109). Their study was
conducted on 419 glioma patients and 612 matching controls in which high (OR=
0.66, 95%CI= 0.49-0.87) and low (OR= 0.44, 95%CI= 0.25-0.76) grade glioma
patients were found less likely to report any allergy in contrast to controls.
However, contradictory findings have also been reported. In one study, long
term antihistamine use was associated with 3.5-fold increase in glioma risk while
in another one this ratio was 2.94 fold (110, 111).
Association between prostate cancer and antidepressant or antipsychotic
usage has also been investigated through several case-control studies (112,
113). Mortensen reported a decrease in prostate cancer incidence in
schizophrenic patients and attributed this observation to high-dose phenothiazine
(primarily chlorpromazine) use (112, 114). However, a controversy finding was
reported by Tamim and colleagues whose study suggested a positive and dosedependent association between prostate cancer and tricyclic antidepressant use
when exposure took place 2-5 years prior to cancer diagnosis (113). The odd
30
ratios were 1.31 (95%CI= 1.14- 1.51), 1.58 (95%CI= 1.29–1.93), 2.42 (95%CI=
1.87–3.12) for low, medium and high average daily dose levels, respectively.
As phenothiazine antidepressants are class-II lysosomotropic compounds,
association between schizophrenia and cancer risk might indicate the
chemotherapeutic potential of these agents. Mortensen investigated the
incidence of cancer in 6168 schizophrenic patients and reported decreased
cancer risk for respiratory system, prostate and bladder cancers (112). In female
patients, uterine cervix cancer was also reduced. On the other hand, an
increased risk of breast and pancreatic cancer was observed, which could be
attributed to reduced exposure to common carcinogens such as cigarette smoke.
In a more recent study, this association was investigated using a nested casecontrol study, in more than 40.000 schizophrenia patients (115). 1.9 fold
increase of colon cancer risk (OR= 2.90, 95%CI= 1.85-4.57), a slight increase in
breast cancer risk (OR= 1.52, 95%CI= 1.10-2.11) and a significant decrease in
respiratory cancer risk (OR= 0.53, 95%CI= 0.34-0.85) was observed. However,
the claim that patients receiving antipsychotics have a higher risk of colon cancer
was criticized and suggested to be related to common lifestyle risk factors
observed among schizophrenia patients (116).
In conclusion, class-II lysosomotropic compounds might prevent some
cancers while promoting others. Further studies are required to determine in
which cancers, even in which subtypes of cancers these compounds might be
helpful. Controversies in many case-control studies suggests that, more studies
should be conducted on carefully curated larger datasets to identify the
31
associations between drug prescriptions and disease risks. Establishment of
human curated databases might be helpful to solve these controversies in close
future.
1.11 Cell death mediated by Class-II lysosomotropic
compounds: mechanisms of action
In the literature, many studies have investigated the mechanisms of cancer
cell death mediated by various class-II lysosomotropic compounds. Although
many of these studies were not conclusive, some suggested that the link
between these compounds and
cell death might involve multiple
Figure 1.9
pathways (45). According to our
studies, cell death mediated by
class-II lysosomotropic
compounds depends on both the
lysosomotropic property of
agents and inhibition of
intracellular cholesterol transport
(see Chapter 3). In fact,
Bafilomycin A1 mediated
inhibition of lysosomotropism or
β-cyclodextrin mediated
Figure 1.9 Cell death pathways triggered by
class-II lysosomotropic compounds.
depletion of cholesterol protected cells from death mediated by class-II
compounds.
32
As discussed earlier, the lysosomotropic property of class-II compounds
enable their accumulation in late endosomal/lysosomal cell compartments where
they disturb intrinsic homeostasis of these organelles leading to accumulation of
many lipids, but most notably cholesterol. Loss of subcellular cholesterol
balance harms proper functioning of many organelles such as Golgi, ER and
mitochondria (117, 118). Moreover, oxidized derivatives of cholesterol
(oxysterols) could increase lysosomal membrane permeability causing cell death
through cathepsin leakage (119, 120). Disruption of subcellular vesicle transport
could suppress receptor-mediated endocytosis as well as exocytosis (121).
Cholesterol depletion from the ER pool could trigger autophagy and ER stress
(122). As lysosomes and late endosomes play crucial roles in many intracellular
pathways, disruption of this homeostatic balance could also disrupt mitochondria
and intracellular energy balance, increase production of reactive oxygen species,
cause mitotic arrest and inhibit protein synthesis (Fig. 1.9)(45).
33
1.11.1 Disruption of integrity of cellular membranes
Cholesterol is an essential structural component of cellular membranes to
maintain its integrity as well as fluidity. In cellular membranes, the cholesterol to
phospholipid ratio is precisely regulated to maintain proper membrane
functioning (123). Accumulation of cholesterol in lysosomal/late endosomal cell
compartments could destabilize these organelles leading to an increase in
permeability to lysosomal proteases and ions. As a consequence of lysosomal
membrane permeabilization (LMP), cathepsins and other proteases leak in to the
cytosol where they can trigger both apoptotic or non-apoptotic cell death
pathways (119). Although most of the cathepsins are active only in acidic pH,
some of them (such as cathepsin B, D or L) can remain active in the neutral pH
of the cytoplasm. Complete disruption of lysosomal membranes can trigger
necrosis while partial leakage of cathepsins can induce programmed cell death.
Sphingosine has been reported to induce cell death through lysosomal
membrane permeabilization. As it was discussed earlier, in NPC disease and
following treatment of class-II lysosomotropic compounds, sphingosine
accumulates inside the acidic cell compartments causing increased membrane
permeability. Induction of programmed cell death following treatment of jurkat T
lymphocytes or J744 macrophage cells with sphingosine has been reported (29).
A decrease in mitochondrial membrane potential and activation of caspases were
observed. However, a high dose of sphingosine was reported to cause necrosis
without caspase activation.
34
1.11.2 Induction of arachidonic acid metabolism.
Arachidonic acid (AA) metabolism could also induce cytotoxicity in NPC
disease cells (124). Nakamura and colleagues demonstrated that, NPC1deficient Chinese hamster ovary cells secrete increased levels of AA compared
to wild-type cells. Inhibition of cytosolic phospholipase A-2 (cPLA2) or cultivation
of cells in lipoprotein-deficient medium was able to suppress the AA secretion.
Moreover, U18666A treatment triggered AA secretion while inducing reactive
oxygen species levels and cell death. Interestingly knockdown of cPLA2 was
able to decrease U18666A mediated induction of ROS formation and cell death.
Activation of PLA2 enhanced LMP in a lymphoma cell line; and AA liberated by
phospholipases could destabilize lysosomal membranes (125, 126).
Interestingly, activation of caspases by lysosomal proteases could activate
cPLA2, creating a positive feedback loop between LMP and cPLA2 activity (127).
However, further studies are required to identify the link between inhibition of
cholesterol transport and arachidonic acid metabolism.
1.11.3 Increased oxysterol levels
Oxysterols are also capable of inducing cell death through lysosomal
membrane permeabilization (120). Roussi et al. have reported that 7βhydroxycholesterol or 7β-hydroxysitoesterol (major oxidation products of
cholesterol) induce apoptosis in Caco-2 cells, in a caspase-dependent manner
(128). Although these compounds share significant structural similarity, they
display differences in the cell death mechanism induced by each compound. 7βhydroxycholesterol induced accumulation of reactive oxygen species and caused
35
mitochondrial membrane permeabilization, whereas 7β-hydroxysitoesterol did not
trigger any of these alterations. These differences in cellular responsiveness
might be caused by the slight differences in the hydrophobicity of these
molecules (119).
1.11.4 Disruption of mitochondrial membrane cholesterol levels
Mitochondria lies at the heart of many apoptotic programs and mitochondrial
membrane cholesterol is strictly regulated to ensure its proper function (118,
129). Treatment of HeLa cells with U18666A triggers mitochondrial cholesterol
loading (130). Increase in mitochondrial cholesterol could disrupt ATP
production (131). Yu et al. demonstrated that in NPC1 mouse neuronal cells
mitochondrial membrane cholesterol levels were significantly elevated (132). As
a consequence of this increase, mitochondrial membrane potential and activity of
ATP synthase was markedly reduced. Methyl-β-cyclodextrin mediated depletion
of cholesterol was able to restore mitochondrial dysfunctions and ATP
production. Importantly, exogenous ATP treatment was able to rescue impaired
neurite outgrowth of NPC1 neurons. Many tumors display high mitochondrial
cholesterol content and tricyclic antidepressants were reported to decrease the
mitochondrial respiration rate, more effectively in transformed cells (130, 131,
133). These findings suggest that, class-II lysosomotropic compounds could
trigger an increase in mitochondrial cholesterol content and consequently impair
organelle function.
36
1.11.5 BAX mediated cell death
As we have observed with leelamine and FIASMA compounds, class-II
lysosomotropic compounds significantly hinder mitochondrial outer membrane
potential. BAX is a pro-apoptotic member of Bcl-2 family of proteins and induces
mitochondrial outer membrane permeabilization (MOMP) as a response to
various apoptotic stimuli (134). However, BAX has also been shown to
participate in lysosomal cell death pathways (119). Using immuno-electron
microscopy, Kagedal and colleagues demonstrated that, Staurosporine treatment
induces BAX translocation to lysosomal membranes and causes lysosomal
membrane permeabilization (135). This observation was validated with purified
lysosomal fractions in which they had observed release of lysosomal proteases
following incubation with recombinant BAX protein. Feldstein et al. also reported
similar observations with free fatty acid induced lipotoxicity (136). BAX was
activated and translocated to lysosomes following exposure of liver cells to
palmitate. Lysosomal membrane permeabilization was a consequence of this
translocation as siRNA mediated knockdown of BAX expression was able to
suppress cathepsin release. In our studies we have observed that BAX-/HCT116 cells were more resistant to cell death mediated by class-II
lysosomotropic compounds (see Chapters II and III). However, further
clarification is required to assess whether this effect was regulated by BAX
translocation to mitochondria or lysosomes.
37
1.11.6 Disruption of Golgi vesiculation and caveolin transport
Other sources of cytotoxicity mediated by inhibition of intracellular cholesterol
could involve disruption of Golgi vesiculation and caveolin transport to the
plasma membrane. Caveolins are integral membrane proteins that are involved
in the formation of a special type of lipid rafts, called caveolae. Caveolins are
upregulated in several MDR cancer cell lines and tumor specimens (137).
Caveolae membranes are enriched in cholesterol and sphingolipids as well as
caveolins and perform several functions in signal transduction and endocytosis.
Reverter and colleagues demonstrated that accumulation of late endosomal
cholesterol impairs cholesterol supply in Golgi and consequently decreases Golgi
vesiculation and caveolin transport (121).
1.11.7 Disruption of lipid rafts and inhibition of endocytosis
Cholesterol is an essential component of not only for caveolae but also other
lipid rafts and clathrin-coated pits (138). Accumulation of cholesterol inside late
endosomes and lysosomes may lead to alterations in the composition of lipid
rafts (139). Recently, Kuech et al. analyzed the trafficking profile of
dipeptidylpeptidase IV (DPPIV), a lipid raft associated membrane protein, in
NPC1 patient fibroblasts. They found that lipid raft dependent endocytosis was
significantly hindered in NPC1 cells. In our studies we observed that, both
leelamine and FIASMA compounds hinder endocytosis of Alexa Fluor conjugated
transferrin protein (see Chapter II and III). However, many other factors might
also be involved in inhibition of endocytosis. In fact, it was hypothesized that, an
overall change in membrane elasticity of endosomes or defective calcium
38
homeostasis inside the acidic vesicles could prevent transportation and budding
of endocytic vesicles (27, 140).
1.11.8 Inhibition of membrane to cytosol signaling cascades
Endocytosis has an essential role in cellular signal transduction. It tightly
controls the activity of various membrane receptors such as receptor tyrosine
kinases (RTK), G-protein coupled receptors (GPCR) and ligand-gated channels
(e.g. Neurotransmitter receptors) (50, 141, 142). Therefore, inhibition of
endocytosis could mediate a general jam in signal transduction pathways. We
have shown that treatment of UACC 903 melanoma cells with leelamine or
FIASMA compounds, altered localization of receptor tyrosine kinases and
inhibited downstream signaling such as PI3K/AKT and STAT3 cascades. Similar
observations have also been reported, where exposure of U-87MG glioblastoma
cell line to imipramine induced cell death through inhibiting PI3K/AKT/mTOR
signaling cascade (49). Recently, impaired insulin signaling following inhibition of
NPC1 expression has also been reported (143). Both siRNA mediated
knockdown of NPC1 and U18666A treatment hindered insulin mediated
phosphorylation of AKT protein. The effect was mediated by the decreased
levels of caveolae formation as caveolin-1 levels were diminished in plasma
membrane. Consistent with this observation, the impairment of insulin signaling
was also observed in NPC1 knockout mouse models (144).
39
Activation of RTKs leads to initiation of diverse signaling cascades such as
PI3K/AKT, MAPK, PKC and STAT. However, following receptor activation,
receptors undergo endocytosis which complicates the regulation of the
downstream cascades. Surface localized receptors trigger distinct signaling
cascades in contrast to internalized ones (145). Some studies suggest that
endosome-localized insulin receptors exert greater impact on intracellular
signaling cascades in contrast to plasma membrane associated ones (146).
Inhibition of internalization of insulin-like growth factor type-I receptor (IGFIR)
suppresses MAPK cascade without altering AKT activation (147). However,
recycling of the IGFIR was required to sustain AKT activity (145). Moreover, it
has also been reported that STAT3 co-localizes with endocytic vesicles and its
activity depends on receptor-mediated endocytosis, as inhibition of endocytosis
blocks its nuclear translocation and activity (148). Since malignancies are
addicted to the activity of these signaling cascades, class-II lysosomotropic
compounds-mediated inhibition of endocytosis could effectively induce cell death
in cancer cell lines.
On the other hand, entry of many viruses into the cells depends on receptormediated endocytosis (149, 150). Interestingly, it was discovered that NPC1
protein was essential for the Ebola virus entry (151, 152). Primary fibroblast cells
derived from NPC1 patients were resistant to infection by Ebola and Marburg
viruses (151). shRNA mediated knockdown of NPC1 or treatment of cells with
U18666A or imipramine was able to prevent infection of cells with these viruses.
However, studies suggested that the decrease in infection was not related to a
40
decrease in the uptake of virus but to its transport from endocytic vesicles to
cytosol (151).
1.11.9 Induction of endoplasmic reticulum stress
Cytotoxicity mediated by class-II lysosomotropic compounds may also involve
endoplasmic reticulum (ER) stress. ER is an important sensor for various
intracellular stress factors such as accumulation of misfolded proteins and
disruption of intracellular calcium homeostasis (122). ER stress is reported to be
a common observation in lysosomal storage diseases (LSD) including NPC1
(153). Cholesterol depletion in ER membranes could trigger ER stress due to
impaired transport of secretory proteins or due to altered calcium homeostasis
(154, 155). As discussed earlier, in their microarray study Wiklund and
colleagues have identified alteration of many genes that are involved in
cholesterol regulation, following treatment of cells with antipsychotic agents (66).
However, their microarray results displayed fingerprints of ER stress as
evidenced by upregulation of several ER stress-related genes, such as XBP1,
GRP78 (HSPA5), HERPUD1 and C/EBP-β. XBP1 is a UPR transcription factor
and regulates expression of ER resident chaperone genes such as GRP78 (156).
HERPUD1 regulates the balance between protein load vs folding capacity of the
ER and its overexpression is considered to be a hallmark of ER stress (157).
C/EBP-β is involved in transition of UPR from a protective to cell death phase
(158). It is noteworthy that, the unfolded protein response includes suppression
of protein translation to block further accumulation of unfolded proteins, which
41
could explain the mitotic arrest that is commonly observed in the cells treated
with weakly basic amines. (14).
In a recent study, a novel cellular stress response that causes reversible,
membrane-whorls like aggregations of the ER was identified (159). This stress
response was triggered by various pharmacological chemicals mostly with
antipsychotics and antihistamines. Seven of the compounds (Suloctidil,
Astemizole, Chlorpromazine, Terfenadine, Trifluoperazine, Fluphenazine, and
Thioridazine) which were demonstrated to induce this type of ER stress response
were FIASMA compounds acting as intracellular cholesterol transport inhibitors.
Moreover, we had observed similar membrane aggregations in leelamine treated
UACC 903 melanoma cells. Hence, this could be a general stress response
triggered by class-II lysosomotropic compounds following intracellular cholesterol
accumulation. In fact, it was noted that this stress response was different from
classical ER stress responses and might involve altered lipid metabolism.
1.11.10 Oxidized-LDL and PKC signaling
Oxidized-LDL could induce ER stress and apoptosis through protein kinase C
δ activation (PKCδ) (160). PKCδ was downregulated in transformed
keratinocytes and its activation was sufficient for induction of apoptosis in these
cells (161). Baicalein, an antioxidant, and an inhibitor of calcium mobilization,
was shown to attenuate oxidized-LDL induced apoptosis (162, 163). This
compound was also reported to protect neuronal cells against ER-stress-induced
apoptosis and cardiomyocytes against the toxicity of doxorubicin through
inhibition of JNK activation (164, 165). Qi et al. demonstrated that, following ER
42
stress, PKCδ translocates to the ER and forms a complex with Abl tyrosine
kinase to communicate ER stress signals to mitochondria through activation of
JNK signaling (166). In fact, inhibition or knockdown of PKCδ was reported to
decrease ER-stress-induced JNK activation and suppress consequent stressrelated apoptosis. Formation of this complex was shown to be an essential step
for ER-stress-induced apoptosis, both in-vitro and in-vivo. PKD/PKCµ, another
member of PKC family of proteins, could be involved in this process as activation
of PKCµ is regulated through sequential phosphorylation by PKCδ and Abl
kinases (167). PKCµ has also
been reported to directly regulate
Figure 1.10
the JNK/c-Jun pathway following
its activation (168). Consistent
with these findings, we observed
dose and time dependent
activation of PKCδ and PKCµ
following leelamine treatment
(Figure 1.10). Baicalein and two
PKC inhibitors, Gö6976 and
Staurosporine, were able to
Figure 1.10 Leelamine mediated alterations
in PKC singling.
effectively suppress leelaminemediated cell death (Figure 1.11). Importantly, Gö6983, (except PKCµ, inhibits
same PKC isoforms with Gö6976), was not able to protect cells from leelaminemediated cell death, suggesting that inhibition of the PKCµ was the mediator of
43
the protective effect of
Figure 1.11
Gö6976 (169). Taken
together, these studies
demonstrate that class-II
lysosomotropic
compounds could trigger
ER stress associated
membrane aggregations
and PKCδ/PKCµ/JNK
signaling could play role in
the cell death process
mediated by this stress.
Figure 1.11 Co-treatment of Baicalein, GO6976 or
Staurosporine protects UACC 903 cells from leelamine
mediated cell death.
44
1.11.11 Inhibition of autophagic flux
In addition to these mechanisms, autophagy and inhibition of autophagic flux
have also been reported to play important role in induction of cell death following
inhibition of intracellular cholesterol transport (44, 49). Since the link between
lysosomal cholesterol accumulation and autophagy has been discussed above,
the details will not be discussed again. However briefly, inhibition of cholesterol
transport could induce autophagy due to insufficient cholesterol levels in ER (45,
46). However, excess amount of cholesterol in acidic organelles impairs the
fusion of autophagosomes with lysosomes leading to inhibition autophagic flux
and consequently accumulation of autophagosomes (43). siRNA mediated
knockdown of Beclin-1, a protein that is required for initiation and maturation of
autophagosomes, was shown to protect cells from cell death initiated by
cholesterol transport inhibitors (48). Consistent with this observation, autophagydeficient ATG5 knockout MEF cells were resistant to cell death mediated by
leelamine (44).
Taken together, inhibition of intracellular cholesterol transport has many
impacts on cellular processes and signaling cascades. These alterations might
vary between cell lines and might depend on the chemical properties of the
compound that inhibits cholesterol transport. Cell death might be a consequence
of a combination of multiple altered signaling events. Further investigations are
warranted to identify the cause and result relationships between the altered
events.
45
1.12 Increased sensitivity of cancer cells to class-II
lysosomotropic compounds compared to normal cells
An important aspect of class-II lysosomotropic compound mediated cell death
is the increased sensitivity of cancer cell lines to these compounds in contrast to
normal counterparts. This observation has been extensively reported in the
literature as well as observed in our studies with leelamine and FIASMA
compounds (67, 170-172). In contrast to normal cells, mutant BRAF/PTEN-/melanoma cell lines displayed 3-5 fold increased sensitivity against leelamine.
This observation was valid for all of the FIASMA compounds that we have tested.
On average, UACC 903 cells were ~2.9 fold more sensitive to FIASMAs
compared to fibroblasts. However, for wild-type BRAF or wild-type PTEN cell
lines this difference was less.
1.12.1 Decreased levels of LAMP-1 and LAMP-2 proteins in cancer
cells
Increased sensitivity of cancer cells to cell death triggered by lysosomal
pathways has been investigated (170). Transformation of cells by various
oncogenes, such as Ras, Erbb2 or Src, affected maturation, size, and
localization of lysosomes. In control cells lysosome-associated membrane
protein-1 (LAMP-1) positive vesicles were localized to perinuclear region while
they were distributed throughout the cytosol in transformed cells. Transformation
of fibroblast cells reduced the levels of LAMP-1 and LAMP-2 proteins. The
increased sensitivity of transformed cells was associated with this reduction since
siRNA mediated knockdown of LAMP-1 and LAMP-2 was able to sensitize U-2OS osteosarcoma cells to cell death triggered by lysosomal pathways. MAPK
46
signaling is over-activated in many cancers including melanoma and regulates
cathepsin expression (170). An increased level of cysteine cathepsins
suppresses lysosome-associated membrane proteins (LAMP-1 and LAMP-2).
Both cathepsin inhibitors and ectopic expression of LAMP-1/2 proteins were
shown to protect transformed cells against the lysosomal cell death pathway.
Moreover, LAMP-1/2 proteins have been reported to be involved in
intracellular cholesterol transport as their knockdown results in accumulation of
unesterified cholesterol in the late endosomes and lysosomes of fibroblast cells
(173). Enforced expression of LAMP-2 was able to hinder the lysosomal
cholesterol accumulation induced by U18666A treatment. Taken together, in
cancer cells over-activation of various oncogenes appears to trigger increased
cathepsin expression which consequently decreases LAMP-1/2 levels. This
decrease triggers sensitivity of transformed cells to lysosomal death pathways
potentially through alterations in lysosomal cholesterol homeostasis (Figure
1.12).
1.12.2 Decreased activity of ASM in cancer cells
Another factor that contributes to the increased sensitivity of cancer cells was
reported to be the decreased activity of ASM in cancer cells (57). Class-II
lysosomotropic compounds could be more effective in these cells through
blocking the residual ASM activity. Cancer cells display higher levels of activity
in membrane to cytosol signaling cascades which depends on membrane
dynamics (57). Decreased activity of ASM confers high concentrations of
sphingomyelin in cancer cells which could inhibit these processes while
47
enhancing the fragility of lysosomal membranes in tumor cells. Moreover,
increased sphingomyelin levels also decreases cholesterol export from
lysosomes and consequently inhibits saposins causing a further reduction in
sphingolipid degradation (57). This vicious cycle could result further
accumulation of sphingolipids up to toxic levels (Figure 1.12).
1.12.3 Oncogene addiction
On the other hand, it is noteworthy that, cancer cells have increased activity
of certain anti-apoptotic or mitogenic pathways that leads to several
malignancies. Many of these signaling cascades are initiated from abnormally
functioning proteins. Cancer cells are “addicted” to the activity of these
oncogenic signaling cascades and cannot survive when they are suppressed
(174, 175). Many of the oncogenic signals are either initiated from membrane
receptors or lie somewhere at the downstream of them. For instance, in
melanoma ~17% of the cases involve over-activation of membrane receptors
(such as c-Kit, EGFR, EphA1), ~20% involves activation of RAS and ~60%
involves activation of BRAF concurrent with PTEN deletion (176). Taken
together, nearly all melanoma cases are addicted to membrane to cytosol
signaling cascades and hence melanoma cell lines could have increased
sensitivity to the inhibition of endocytosis caused by cholesterol transport
inhibitors. In fact, in this dissertation, both leelamine and several other class-II
lysosomotropic agents were shown to suppress AKT signaling in melanoma cell
lines (Figure 1.12).
Figure 1.12
48
Figure 1.12 Cellular
alterations that can mediate
sensitivity of cancer cells to
class-II lysosomotropic
compounds. 1- Activation of
MAPK signaling enhances
Cathepsin expression which
increases lysosomal
cholesterol levels through
inhibition of LAMP1/2
proteins. In addition, this
cascade was reported to
affect maturation, size and
number of lysosomes which
could increase their
susceptibility to lysosomal
membrane permeability.
2- Decreased ASM
activity in cancer cells could
induce lysosomal cholesterol
levels
through increasing sphingosine levels. Accumulated cholesterol inhibits SAPOSINS
(Sphingolipid activator proteins) creating a vicious cycle between sphingosine and
cholesterol accumulation . 3- Cancer cells are addicted to signaling cascades in which
many are initiated from membrane receptors (e.g. AKT signaling). Inhibition of endocytosis
could induce cancer cell death through suppressing these cascades.
1.13 Conclusion
Selectivity of neoplastic drugs to cancer cells is a great obstacle in cancer
chemotherapy. To have a decreased toxicity, cancer drugs need to pose some
type of selectivity towards cancer cells. In many studies including the ones in
this dissertation, it has been shown that calls-II lysosomotropic compounds tend
to show several fold selectivity against various cancer cell lines in contrast to
their normal counterparts (67, 68, 133, 170, 171). This selectivity has been
attributed to the various metabolic differences, such as altered lysosomal
membrane stability, lysosomal pH differences and activity of different signaling
pathways between cancer and normal cells. Cancer cell death induced by classII lysosomotropic compounds was shown to be complex. Many cellular
alterations such as decreased ATP production due to disruption of mitochondria,
49
increased production of reactive oxygen species, toxic molecules such as
oxysterols, disruption of lysosomal membrane stability, inhibition of membrane to
cytosol signaling and inhibition of autophagic flux have been reported to cause
cell death following treatment with these agents. All of these could be triggered
by multiple actions of these agents such as inhibition of lysosomal cholesterol
egress, inhibition of ASM activity, disruption of intracellular lipid homeostasis and
alteration of membrane fluidity.
In this dissertation, inhibition of lysosomal cholesterol egress by leelamine
and FIASMAs was shown to impair autophagic flux and cellular endocytosis in
melanoma cell lines. Inhibition of cellular endocytosis was suggested to alter
localization and activity of various signaling receptors such as IGF1R and HGFR,
causing suppression of key signaling cascades required for the viability of
melanoma cells. More importantly these class-II lysosomotropic compounds
were also effective in-vivo and reduced xenografted tumor growth up to ~60 % of
the controls. Since there are many class-II lysosomotropic compounds that are
generic drugs with well-established toxicity profiles, further investigations related
to the chemotherapeutic potential of these agents have clinical significance and
could open new perspectives for repurposing these drugs for the treatment of
advanced-stage cancers.
50
CHAPTER 2
Leelamine mediates cancer cell death through inhibition
of intracellular cholesterol transport
Kuzu OF, Gowda R, Sharma A, Robertson GP
Published in Molecular Cancer Therapeutics
2014 Jul;13(7):1690-703
All rights reserved
51
2.1 Abstract
Leelamine is a promising compound for the treatment of cancer; however, the
molecular mechanisms leading to leelamine-mediated cell death have not been
identified. This report shows that leelamine is a weakly basic amine with
lysosomotropic properties, leading to its accumulation inside acidic organelles
such as lysosomes. This accumulation leads to homeostatic imbalance in the
lysosomal endosomal cell compartments that disrupt autophagic flux and
intracellular cholesterol trafficking as well as receptor-mediated endocytosis.
Electron micrographs of leelamine-treated cancer cells displayed accumulation of
autophagosomes, membrane whorls, and lipofuscin-like structures, indicating
disruption of lysosomal cell compartments. Early in the process, leelaminemediated killing was a caspase-independent event triggered by cholesterol
accumulation, as depletion of cholesterol using β-cyclodextrin treatment
attenuated the cell death and restored the subcellular structures identified by
electron microscopy. Protein microarray–based analyses of the intracellular
signaling cascades showed alterations in RTK–AKT/STAT/MAPK signaling
cascades, which was subsequently confirmed by Western blotting. Inhibition of
Akt, Erk, and Stat signaling, together with abnormal deregulation of receptor
tyrosine kinases, was caused by the inhibition of receptor-mediated endocytosis.
This study is the first report demonstrating that leelamine is a lysosomotropic,
intracellular cholesterol transport inhibitor with potential chemotherapeutic
properties leading to inhibition of autophagic flux and induction of cholesterol
accumulation in lysosomal/endosomal cell compartments. Importantly, the
52
findings of this study show the potential of leelamine to disrupt cholesterol
homeostasis for treatment of advanced-stage cancers.
53
2.2 Introduction
Melanoma is the deadliest and most metastatic form of skin cancer (177). If
it is detected early, surgery still is the most feasible option to cure the disease.
However, if it metastasizes to other organs, less than 36% of the patients survive
for longer than one year (177). Targeted therapies such as Zelboraf and
Dabrafenib, two FDA approved mutant B-RAF inhibitors, can be used for the
short-term management of melanoma. But an aggressive drug resistant disease
usually develops limiting survival benefit to only a few months (178). Cancer
cells were able to bypass the targeted therapies by compensating with alternative
activation of the pathway, several by activating upstream receptor tyrosine
kinases (179). Therefore, targeting these alternative escape routes through a
combinational drug treatment approach or development of a drug that
suppresses multiple disease driving pathways is indispensable for a successful
treatment of melanoma or prevention of recurrent resistant disease.
Natural compounds are important sources of new drug development and
represent a significant portion of the FDA-approved cancer therapeutics portfolio
(180). Through a natural compound library screen, leelamine, a tricyclic
diterpene molecule that was extracted from the bark of pine trees, is reported in
the article by Gowda et al. in the current issue of this journal, as a potential drug
effective against advanced stage melanoma. This agent has been shown to
induce death of advanced stage melanoma cell lines 3 to 5 fold more effectively
than normal cells and led to a 60% decrease in tumor burden compared to
control vehicle treated animals. In these studies, leelamine inhibited AKT and
54
STAT3 signaling in xenografted tumors. No obvious systemic toxicity of the
compound following treatment was detected as assessed by body weights of
animals or by examination of the various blood parameters that are indicative of
organ distress. However, the molecular mechanisms underlying the therapeutic
efficacy of leelamine are unknown; therefore, in this report, the mechanism of
action of leelamine for induction of cell death in cancer cells has been identified.
Prior to this report, leelamine had been reported to be a poor agonist of
cannabinoid receptors and a weak inhibitor of pyruvate dehydrogenase kinases
(181, 182). However, data presented here suggest that leelamine mediated
melanoma cell death does not involve modulation of any of these reported
targets, but was rather mediated by the lysosomotropic property of the
compound, which triggers accumulation of compound inside the
lysosomal/endosomal (LE/L) compartments. This accumulation led to disruption
of cholesterol homeostasis and intracellular vesicle transport systems as well as
inhibition of autophagic flux. As a consequence, a caspase-independent cell
death that was separate from classical apoptotic pathways was induced.
Western blot analyses revealed inhibition of receptor tyrosine kinase (RTK), AKT,
ERK and STAT3 signaling cascades, which are reported to be important for the
survival of melanoma cells. Leelamine mediated inhibition of these cascades
was attributed to the inhibition of receptor mediated endocytosis of RTKs causing
aberrant accumulation of these proteins in the perinuclear region of cells.
55
2.3 Materials and Methods
2.3.1 Cell lines, culture conditions and plasmids.
Metastatic melanoma cell line UACC 903 was provided by Dr. Mark Nelson
(University of Arizona, Tucson, AZ) between 1995 to 1999, 1205 Lu cell line was
provided by Dr. Herlyn (Wistar Institute, Philadelphia, PA) between 2003-2005,
human fibroblast cell line FF2441 was provided by Dr. Craig Myers (Penn State
College of Medicine, Hershey, PA) in 2005 and these cell lines were maintained
in cell culture up to 69th, 98th, 7th passages respectively. Wild-type and BAX
knock-out (HCT116BAX−/−) HCT116 human colon cancer cell lines were provided
by Dr. Wafik El-Deiry (Penn State College of Medicine, Hershey, PA) in 2013.
Wild-type and ATG5 knock-out (MEFATG5−/−) mouse embryonic fibroblast (MEF)
cell lines were provided by Dr. Hong-Gang Wang (Penn State College of
Medicine, Hershey, PA) in 2008. All cell lines were maintained in DMEM
(Invitrogen, Carlsbad, CA) supplemented with 1% Glutamax (Invitrogen) and
10% FBS (Hyclone, Logan, UT) in a 37°C humidified 5% CO2 atmosphere
incubator. Melanoma cell lines were periodically monitored for genotypic
characteristics, phenotypic behavior and tumorigenic potential to confirm cell line
identity. pBABE-puro mCherry-EGFP-LC3B plasmid was obtained from
Addgene and transfected to UACC 903 cells to generate GFP tagged LC3B
expressing UACC 903 cell line (plasmid #22418) (183).
56
2.3.2 Cell viability assay and drug treatments.
Viability of cells upon treatment with various compounds (see Table 2.1 for
compound sources) were measured through the MTS assay (Promega,
Madison, WI) as described previously (184). For combinatorial drug treatment
studies, both investigated compounds and leelamine were treated
simultaneously. However, in the case of β-cyclodextrin pre-treatment, βcyclodextrin was washed away after 60 minutes of treatment and subsequently
cells were treated either with DMSO or leelamine. Twenty-four hours after
treatment, MTS assay was performed.
57
Table 2.1: Compounds and sources
Compound Name
Bafilomycin A1
Concanamycin A
Abietic Acid
ß-cyclodextrin
z-VAD-fmk
Staurosporine
TRAIL
ALLN
ALLM
Pepstatin A
AEBSF
Leupeptin
BIP-V5
NS3694
BI-6C9
Simvastatin
Pravastatin
AM251
AM630
U-18666A
Filipin-III
Dichloroacetic acid
Cyclohexamide
Leelamine
Cholesterol
L-alpha-PC
3H Leelamine 1
million CPM/uL
Company
LC Labs, Woburn, MA
Santa Cruz Biotech., Santa Cruz, CA
Sigma-Aldrich, St. Louis, MO
Sigma-Aldrich, St. Louis, MO
Tocris, Bristol, UK
BIOMOL, Plymouth Meeting, PA
R&D Systems, Minneapolis, MN
Cayman Chem , Ann Arbor, MI
Enzo Life Sciences , Farmingdale, NY
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Calbiochem, Darmstadt, Germany
Sigma-Aldrich, St. Louis, MO
Santa Cruz Biotech., Santa Cruz, CA
Sigma-Aldrich, St. Louis, MO
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Sigma-Aldrich, St. Louis, MO
Sigma-Aldrich, St. Louis, MO
Tocris, Bristol, UK
Avanti Lipids
Avanti Lipids
Catalog #
B-1080
Sc-202111
10
C4805
2163
BML-EI156
375-TEC-010
14921
BML-PI100
9000469
14321
14026
196810
N7787
sc-210915
S6196
10010343
71670
10006974
10009085
10009779
D6399
C7698
2139
700000
840051
American Radio Chemicals, St. Louis, MO
NA
58
2.3.3 Caspase dependence, mitochondrial membrane potential and
DNA fragmentation assays.
Caspase dependence of cell death was measured by growing cells in a 96well plate and pre-incubating with pan-caspase inhibitor z-VAD-fmk (20 µmol/L)
for 1 hour prior to drug treatments. TRAIL (50 ng/mL) treatment was used as a
positive control for induction of caspase dependent cell death. Twenty-four hours
after treatment, cell viability was measured by MTS assay as described above.
Mitochondrial membrane potential was measured via the TMRE Mitochondrial
Membrane Potential Assay Kit (Abcam, Cambridge USA) according to the kit’s
protocol. For the DNA fragmentation assay, total DNA was collected using the
DNeasy (Qiagen, MA) kit according to instructions and DNA was loaded into 1%
agarose gels for electrophoresis.
2.3.4 Electron microscopy analyses.
UACC 903 cells growing at 70 to 80% confluency on 35 mm permanox petri
dishes (Electron Microscopy Sciences, PA) were treated with leelamine (3
µmol/L) or DMSO for 3 hours, washed with PBS and then fixed with fixative
(0.5% glutaraldehyde / 4% paraformaldehyde in 0.1 M sodium cacodylate buffer,
pH 7.3) for 1 hour. The cells were washed in 0.1 M sodium cacodylate and post
fixed overnight in buffered 1% osmium tetroxide 1.5% potassium ferrocyanide.
After post fixation, cells were rinsed with buffer, dehydrated in a graded series of
ethanol, and embedded in EMbed812 (Electron Microscopy Sciences). After
sectioning, samples were stained with 2% aqueous uranyl acetate and lead
citrate followed by analysis with JEOL JEM1400 Digital Capture TEM.
59
2.3.5 Kinexus and Receptor Tyrosine Kinase Protein Arrays.
UACC 903 cells treated with leelamine (3 µmol/L for 3,6,12 or 24 hours) were
collected with Kinexus lysis buffer according to the Kinexus protocol and shipped
to Kinexus (Vancouver, Canada) for analyses with Kinexus Antibody Microarray
Chip 1.3 (812 antibodies). The array data was normalized through Z-score
transformation and Z-ratios between treated samples and corresponding controls
were calculated as described elsewhere (185). The data was analyzed through
Ingenuity Pathway Analyses (IPA, version 17199142) software based on the
alterations with a Z ratio of ± 1.50 with the software’s default settings. Human
Phospho-Receptor Tyrosine Kinase Array Kit was obtained from R&D Systems
(Minneapolis, MN) and experiments were performed according to the
manufacturer’s protocols. The blot images were quantified by using Quantity
One 1-D Software (Bio-Rad Laboratories, Hercules, CA, USA).
2.3.6 Cholesterol localization, quantitation and TLC analyses.
Localization of intracellular cholesterol was detected through Cayman’s
Cholesterol Cell-Based Detection Assay Kit (Cayman Chemical, Ann Arbor, MI)
according to the manufacturer’s protocol. Lipid extraction from cell cultures was
achieved through the Bligh and Dyer method (186). The lipid extract was
dissolved in chloroform: methanol (2:1) and stored at -20oC. TLC analyses were
undertaken according to a published approach (187). High-performance thin
layer chromatography (HPTLC) Silica gel 60 plates (Merck, Germany) were
developed with iodine vapor. The bands were analyzed with ImageJ, image
analysis software (v1.44, NIH, USA). Rf values were calculated as 0.35 for
60
Cholesterol, 0.1 for PC and 0.17 for PE. These values were consistent with the
values observed in the aforementioned published study (187).
2.3.7 Evaluation of endocytosis.
Endocytic capacity of the cells was measured through evaluation of receptormediated endocytosis of Alexa Fluor 488 conjugated transferrin protein
(Molecular Probes, Eugene, OR). Briefly, cells were seeded into chamber slides
and treated with leelamine for 2 hours. Next, transferrin protein was added at a
final concentration of 5 mg/mL and incubated for 30 minutes. Cells were then
washed with PBS, trypsinized and collected for flow cytometry analyses or fixed
on a slide with 4% paraformaldehyde for fluorescence microscopy analysis.
2.3.8 Analyses of drug uptake using 3H labeled leelamine.
To analyze the kinetics of leelamine uptake, tritium labeled leelamine was
used (specific activity of 25 Ci/mmol) (American Radio Chemicals Inc, St. Louis,
MO). UACC 903 cells (70-85% confluent in a 150 mm plate) were treated with
25 mL of DMEM media containing 3 µmol/L leelamine and 5 mL of 20 mM triated
leelamine (1million CPM/uL). At various time points, 20 mL of media from the
plate was collected and radioactivity associated with the tritiated leelamine was
measured using the LS-6500-Beckman Coulter liquid scintillation counter.
2.3.9 Analyses of lysosomotropism.
UACC 903 cells were plated into 6-well plate and grown to 75-90%
confluency. Cells were treated with 1 mM Lysotracker Red DND-99 (Life
Technologies, Grand Island, NY) for 15 minutes. Cells were subsequently treated
61
with leelamine or chloroquine for 45 minutes and collected for flow cytometry
analyses.
2.3.10 Western blot analysis.
1-1.5 x106 melanoma cells were plated in 100 mm culture dishes and grown
to 75-90% confluency. After treatments, at indicated time points cells were
harvested in RIPA buffer containing protease and phosphatase inhibitors (Pierce
Biotechnology, Rockford, IL). Proteins were quantitated using the BCA Assay
from Pierce (Rockford, IL). Thirty μg of protein per lane were loaded onto a
NuPage gel from Life Technologies, Inc. and electrophoresed according to the
manufacturer’s instructions. Proteins were transferred to PVDF membrane and
blots were probed with antibodies according to supplier’s recommendations (For
detailed antibody information see Table 2.2). Immunoblots were developed
using the enhanced chemiluminescence (ECL) detection system (Thermo Fisher
Scientific, Rockford, IL).
62
Table 2.2: Antibodies and sources
Antibody
Akt (Total Akt1/2/3)
Phospho-Akt
Phospho-4E-BP1 (S65)
Cleaved PARP
ERK 2
LC3B
P27 (C-19)
Company
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Catalog #
9272
9271
9456
9541
sc-1647
2775
sc-528
Phospho-Stat3 (Y705)
Cell Signaling Technology, Danvers, MA
9145
Stat3
Cyclin D1
Trk (pan) (C17F1)
IGF-1RB (C-20)
HGFR (C-28)
IRS1
PDGFR β (28E1)
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Santa Cruz Biotechnology, Santa Cruz, CA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
4904
2978
4609
sc-713
sc-161
2382
3169
SQSTM1/p62
Cell Signaling Technology, Danvers, MA
5114
2.3.11 siRNA transfections.
5 pmoles/well of siRNA was transfected into UACC 903 cells that were
seeded into 96-well plates using Lipofectamine RNAiMAX (Life Technologies)
reagent according to the manufacturer’s protocols. 48 hours after transfection,
effect on cell viability was measured by MTS assays. Mutant BRAF siRNA and
scrambled siRNA were used as positive and negative controls, respectively.
Viability of cells was plotted against scramble siRNA transfected cells (siRNA
sequences are provided in Table 2.3).
63
Table 2.3: siRNA sequences and sources
siRNA
Scrambled
mut-Braf
CB1 #1
CB1 #2
CB2 #1
CB2 #2
PDK1 #1
PDK1 #2
PDK1 #3
PDK2 #1
PDK2 #2
PDK2 #3
PDK3 #1
PDK3 #2
PDK3 #3
PDK4 #1
PDK4 #2
PDK4 #3
Sense Sequence
UCUCACGUGACACGUUCGGAGAAUU
GGUCUAGCUACAGAGAAAUCUCGAU
UACACCAUGAUUGCAAGCAGAGGGC
UUCGUACUGAAUGUCAUUUGAGCCC
UUUGUAGGAAGGUGGAUAGCGCAGG
UGCCCAUAGGUGUAGAUGAUUCCGG
CAGAUACUGUGAUACGGAUtt
GAGUCGCAUUUCAAUUAGAtt
CAAACUGCAAUGUACUUGAtt
AGAUCAACCUGCUUCCCGAtt
CAACCCAGCCCAUCCCAAAtt
CAGCAAUGCCUGUGAGAAAtt
GACUUAUCCAUUAAGAUCAtt
CCCUCGUUACUUUGGGUAAtt
CAUAUAUGUUUCUACGAAAtt
GGAUGCUCUGUGAUCAGUAtt
GGGCAACAGUUGAACACCAtt
CCGCCUCUUUAGUUAUACAtt
Company
Invitrogen
Invitrogen
Invitrogen
Invitrogen
Invitrogen
Invitrogen
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
Life Sciences-Ambion
2.3.12 Statistical analysis.
The statistical analysis was performed using the unpaired Student t test. A P
< 0.05 was considered statistically significant. * indicates P < 0.05.
64
2.4 Results
2.4.1 Leelamine inhibits autophagic flux in melanoma cells.
To dissect the mechanism by which leelamine kills cancer cells, UACC 903
melanoma cells treated with leelamine were examined by light and electron
microscopy. Light microscopy showed rapid and widespread vacuolization of the
cells (Fig. 2.1), followed by membrane blebbing, cell shrinkage and cell rounding.
Compared to control DMSO treated cells (Fig. 2.2 - Box a), transmission
electron microscopy showed accumulation of lipofuscin-like material (Fig. 2.2 Box b) (undegraded lysosomal waste), formation of web-like membrane whorls
(Fig. 2.2 - Box c) and increased number of autophagosomes (Fig. 2.2 - Box d).
Figure 2.1
Figure 2.1: Light
microscopic images
show vacuolization
of melanoma cells
after treatment.
Figure 2.2
Figure 2.2: Transmission electron micrographs show
DMSO-treated control cells (a), leelamine-treated cells
displaying formation of lipofuscin-like material (b), web-like
membrane whorls (c), and increased number of
autophagosomes (d).
65
TEM analysis suggested that leelamine treatment led to autophagosome
accumulation; therefore, the effect of leelamine on autophagic flux was next
evaluated through western blotting. Treatment with Bafilomycin A1 (BafA1), a
specific inhibitor of vacuolar type H+-ATPase that blocks autophagic flux, induced
accumulation of LC3B
Figure 2.3
(an autophagosome
marker) and
p62/SQSTM1 (an
autophagic flux
marker) proteins
indicating the
inhibition of
autophagosome
degradation (Fig. 2.3)
(188). Likewise,
Figure 2.3: Western blot analyses showing LC3B and P62
protein levels as a marker of autophagic flux; Erk-2 served as
a loading control. BafA1 treatment was used as a positive
control for inhibition of autophagic flux. Bottom, confocal
microscopy of GFP-tagged LC3B accumulation in leelamineor BafA1-treated UACC 903 cells.
leelamine treatment
induced the accumulation of both proteins in a dose dependent manner
suggesting inhibition of autophagic flux. Accumulation of LC3B protein was
detectable via fluorescence microscopy of UACC 903 cells expressing GFP
tagged LC3B protein (Fig. 2.3). Leelamine treatment also dose dependently
increased the intensity ratio of LC3B-II to LC3B-I, further indicating enhanced
autophagic activity (Fig. 2.3).
66
2.4.2 Leelamine has lysosomotropic property leading to accumulation
in acidic organelles.
Since observations such as vacuolization of cells, accumulation of lipofuscinlike material, formation of web-like membrane whorls and inhibition of autophagic
flux are commonly attributed to lysosomal storage diseases and can be mimicked
by some lysosomotropic compounds, the lysosomotropic potential of leelamine
was next investigated (189, 190). As a weakly basic primary amine, leelamine
has a pKa of 9.9 (calculated by ACD Labs Precepta software v14.0) and it was
therefore predicted to be a lysosomotropic compound. Treatment with vacuolar
H+-ATPase inhibitors can suppress the activity of lysosomotropic compounds by
inhibiting the acidification of cell compartments (14). Pre-treatment of UACC 903
melanoma cells with two
Figure 2.4
vacuolar H+-ATPase inhibitors
that target different subunits of
the H+-ATPase complex, BafA1
and Concanamycin A (Conc-A),
suppressed leelamine-mediated
cell vacuolization (Fig. 2.4),
suggesting that leelamine was a
lysosomotropic compound.
Figure 2.4: Light microscopic images of
melanoma cells following leelamine treatment
either alone or in combination with V-ATPase
inhibitors Conc-A and BafA1.
67
Lysosomotropic compounds can be rapidly taken up by cells due to trapping
inside the acidic organelles such as lysosomes and endosomes (191, 192). To
measure the kinetics of leelamine uptake, UACC 903 cells were treated with
tritiated leelamine and every 10 minutes
Figure 2.5
media samples were collected to quantify
levels of tritiated compound remaining in
the media. Sixty percent of the tritiated
leelamine was internalized into cells in less
than 30 minutes after treatment, which
supports the lysosomotropic property of the
3
compound (Fig. 2.5). This was further
Figure 2.5: Kinetics of H-labeled
leelamine uptake.
confirmed by testing the efficacy of
collected samples to decrease cell viability.
Figure 2.6
UACC 903 cells were treated with 3
mmol/L leelamine in a p100 plate and
every 10 minutes, 300 mL of media was
collected from the plate to treat UACC 903
cells that were plated in a 96 well plate
(100 mL X 3 wells/sample). Twenty-four
hours later, cell viability was assessed by
MTS assay. Consistent with the uptake
Figure 2.6: Viability of cells
exposed to conditioned media that is
collected from leelamine-treated
melanoma cells at different time
points.
kinetics of leelamine, samples collected 30 minutes after pre-incubation with
cells, did not induce cell death in UACC 903 cells (Fig. 2.6).
68
To further validate the lysosomotropic property of leelamine, a modified
Lysotracker Red DND-99 competition assay was used (193). Lysosomotropic
compounds typically compete with
Figure 2.7
Lysotracker Red DND-99 to decrease
uptake. Therefore, cells treated with a
lysosomotropic compound should take up
less Lysotracker Red DND-99. Flow
cytometry based quantitation of the staining
of cells with the Lysotracker Red DND-99
showed decreased uptake following
Figure 2.7: Histogram showing
lysosomotropic property of leelamine,
assessed by its competition with
LysoTracker Red DND-99 dye, which
was similar to chloroquine, a wellknown lysosomotropic compound.
treatment with chloroquine (100 µmol/L), a
well-known lysosomotropic compound, or leelamine (3 µmol/L), which provided
further support for leelamine as a lysosomotropic compound (Fig. 2.7).
2.4.3 Lysosomotropic property of leelamine mediated early caspaseindependent melanoma cell death.
Figure 2.8
To determine whether the
lysosomotropic property of leelamine
mediated its activity, cell viability
following H+-ATPase inhibition was
measured. Cotreatment of 10 nmol/L of
BafA1 or Conc-A effectively protected
melanoma cells from leelamine
mediated cell death (Fig. 2.8).
Figure 2.8: Viability of melanoma cells
treated with leelamine in the absence or
presence of V-ATPase inhibitors BafA1 or
Conc-A.
69
Moreover, abietic acid, a structurally similar compound to leelamine that lacks the
amine group, failed to induce either vacuolization or death of UACC 903 cells
suggesting that, the amine group of leelamine mediated its lysosomotropic
activity to subsequently trigger cell death (Fig. 2.9).
Figure 2.9
Figure 2.9: Abietic acid a structurally similar compound to leelamine
without an amine group fails to induce vacuolization and death of
melanoma cells. Light microscopic images of UACC 903 cells after
leelamine or abietic acid treatments (left); Viability of melanoma cell
lines after treatment with abietic acid (right);
Although leelamine has been reported in the current issue of this journal to
induce the activation of caspases (Gowda et al.), it was not known whether the
fate of leelamine treated cells is solely a result of caspase activation, or if there
are other players that trigger cell death. In the case of caspase-dependent cell
death, it would be expected that inhibition of caspase activation via pan-caspase
inhibitor zVAD-fmk would rescue cells from leelamine mediated cell death. In the
positive control, zVAD-fmk co-treatment completely restored the viability of cells,
which was reduced to 58% by TNF-related apoptosis-inducing ligand (TRAIL)
70
treatment (Fig. 2.10). In
contrast, zVAD-fmk had no
Figure 2.10
effect on the viability of
melanoma cells when cotreated with leelamine.
Furthermore, leelamine did not
induce caspase-mediated DNA
fragmentation up to 24 hours
following treatment when
compared to Staurosporine
treatment, an accepted
Figure 2.10: Caspase dependence of leelaminemediated cell death measured through treatment
of melanoma cells with leelamine in the absence
or presence of pan-caspase inhibitor, z-VAD-fmk.
apoptosis inducer (Fig. 2.11)
(194). This observation
Figure 2.11
indicated that early phase of
leelamine mediated cell death
was triggered through a
caspase independent process
despite the fact that caspases
are activated downstream in the
cell death process.
Since various caspaseindependent cell death
programs require de-novo
Figure 2.11: DNA laddering assay showing
absence of DNA fragmentation following
leelamine treatment. Staurosporine was used as
a positive control for apoptosis-mediated DNA
fragmentation.
71
protein synthesis, the effect of inhibition of protein synthesis on leelaminemediated cell death was examined next (195). Co-treatment of UACC 903
melanoma cells with cycloheximide, a protein synthesis inhibitor, did not affect
viability of leelamine treated cells, suggesting that de-novo protein synthesis is
not required for leelamine
mediated cell death (Fig. 2.12-A).
Figure 2.12
Lysosomotropic
compounds can induce caspaseindependent cell death through
lysosomal membrane
permeabilization leading to
leakage of cathepsins (lysosomal
peptidases) into the cytosol (119,
192). To examine whether
leelamine caused lysosomal
membrane permeabilization,
lysosomal peptidase inhibitors,
ALLN (Calpain/CathepsinInhibitor1), ALLM
(Calpain/Cathepsin-Inhibitor 2),
leupeptin (cysteine, serine and
threonine peptidase inhibitor),
Figure 2.12: Leelamine mediated cell death
does not involve de-novo protein synthesis or
leakage of proteases from lysosomes. A, Graph
showing viability of UACC 903 cells upon
leelamine treatment with or without increasing
concentrations of protein syntheses inhibitor,
cycloheximide; B, Viability of UACC 903 cells
after 24 hours cotreatment of various protease
inhibitors, AEBS, 100M; Pepstatin A, 50 M;
Leupeptin, 50 M; ALLM, 25 M; ALLN, 10 M
with leelamine.
Pepstatin-A (aspartic proteinase inhibitor) and AEBSF (irreversible serine
72
protease inhibitor) were used. However, none of these inhibitors were able to
alter leelamine mediated cell death suggesting that lysosomal membrane
permeabilization is not involved in leelamine mediated cell death (Fig. 2.12-B).
Since disruption of mitochondrial function plays key roles in the execution
of several cell death programs, mitochondrial membrane potential (∆Ψm) of
UACC 903 cells was measured after leelamine treatment (196). In the positive
control, 20 µmol/L FCCP, a very potent un-coupler of oxidative phosphorylation
in mitochondria significantly hindered ∆Ψm of treated cells. Leelamine treatment
also decreased the ∆Ψm of treated melanoma cells in a time and dose
dependent manner (Fig. 2.13). Mitochondrial membrane potential was found to
be diminished in more than 70%
Figure 2.13
of the cells when melanoma cells
were treated with 3 µmol/L
leelamine for 24 hours,
suggesting that leelamine triggers
significant perturbations in
mitochondrial stability.
Figure 2.13: Histogram showing m following
leelamine or FCCP (positive control) treatments.
Bcl-2-associated X protein (BAX) and BH3 interacting-domain death agonist
(BID) are two well-studied apoptosis regulators that induce the opening of the
mitochondrial voltage-dependent anion channels following apoptotic signals
(197). The potential involvement of BAX in leelamine mediated cell death was
investigated through comparing wild-type HCT116 cells with BAX knock-out
HCT116 (HCT116 BAX−/−) cells. Interestingly, BAX knockout cells were more
73
resistant to leelamine mediated cell
Figure 2.14
death in contrast to their wild type
counterparts (Fig. 2.14). However,
contradictorily pharmacological
inhibition of Bax channels through
BAX-Inhibiting Peptide, V5; inhibition
of Bid activity through BI-6C9; or
inhibition of apoptosome formation
by NS3694 were not able suppress
Figure 2.14: Viability of wild-type or BAXknockout HCT116 cells after 24 hours of
treatment with increasing concentrations of
leelamine.
leelamine mediated cell death (Fig.
2.15).
Figure 2.15
2.4.4 Blockage of autophagic
flux mediated by leelamine.
Lysosomotropic compounds can
block autophagic flux through
alkalinization of the lysosome to
trigger caspase-independent cell
death (119, 192). To investigate
whether leelamine-mediated cell
Figure 2.15: Viability of UACC 903 cells after
24 hours cotreatment of leelamine with
various apoptotic signal inhibitors, BAX
Inhibiting Peptide V5 (BIP-V5), Bid Inhibitor
BI-6C9, apoptosome inhibitor NS3694.
death involves inhibition of autophagic flux, autophagy deficient ATG5 knockout
mouse embryonic fibroblasts (MEF) cells were compared with wild-type
counterparts following leelamine treatment. ATG5 knockout MEFs showed
partial resistance to leelamine mediated cell death suggesting that inhibition of
74
autophagic flux played an important role
in this process (Fig. 2.16). Interestingly,
Figure 2.16
ATG5 knockout MEF cells did not
undergo vacuolization upon leelamine
treatment indicating a relationship
between vacuolization and autophagy
(Fig. 2.16). Thus, leelamine-mediated
cell death was associated with its
lysosomotropic property and partially
Figure 2.16: Viability of wild-type or atg5knockout MEF cells after 24 hours of
treatment with increasing concentrations
of leelamine. Images showing that
leelamine did not cause vacuolization of
ATG5-knockout MEF cells.
involved inhibition of autophagic flux.
2.4.5 Activity of leelamine was not mediated by PDKs or Cannabinoid
receptors.
Pyruvate dehydrogenase kinases (PDK) and cannabinoid receptors (CBR)
are reported targets of leelamine (181, 182, 198). To determine whether, the
lysosomotropic property of leelamine mediated cell death did not involve these
proteins, pharmacological agents or RNA interference was used to inhibit these
proteins. siRNA-mediated knockdown of PDK isoforms or dichloroacetatemediated inhibition of PDKs did not affect the viability of melanoma cells
suggesting that these proteins were not mediating the effect (Figs. 2.17 A and
B). Agonists of cannabinoid receptors have also been reported to promote
apoptotic cell death in melanoma cells (199); however, co-treatment of neither
CB1 inverse antagonist AM251, nor CB2 inverse antagonist AM630, nor a
combination of them, protected UACC 903 cells from leelamine mediated cell
75
death (Fig. 2.18-A).
Figure 2.17
Consistent with these
observations, siRNAmediated knockdown of
cannabinoid receptors also
did not alter the activity of
leelamine (Fig. 2.18-B).
Thus, none of the reported
Figure 2.17: A and B, Graphs showing that neither siRNA
mediated knockdown of PDK isoforms nor DCA treatment
hinders UACC 903 cell viability indicating that leelamine
mediated cell death is not tied to activity of the PDK
isoforms.
targets of leelamine were found to mediate cancer cell killing.
Figure 2.18
Figure 2.18: A, Graph showing viability of UACC 903 cells following
treatment with increasing concentrations of cannabinoid (CB) receptor inverse
agonists (AM251 and AM630) in the presence or absence of leelamine; B,
Viability of UACC 903 cells transfected with siRNA against CB receptors
followed treatment with leelamine or DMSO.
2.4.6 Leelamine induced intracellular cholesterol accumulation and
altered cholesterol subcellular localization.
Phenotypes induced by some lysosomotropic compounds (e.g. U18666A and
imipramine) resemble those occurring with Niemann Pick Type C (NPC1)
disease (200, 201). NPC1 is a well-studied lysosomal storage disease, which
76
leads to neurodegeneration and cell death through lysosomal/endosomal
accumulation of unesterified cholesterol due to loss-of-function mutations in NPC
proteins (202). These compounds also lead to accumulation of endosomal
cholesterol upon treatment (200, 201). To investigate whether leelamine
triggered a phenotype similar to NPC1, cholesterol localization following
leelamine treatment was analyzed via Filipin-III staining. Under steady-state
conditions, UACC 903 cells stained weakly for Filipin at the periphery of the
nucleus (Fig. 2.19-A). 3 mmol/L leelamine significantly altered cholesterol
localization and induced a staining pattern, which was comparable to that
occurring following U18666A treatment (Fig. 3A). At higher concentrations (5
mmol/L) cholesterol accumulation was more significant and observed as large
Figure 2.19
Figure 2.19: Leelamine-mediates intracellular cholesterol accumulation. A, florescence
microscopy of cholesterol localization following leelamine or U18666A treatments. βcyclodextrin–mediated depletion of cholesterol prevents leelamine-mediated intracellular
cholesterol accumulation (right). B, HPTLC showing cholesterol accumulation in
melanoma cells with increasing leelamine concentrations. The numbers under the
cholesterol band show the quantitation of the cholesterol band with respect to the DMSO
treatment; PC, phosphatidylcholine; PE, phosphatidylethanolamine.
77
droplets around the nucleus. In contrast, altered cholesterol localization was not
observed in normal fibroblasts at the 3 mmol/L but was significant at 10 mmol/L.
β-cyclodextrin mediated depletion of cholesterol has been reported to decrease
the toxicity of cholesterol accumulation in NPC1 disease (203). Cotreatment of
β-cyclodextrin prevented intracellular cholesterol accumulation even at high
leelamine concentrations (Fig. 2.19-A). Thin layer chromatography analyses of
the lipid extracts from UACC 903 cells showed an increase in intracellular
cholesterol accumulation following leelamine treatment (Fig. 2.19-B).
To validate the biological significance of leelamine mediated cholesterol
accumulation, β-cyclodextrin was used to deplete cellular cholesterol levels.
Depletion of cholesterol from UACC 903 or 1205 Lu melanoma cells through preor co-treatment with β-cyclodextrin suppressed cell death mediated by leelamine
treatment (Fig. 2.20-A). In addition, electron microscopy analyses of the βcyclodextrin co-treated UACC 903 cells showed that depletion of cholesterol
prevented formation of lipofuscin-like material, membrane whorls and autophagic
vesicles observed following leelamine treatment (Fig. 2.20-B). It is important to
note that, it was the inhibition of cholesterol transport but not the cholesterol
synthesis that lead leads to cell death since statins were not able to induce cell
death in these cell lines (Fig. 2.21).
78
Figure 2.20
Figure 2.20: Leelamine-mediated cell death depends on intracellular cholesterol
accumulation. A, Viability of melanoma cells following leelamine treatment alone or in
combination with co- or pretreatment with β-cyclodextrin. * indicates t-test, p < 0.05 B,
Transmission electron micrographs of leelamine- and β-cyclodextrin–cotreated UACC 903
cells.
2.4.7 Leelamine inhibited cellular endocytosis.
Endosomes are major sorting compartments within cells functioning not only
for the uptake of extracellular material but also
Figure 2.21
for the maintenance of cell signaling through
recycling of membrane receptors (6, 204).
Since, endosomal accumulation of cholesterol
has the potential to disrupt the endocytic system,
the integrity of the system was assessed by
measuring endocytic uptake of Alexa Fluorconjugated transferrin protein (205, 206).
Figure 2.21: Statins as
cholesterol transport inhibitors
are ineffective in inducing death
of UACC 903 melanoma cells.
Fluorescence microscopy analyses showed
robust suppression of endocytosis following leelamine treatment of both UACC
903 and 1205 Lu melanoma cells (Fig. 2.22-A). Depletion of cholesterol through
β-cyclodextrin cotreatment prevented leelamine mediated inhibition of transferrin
79
Figure 2.22
Figure 2.22: Leelamine inhibits cellular endocytosis. A, Fluorescence microscopic
images showing endocytosis of Alexa Fluor–conjugated transferrin protein following DMSO
control or leelamine treatment in the absence or presence of β-cyclodextrine–mediated
cholesterol depletion. B, Flow cytometry–based analyses of Alexa Fluor–conjugated
transferrin protein endocytosis following leelamine treatment. DAPI, 4′,6-diamidino-2phenylindole.
endocytosis. In contrast, although endocytosis of transferrin was restricted in
fibroblasts cells, its inhibition was not seen until the leelamine concentration was
increased to 10 mM (Fig. 2.22-A). Flow cytometry based quantitation of
transferrin signal, confirmed the fluorescence microscopy analyses and displayed
a dose-dependent inhibition of endocytosis (Fig. 2.22-B). 3 µmol/L leelamine
treatment decreased endocytosis positive UACC 903 cells by 68% while 5
µmol/L decreased it by 88%. Collectively these data suggest that leelamine
treatment inhibited cellular endocytosis in cancer cells at 3 µmol/L and required
3-fold higher levels to see a similar effect in normal cells.
80
2.4.8 Leelamine inhibited signaling pathways driving melanoma cell
survival.
Since leelamine disrupted cellular endocytosis, inhibition of this process was
predicted to disrupt key signaling pathways important for melanoma survival.
Therefore, signaling pathways altered following leelamine treatment were
assessed next. Since cycloheximide treatment suggested that protein synthesis
was not involved in the activity of leelamine, the primary effect of the compound
was predicted to occur at the post-translational level. Therefore, to assess these
changes, high-throughput antibody microarray analysis was undertaken using
Kinexus Antibody Microarray Chip 1.3 (Kinexus Bioinformatics Corporation,
Vancouver, Canada). This analysis simultaneously assessed the expression and
phosphorylation status of various cell signaling proteins. Cell lysates were
collected at various time points from 3-24 hours following leelamine or control
treatment and analyzed on the Kinexus arrays. Data was normalized through Zscore transformation and significant alterations were identified by calculation of
Z-ratios between treated samples and corresponding controls (Table 2.4).
Results suggested alterations in the members of receptor tyrosine kinase (RTK)
– AKT signaling pathway (e.g., IGF1R, IRS1, ALK, EPHA1, ERBB2, GSK3, and
FKHRL1) (Fig. 2.23). Analyzes of the data through Ingenuity Pathway Analyses
software suggested that the insulin and PI3K-Akt pathways were the most
prominent pathways that were altered following leelamine treatment (Fig. 2.24).
81
Table 2.4 Alterations in protein expression or activity following leelamine treatment.
DOWN REGULATED
UP REGULATED
Z Ratios
Target
Protein
IRS1
IRS1
IR/IGF1R
P38A
MAPK
PKCL/I
STAT4
GCK
TAU
ERK1/2
HSP90
GFAP
LYN
MAP2K4
BAD
EIF4E
ALK
BCL-XS/L
IKBB
BCL2
DAXX
ERK1/2
GSK3AB
GSK3AB
MOS
DFF35/45
DNAPK
EPHA1
ERBB2
FKHRL1
%CFC
Phospho
Site
Y1179
S312
Y1189/Y1190
3 hr
6 hr
12 hr
24 hr
3 hr
6 hr
12 hr
24 hr
1.50
1.81
1.21
2.95
1.82
1.83
2.38
1.89
1.81
1.45
2.19
0.17
113
142
79
907
307
328
406
324
220
120
288
8
Pan-specific
1.35
5.17
1.95
0.70
90
2654
205
42
1.82
T564
0.55
Pan-specific * 7.70 1.54
Pan-specific * 1.39 * 2.23
1.73
1.50
T548
2.24
Pan-specific 0.01
Pan-specific * -10.8 4.99
S8
-1.07 0.83
Y508
-0.54 -0.86
Pan-specific -2.02 -1.54
S75
-1.27 -2.14
S209
-0.54 -1.69
Pan-specific -1.42 -2.64
Pan-specific * -6.5 -6.51
Pan-specific * -2.33 -7.45
Pan-specific -1.52 -0.54
Pan-specific -1.64 -1.34
Pan-specific -1.69 -1.04
Pan-specific -3.11 -1.35
Pan-specific -2.07 -1.01
Pan-specific -1.93 * -1.87
Pan-specific -0.88 -0.86
Pan-specific -0.74 -1.12
Pan-specific -1.30 -0.76
Pan-specific -1.48 -0.90
T32
-0.99 -0.75
0.80
4.10
7.44
* 2.14
0.89
* -0.48
-1.69
-1.56
-1.18
-1.44
-1.36
-1.75
-3.60
-2.71
-1.93
-2.17
-2.00
-1.88
-1.57
-1.60
-1.95
-2.36
-1.65
-1.98
-3.70
1.66
174
84
99
0.31 11598 108
1162
1.68 2677 5468 38746
-0.62
141
261
298
1.82
-3
509
32
1.51
-99 75219 2736
-2.12
-33
168
-52
-1.99
-18
-35
-29
-0.83
-54
-71
-41
-1.63
-46
-80
-63
-1.74
-24
-68
-54
-1.70
-50
-87
-69
-0.34
-90
-80
-93
-0.06
-37
-100
-56
* -0.66 -44
-34
-53
-2.58
-49
-64
-70
-1.80
-46
-47
-50
-1.88
-72
-59
-53
-0.64
-54
-39
-43
-1.13
-52
-81
-49
-2.49
-29
-47
-53
-1.97
-25
-60
-75
-2.73
-42
-42
-52
-2.36
-46
-47
-55
-1.71
-26
-42
-64
Note: Grey shadowed boxes indicates Z-Ratio > 1.5 or Z-Ratio < -1.5.
Astrix (*) indicates antibody spots which were not reliable due to technical issues.
%CFC: Percentage change from control treatment
163
9
138
-27
138
107
-63
-61
-32
-64
-62
-63
-22
-7
-27
-77
-58
-62
-18
-46
-53
-68
-75
-67
-46
82
Involvement of key
Figure 2.23
proteins that were
downstream of RTK
signaling was
subsequently validated by
western blotting.
Significant suppression of
the active AKT (pAKT)
and STAT3 proteins
(pSTAT3) were identified
Figure 2.23: Leelamine mediated alterations in signaling
pathways. Schematic summary of signaling alterations in
melanoma cells occurring following leelamine treatment
based on Kinexus antibody array analysis.
(Fig. 2.25). Suppression
of several other signaling proteins (e.g. ERK, PRAS40, CREB, p70S6K) in these
pathways have been validated in the manuscript by Gowda et al. in the current
issue of this journal. Phosphorylation
of 4E-BP1, an important regulator of
Figure 2.24
cap-dependent protein translation, was
significantly decreased by leelamine
suggesting that the AKT/mTOR branch
of the cascade was also inhibited
following leelamine treatment (207).
Most importantly, BafA1 co-treatment
reversed the effect of leelamine on
these signaling cascades suggesting
Figure 2.24: Ingenuity Pathway Analyses.
Analyses of the Kinexus protein array data
with IPA software’s default parameters
showing significantly altered signaling
pathways.
83
that these alterations were triggered
Figure 2.25
by the lysosomotropic properties of
this drug (Fig. 2.25).
Figure 2.25: Western blot (WB) analysis of
pAKT (S472), total AKT, 4EBP1 (T70),
pSTAT3(Y705), STAT3, and ERK-2 proteins
in melanoma cells treated with increasing
concentrations of leelamine with or without
BafA1.
2.4.9 Leelamine disrupted receptor tyrosine kinase signaling via
interference with intracellular vesicular transport systems, which was
reversible by cholesterol depletion.
Since protein microarray analysis
suggested alterations in receptor
Figure 2.26
tyrosine kinase signaling, the activities
of 42 different receptor tyrosine kinases
were analyzed using a protein array
that is specific to receptor tyrosine
kinases (Fig. 2.26). Alterations in
tyrosine phosphorylation of several
RTKs, such as decreases in ERBB4
and PDGFR receptors, as well as an
increase in IGF1R and HGFR receptors
Figure 2.26: RTK protein array analysis
showing activity of various RTKs following
leelamine treatment.
84
were observed. However, identified
Figure 2.27
increases in HGFR and IGF1R
phosphorylation were associated
with intracellular accumulation of
these receptors. Western blot
analyses displayed a dose and time
dependent accumulation of HGFR
precursor protein with significant
decrease in mature forms of HGFR
Figure 2.27: Western blot analysis of pAKT
(S472), total AKT, pSTAT3 (Y705), cleaved
PARP, HGFR, IGF1R, and ERK-2 proteins post
leelamine treatment of UACC 903 cells.
and IGF1R receptors (Fig. 2.27).
The precursor form of IGF1R also displayed slight accumulation that was more
significant after 12 hours of leelamine treatment. Accumulations of these
precursor proteins were possibly related to the disruption of the endocytic system
(208).
Figure 2.28
Immunofluorescence
staining of various
RTKs (IGF1R,
PDGFR and TRK
receptors) and IRS1,
an adaptor protein in
Figure 2.28: Immunofluorescence staining showing perinuclear
accumulation (arrow heads) of RTK signaling members (nucleus
marked with dashed circles in treated cells).
INSR/IGF1R-AKT signaling, displayed perinuclear accumulation of these proteins
further supporting inhibition of the intracellular vesicular transport systems (Fig.
2.28).
85
To demonstrate that signaling alterations were induced by disrupted
cholesterol homeostasis, b-cyclodextrin co-treatment was used to deplete
accumulating cholesterol and effects on inhibited signaling pathways were
examined by western
Figure 2.29
blotting (Fig. 2.29). cyclodextrin co-treatment
restored phosphorylation
of Akt and Stat3 proteins,
suppressed accumulation
of IGF1R and HGFR
precursors, inhibited
upregulation of p27
protein, reinstated Cyclin
D1 levels to control
amounts, and decreased
PARP cleavage (Fig.
2.29). Thus, these
observations suggested
Figure 2.29: Western blot analysis shows restoration of
leelamine mediated signaling alterations in pAKT
(S472), total AKT, pSTAT3(Y705), STAT3, CDKN1B
(P27), CCND1 (Cyclin D1), cleaved PARP, HGFR, and
IGF1R proteins following cholesterol depletion using βcyclodextrine (β-cyclo) treatment. ERK, extracellular
signal-regulated kinase; CDK, cyclin-dependent kinase;
RB, retinoblastoma; IKK, inhibitor of IκB kinase; FGFR,
fibroblast growth factor receptor.
that leelamine mediated
signaling alterations were initiated by disruption of cholesterol homeostasis
leading to shutdown of cellular endocytosis.
86
2.5 Discussion
In this study, leelamine has been identified as a lysosomotropic compound
that disrupts intracellular cholesterol homeostasis to induce cell death more
selectively in melanoma compared to normal cells. Cholesterol is an essential
component of cell membranes and occupies vital roles in intracellular transport
and signaling systems (209, 210). Its homeostasis is strictly regulated since
proper functioning of several organelles such as golgi, endoplasmic reticulum
and mitochondria rely on cholesterol abundance in the membranes of these
organelles (211, 212). Late endosomes and lysosomes have an important role in
maintaining this homeostasis. Cholesterol that is derived from the membranes of
the endocytotic vesicles and cholesteryl esters that are derived from the imported
LDL molecules or from the autophagic flux, converge on the lysosomal cell
compartments where cholesteryl esters are hydrolyzed to free cholesterol
molecules (24, 42, 212). Excess free cholesterol should be either esterified in
the endoplasmic reticulum or removed from the cell through the efflux pathway
(212). NPC1 and NPC2 proteins function together to export free cholesterol from
the lysosomal-endosomal cell compartments and loss-of-function mutations in
these genes, give rise to accumulation of free cholesterol in the lysosomalendosomal compartments (213). Since, lysosomes are a convergent point for
the endocytic and autophagic pathways, cholesterol accumulation potentially
shuts down both of these pathways.
87
Inhibition of autophagic flux is potentially detrimental to cells due to
insufficient disposal of toxic protein aggregates and inadequate recycling of
unnecessary cellular components to maintain intracellular homeostasis (192).
Recent studies link autophagy to cholesterol homeostasis (42). Elrick et al.
(2012) identified autophagy as an important source of accumulated cholesterol in
NPC1 disease (43). In their study, ATG5-null-MEF cells accumulated less
cholesterol in the lysosomal-endosomal compartments upon U18666A treatment.
In agreement with this observation, ATG5-null-MEF cells were more resistant to
leelamine-mediated cell death compared to wild-type counterparts. These
observations suggested autophagy as an important source for accumulated
cholesterol in leelamine treated cells. Moreover, endosomal cholesterol
accumulation not only inhibits autophagic flux but can also induce autophagy
itself (214). Leelamine treatment dose dependently increased LC3BII to LC3BI
ratio as well as decreased the phosphorylation of 4EBP1, suggesting the
sustained inhibition of mTOR signaling and induction of autophagy. Thus, the
autophagic process creates a vicious circle between cholesterol accumulation
and autophagy induction in which endosomal cholesterol accumulation triggers
autophagy and autophagy subsequently induces further endosomal cholesterol
accumulation, which is summarized in Fig. 2.30.
In contrast to autophagy, inhibition of endocytosis disrupts intracellular
signaling processes since receptor mediated signaling depends on endocytosis
and endocytic recycling of internalized receptors to the cell membrane (215).
RTKs are an important family of membrane receptors that are regulated through
88
receptor-mediated endocytosis.
Figure 2.30
Upon ligand binding and
activation, they are internalized
through endocytosis and
transported to the late
endosomes where they are
either recycled back to the
membrane or directed to the
lysosomes for degradation
(215). This process is
important for down-regulation
Figure 2.30: Schematic summary of cellular
alterations mediated by leelamine in melanoma
cells.
of initiated signal transduction
and also required for transduction of various signals from the cell periphery to the
nucleus (216).
Receptor tyrosine kinases play vital roles in the progression of several
cancers including melanoma (217). Hyper-activation of several RTKs such as
PDGFR, ERBB4, AXL, IGF1R can contribute to mutant BRAF inhibitor resistance
(179). They induce PI3K/Akt, Stat and MAPK signaling cascades in response to
extracellular factors. Leelamine mediated disruption of RTK signaling led to the
inhibition of these three signaling cascades. Leelamine mediated inhibition of
MAPK signaling was not very prominent in contrast to Akt3 and Stat3 pathway
shutdown since the constitutive activation of the MAPK cascade is triggered by
mutant V600EB-Raf protein and does not require RTK activity (218). Silencing of
89
AKT activity significantly suppresses melanoma tumor growth (219). Cell lines
with over-activated Akt signaling show increased sensitivity to the inhibition of
PI3K/AKT signaling pathway (220). Since leelamine inhibits AKT signaling, it is
effective for killing cells in which the PI3 kinase pathway is activated. Receptor
tyrosine kinases also mediate induction of Stat signaling, which is reported to be
essential for the transforming activity of the various RTKs such as IGF1R (221).
Under steady state growth conditions, activity of STAT proteins is transient and
tightly regulated by various signaling pathways (222). However, STATs are
constitutively activated and promote tumor development in several malignancies,
including melanoma (223). Niu et al. (2002) reported constitutive activation of
STAT3 in more than 80% of melanoma cell lines in which hyper-activated Stat3
inhibits apoptotic pathways through induction of BCL2L1 (BCL-XL) expression
(224). Our studies showed that leelamine significantly hinders Stat3 activity and
decreases Bcl-XL protein levels as observed in Kinexus array analysis and in
subsequent validation studies.
In summary, this study identifies leelamine as a lysosomotropic cholesterol
transport inhibitor that triggers cell death through cholesterol accumulation in
lysosomal/endosomal cell compartments. The accumulated cholesterol inhibits
autophagic flux, disrupts receptor mediated endocytosis and subsequently
inhibits signaling pathways that are key to melanoma development. These
findings not only suggest significant potential of leelamine for the treatment of
melanoma but also identify a new approach for induction of melanoma cell death
and possibly that of other cancer types.
90
2.6 Acknowledgements
We are thankful to Dr. Wolfgang Muss, Dr. Patrice Petit, Dr. Ken Hastings, Dr.
Goodwin Jinesh and Dr. Jayanta Debnath for their guidance in interpretation of
the electronmicrographs.
91
CHAPTER 3
Intracellular Cholesterol Transport Inhibitors as
Potential Therapeutic Agents for Melanoma
92
3.1 Abstract
Recently, a lysosomotropic small compound, leelamine has been identified as
a chemotherapeutic agent against melanoma. Leelamine was shown to act as
an intracellular cholesterol transport inhibitor suggesting that cholesterol
homeostasis plays a crucial role in melanoma survival. This study explores the
chemotherapeutic potential of functional inhibitors of acid sphingomyelinase
(FIASMA) as cholesterol transport inhibitors. Similar to leelamine, these
compounds were lysosomotropic molecules that accumulate inside the acidic
organelles such as lysosomes. This accumulation inhibits cholesterol egress
from late endosomal/lysosomal cell compartments leading to disrupted
autophagic flux and cellular endocytosis. Inhibition of lysosomotropic
accumulation of FIASMAs through Bafilomycin-A1 treatment or depletion of
cholesterol through β-cyclodextrin treatment attenuated the cell death mediated
by these agents. As a consequence of inhibition of cellular endocytosis, activity
and localization of receptor tyrosine kinases were altered and their downstream
effectors, AKT and STAT3 signaling cascades, that are two proteins required for
melanoma development were inhibited. Cell death initiated by lysosomal
cholesterol accumulation was suggested to be related to BAX activity and
mitochondrial dysfunction as evidenced by increased resistance of BAX knockout
HCT 116 cells to FIASMAs and dose-dependent depolarization of mitochondrial
membrane potential following FIASMA treatments.
In in-vivo studies, two of the FIASMAs, Perphenazine and Fluphenazine, led
to an up to 60% decrease in the growth of xenografted tumors of three different
93
melanoma cell lines. Since, including these two agents, many of the FIASMA
compounds are generic tricyclic antidepressants or antipsychotics with wellknown toxicity profiles, the findings of this study might open new perspectives in
cancer treatment through repurposing these drugs as anti-cancer agents.
94
3.2 Introduction
Between the ages of 40 and 80, cancer is the leading cause of death in the
United States (225). In 2013, more than 1.6 million people were expected to get
cancer and one third projected to die from the disease. Despite billions of dollars
spent on research to identify effective cancer therapeutics, only a 1.7 %
decrease in cancer related death rates reported between 2005 and 2009.
Incidence and mortality rates related to the most dangerous type of skin cancer,
malignant melanoma continues to rise steadily (226). In 50 to 60% of the
melanomas, BRAF is activated by a point mutation to drive melanoma
development (227). In recent years, V600EBRAF targeted therapeutics have been
developed with short term therapeutic efficacy due to rapid development of
resistance. Consequently, there remains a need for the development of new
melanoma therapeutics or approaches to overcome the development of recurrent
resistant disease.
A recent report has detailed how a natural product library was screened to
identify leelamine as a chemotherapeutic agent for melanoma (171). Leelamine
was shown to be a lysosomotropic compound that triggered cholesterol
accumulation inside acidic organelles such as lysosomes and endosomes (44).
This accumulation led to the disruption of autophagic flux and cellular
endocytosis, which are crucial processes for recycling dysfunctional cellular
components and for signaling pathways that are initiated from tyrosine kinase
receptors, respectively (228, 229).
95
Cholesterol accumulation inside acidic organelles also occurs in a lysosomal
storage disease called Niemann–Pick type C (NPC) (230). In this disorder, loss
of functional NPC1 leads to lysosomal cholesterol accumulation. Importantly,
this accumulation is accompanied by an increase in lysosomal sphingomyelin
levels due to decreased acid sphingomyelinase (ASM) activity, which is a
lysosomal enzyme that catalyzes the breakdown of sphingomyelin to ceramide
and phosphorylcholine (231). Recently, screening of a chemical library has
allowed identification of a class of compounds that are able to inhibit ASM
enzyme (231, 232). These compounds were called as functional inhibitors of
acid sphingomyelinase (FIASMA) since they do not inhibit the enzyme directly.
Among these are several tricyclic antidepressants such as Nortriptyline,
Amitriptyline, Desipramine and Imipramine. Interestingly, similar to leelamine,
Imipramine is also known to induce lysosomal cholesterol accumulation and
trigger NPC disease phenotype (233).
Since ASM activity is inhibited in NPC disease and since imipramine is known
to induce a NPC phenotype as well as inhibiting ASM; and since leelamine kills
melanoma cells through inhibiting intracellular cholesterol transport, it was
hypothesized that FIASMAs would kill cancer cells through inducing lysosomal
cholesterol accumulation. In this study, 42 of acid sphingomyelinase inhibitors
were screened for their potential activity against melanoma cell lines. They were
found to trigger cell death in BRAF mutant melanoma cell lines at 2 to 5 fold
lower concentrations compared to normal fibroblast cells. Similar to leelamine,
cell death was initiated by inhibition of cholesterol egress from lysosomes which
96
impaired cellular endocytosis and autophagic flux. As a consequence Akt and
Stat3 signaling cascades, two important melanoma drivers that are downstream
of tyrosine kinase receptors, were suppressed. More importantly, the efficacies
of four acid sphingomyelinase inhibitors (Nortriptyline, Perphenazine,
Fluphenazine and Desipramine) were tested on xenografted melanoma tumor
development and following oral administration found to cause up to a 60 %
inhibition of tumor development.
Most of the FIASMAs were compounds approved as antidepressant,
antipsychotic or antihistamine drugs. In the literature, anti-cancer activity of
some of these agents have been reported and also supported by large-scale
case-control studies (10-13, 85, 91). The findings of present study suggest that,
mechanistically these compounds display anti-cancer activity through disrupting
intracellular cholesterol transport and consequently inhibiting autophagic flux and
cellular endocytosis. Eventually this leads to cancer cell death through inhibition
of multiple pathways to which the cancer cells are addicted. As most of these
agents are generic drugs with well-known toxicity profiles, the findings of this
study could open new perspectives for repurposing these drugs as anti-cancer
agents.
97
3.3 Materials and Methods
3.3.1 Cell lines, culture conditions and plasmids.
Metastatic melanoma cell line UACC 903 was provided by Dr. Mark Nelson
(University of Arizona, Tucson, AZ), WM164M and 1205 Lu cell lines were
provided by Dr. Herlyn (Wistar Institute, Philadelphia, PA), human fibroblast cell
line FF2441 was provided by Dr. Craig Myers (Penn State College of Medicine,
Hershey, PA), 451Lu, 451LuR cell lines were provided by Xiaowei Xu (University
of Pennsylvania, Philadelphia, PA), C8161.Cl9 cell line was provided by Danny
R. Welch (University of Kansas, Kansas City, KS). Wild-type and BAX knock-out
(HCT116BAX−/−) HCT116 human colon cancer cell lines were provided by Dr.
Wafik El-Deiry (Penn State College of Medicine, Hershey, PA). All cell lines were
maintained in DMEM (Invitrogen, Carlsbad, CA) supplemented with 1%
GlutaMAX (Invitrogen) and 10% FBS (Hyclone, Logan, UT) in a 37°C humidified
5% CO2 atmosphere incubator. Melanoma cell lines were periodically monitored
for genotypic characteristics, phenotypic behavior and tumorigenic potential to
confirm cell line identity. Autophagosome accumulation was assessed using a
GFP-tagged LC3B expressing UACC 903 cell line that was generated using
pBABE-puro mCherry-EGFP-LC3B plasmid (Addgene plasmid #22418) (183).
3.3.2 Cell viability assay, drug treatments and IC50 determination.
Viability of cells following compound treatments (see Table 3.1 for
compounds and their sources) was measured through the MTS assay
(Promega, Madison, WI) as described previously (184). Briefly, cells that were
plated in 96-well plates and grown up to 70 to 80% confluency were treated with
98
either vehicle control or increasing concentrations of investigated compound. 24
h later MTS assay was performed and the IC50 values for each compound for
respective cell lines were calculated with GraphPad Prism version 4.01
(GraphPad Software). In drug co-treatment studies, investigated compounds
were treated simultaneously and 24 hours later, MTS assay was performed.
Table 3.1: Compounds and sources
Compound Name
Bafilomycin A1
ß-cyclodextrin
z-VAD fmk
TRAIL
ALLN (Calpain Inhibitor I)
ALLM
Pepstatin A
AEBSF
Leupeptin
NS3694
U-18666A
Filipin-III
Leelamine
IM-54
Necrostatin-V
Company
LC Labs, Woburn, MA
Sigma-Aldrich, St. Louis, MO
Tocris, Bristol, UK
R&D Systems, Minneapolis, MN
Cayman Chem , Ann Arbor, MI
Enzo Life Sciences , Farmingdale, NY
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Sigma-Aldrich, St. Louis, MO
Cayman Chem , Ann Arbor, MI
Cayman Chem , Ann Arbor, MI
Tocris, Bristol, UK
Catalog Number
B-1080
C4805
2163
375-TEC-010
14921
BML-PI100
9000469
14321
14026
N7787
10009085
10009779 / 70440
2139
3.3.3 Mitochondrial membrane potential, caspase and caspasedependence assays.
Mitochondrial membrane potential of cells was measured through the TMRE
Mitochondrial Membrane Potential Assay Kit (Abcam, Cambridge USA)
according to the kit’s protocol. Caspase 3/7 activity was measured using a
fluorogenic substrate Ac-DEVD-AFC (Ex. 400 nm, Em. 505 nm) according to the
protocol supplied with a Caspase-3 Inhibitor Screening Assay Kit (Merck KGaA,
Darmstadt, Germany). Caspase-dependence of cell death was assessed by pre-
99
treatment of cells with pan-caspase inhibitor z-VAD-fmk (20 µmol/L) for 1 hour
prior to drug treatments. TRAIL (50 ng/mL) treatment was used as a positive
control to induce caspase dependent cell death. 24 hours after treatments, cell
viability was measured by MTS assay as described above.
3.3.4 Annexin V- Propidium Iodide staining.
To determine the effect of cholesterol transport inhibitors on apoptosis,
Annexin V-APC / Propidium Iodide staining assay kit (eBioscience, San Diego,
CA) was used. Briefly, cells were grown in 6-well plates up to 80% confluency
and treated with indicated agents for 24 hours. Cells were processed according
to manufacturer’s protocol and flow cytometry analysis was performed
immediately on flow cytometry using a FACS Calibur (Becton Dickinson,
Mountain View, CA).
3.3.5 Cholesterol localization assay.
Localization of intracellular cholesterol was detected through Filipin III staining
of cells via Cayman’s Cholesterol Cell-Based Detection Assay Kit (Cayman
Chemical, Ann Arbor, MI). Lysosomal/late endosomal localization of cholesterol
was detected through co-localization of LAMP1-RFP and Filipin III signals using
iVision software (BioVision Technologies, Exton, PA). RFP tagged LAMP1
expressing UACC 903 cell line was generated using LAMP1-mRFP-FLAG
plasmid (Addgene plasmid #34611) (234).
100
3.3.6 Evaluation of cellular endocytosis.
Endocytic capacity of cells was measured through Alexa Fluor 488
conjugated transferrin protein (Molecular Probes, Eugene, OR) as described
previously (44). Briefly, cells were plated in to chamber slides (or 6-well plates
for flow cytometry) and treated with compounds for 3 to 4 hours. Next, cells were
incubated 30 minutes with Alexa Fluor 488 conjugated transferrin protein (5
μg/mL) without changing the media. Cells were then washed with PBS and fixed
with 4% paraformaldehyde for fluorescence microscopy analysis (or trypsinized,
and collected for flow cytometry analysis).
3.3.7 Western blot analysis.
1-2 million melanoma cells were plated in 100 mm culture dishes and grown
to 75-90% confluency. After drug treatments at indicated time points, cells were
harvested in RIPA buffer containing protease and phosphatase inhibitors (Pierce
Biotechnology, Rockford, IL). BCA Assay from Pierce (Rockford, IL) was used to
quantitate the amount of protein in collected cell lysates and 30 μg of protein per
lane were loaded onto a NuPage gel (Life Technologies). Following
electrophoresis, proteins were transferred to PVDF membrane and blots were
probed with antibodies according to supplier’s recommendations (for detailed
antibody information see Table 3.2). Enhanced chemiluminescence (ECL)
detection system (Thermo Fisher Scientific, Rockford, IL) was used to develop
immunoblots.
101
Table 3.2: Antibodies and sources
Antibody
Akt (Total Akt1/2/3)
Phospho-Akt
ERK 2
Phospho-p44/42 MAPK
BAX
LC3B
Phospho-STAT3 (Y705)
STAT3
IGF-1RB (C-20)
HGFR (C-28)
PDGF Receptor β (28E1)
SQSTM1/p62
Phospho-PRAS40
PRAS40
Cathepsin B
Company
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Santa Cruz Biotechnology, Santa Cruz, CA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Cell Signaling Technology, Danvers, MA
Santa Cruz Biotechnology, Santa Cruz, CA
Catalog Number
9272
9271
sc-1647
9101
2772
2775
9145
4904
sc-713
sc-161
3169
5114
2997
2610
sc-6493
3.3.8 Immunofluorescence analyses.
Localization of cells IGF1R was measured through immunofluorescence
staining of UACC 903 cells using IGF-IRβ Antibody (C-20) (Santa Cruz
Biotechnology, Santa Cruz, CA). Briefly, cells were plated in to chamber slides
and grown up to 80 to 90% confluency, were treated with indicated compounds
for 24 hours. Cells were then washed with PBS, fixed with 4% paraformaldehyde
(15 min), rinsed three times in 1X PBS (5 min each), blocked 60 minutes in
PBST with 1% BSA, incubated overnight with primary antibody (1:100 dilution in
blocking buffer). Next, cells were rinsed again 3X and incubated for 1 hour with
fluorochrome-conjugated secondary antibody (1:1000 in blocking buffer). Cells
were then rinsed 3X, mounted on coverslips and analyzed by fluorescence
microscopy.
102
3.3.9 Animal studies.
All animal experiments were undertaken according to protocols approved by
the Institutional Animal Care and Use Committee at The Pennsylvania State
University. Xenografted tumor formation was measured in athymic-Foxn1-/(nude) mice (Harlan Laboratories, Indianapolis, IN). One million cells were
collected in 0.2 ml of 10% FBS supplemented DMEM to inject subcutaneously
above both the left and right rib cages of 4- to 6-week-old female mice. Six days
post cells injections when tumor size reached ∼100 mm3, animals were randomly
separated into four groups (three experimental and control). Experimental group
mice were orally administered with 50 mg/kg. Nortriptyline and Desipramine was
given alternate days while Perphenazine was administered at 4 days interval due
to the symptoms associated with drowsiness which is one of the common side
effect of this compound. Perphenazine and Nortriptyline were dissolved in
glyceryl trioctanoate, while Fluphenazine and Desipramine were dissolved in
water. Drugs were administered directly into the stomach of mice via oral
gavage (100 uL per treatment). Dimensions of developing tumors were
measured on alternate days by using calipers.
3.3.10 Statistical analysis.
The statistical analysis was performed using the unpaired Student t test. A P
< 0.05 was considered statistically significant. * P < 0.05; ** P < 0.01; *** P <
0.001. In graphs error bars represents ± SEM.
103
3.4 Results
3.4.1 Identification of compounds that kill cancer cells by inhibiting
lysosomal cholesterol transport.
Recently, a compound library screening has identified 72 compounds as
functional inhibitors of lysosomal acid sphingomyelinase enzyme (231, 232). To
test whether these compounds display similar anti-melanoma activity as
leelamine, a lysosomotropic compound that induces melanoma cell death by
inhibiting intracellular cholesterol transport, IC50 values for killing melanoma cells
compared to normal fibroblasts was measured. Seven different melanoma cell
lines harboring various combinations of V600EBRAF mutation and PTEN deletion
were selected for this study as these mutations are important drivers of the
melanoma development to activate the MAP and PI3 kinase pathways,
respectively.
UACC 903 and 1205Lu cells harboring mutant BRAF and having PTEN
deletion, had significantly lower (paired t-Test, p<0.001) IC50 values compared to
wild-type PTEN (C8161 Cl.9, MelJuSO) containing melanoma cell lines or normal
fibroblasts (FF2441) (Table 3.3 and Fig. 3.1). Average IC50 values for both
UACC 903 and 1205 Lu cells were three fold lower than normal fibroblasts. In
contrast, wild-type BRAF/ wild-type PTEN cell line (C8161 Cl.9) or
V600E
BRAF/wild-type PTEN cell lines (WM164 and 451Lu) were less sensitive to
functional inhibitors of acid sphingomyelinases and IC50 values for these cell lines
were not significantly different in contrast to the normal fibroblasts (FF2441).
104
TABLE 3.3
9.6
91.6
35.2
12.5
38.9
78.7
34.8
48.0
27.4
24.6
68.0
92.1
90.4
44.2
192.5
25.2
49.7
21.7
24.6
94.3
98.6
184.3
41.9
117.3
7.4
18.1
NA
62.5
15.0
6.7
50.5
63.0
56.7
41.3
12.5
36.4
8.4
26.2
8.6
23.9
33.6
43.2
40.7
2.1
2.5
6.7
27.3 36.3 96.3
11.9 12.8 34.3
5.7
6.7 19.8
14.8 11.4 41.4
53.8 70.0 72.3
16.4 15.0 38.8
15.8 8.9 17.9
13.8 16.0 24.6
13.2 11.6 36.5
22.7 34.6 84.0
37.2 39.1 >120
20.6 16.8 66.4
21.0 19.6 55.7
40.3 52.6 71.7
8.7
9.5 23.1
7.6 14.5 NA
7.1
7.7 19.4
10.5 9.5 21.7
28.6 21.4 75.8
44.8 62.7 180.0
41.0 42.3 95.2
13.0 13.4 39.6
42.1 110.4 >120
2.6
3.8 11.3
5.2
4.9 18.1
8.9
NA
NA
14.9 13.2 44.5
6.2
8.0 18.4
4.6
5.2
9.2
9.7
9.3 23.2
28.6 36.6 80.1
17.4 33.5 74.3
10.8 18.7 48.6
6.6
2.0 14.9
8.5
8.4 18.7
6.5
5.3 12.9
16.7 15.4 20.7
4.6
3.9
7.4
11.6 8.6 14.4
10.2 9.8 23.2
12.4 12.2 37.7
33.3 28.0 71.7
6.5
70.9
20.8
25.2
49.4
76.7
23.2
34.8
22.6
25.3
66.9
69.2
5.6
55.1
17.7
19.7
37.7
43.4
22.7
28.0
12.9
17.3
52.5
42.2
50.1
64.1
41.8
37.7
75.0
34.5
91.8
29.4
75.2
25.9
37.0
25.2
NA
15.2
45.1
32.6
30.4
26.1
19.1
24.5
21.1
50.4
88.4
86.3
39.0
170.8
11.0
10.0
NA
24.9
16.6
13.4
15.2
54.1
48.4
35.9
9.1
25.4
13.2
30.3
4.0
11.9
18.0
22.3
46.1
50.4 39.3
93.3 57.2
79.0 67.3
22.3 25.3
>120 144.0
44.2 7.5
19.2 14.5
NA
NA
48.0 23.5
24.3 13.5
14.6 13.5
17.9 10.9
58.7 53.3
57.9 40.2
50.8 31.1
5.9
4.9
30.0 23.6
14.8 14.0
26.4 23.1
11.8 7.7
14.5 10.6
16.6 12.5
37.4 20.8
50.1 33.9
+++
++++
+++
+++
+++
+
++
+
+
+++
++
+++
+++
+++
+++
+++
++++
+++
++-+++
++
+++
+++
+
++
+++
++++
+++
++
+++
+++
++
++
+++
+++
+++
++
+
++++
++
+++
+
++++
+++
+++
+
+++
+++
+
+++
+++
++++
+++
++++
+++
+++
+++
++++
+++
++
++++
+++
+++
+
++++
+++
++
+++
++
++
+++
+++
+++
++
+
++++
+++
+++
+++
+
9.9
9.8
9.5
8.8
9.1
9.5
9.2
9.8
9.3
9.2
9.8
8.1
5.2
4.8
1.6
5.4
5.8
4.2
4.5
5.1
6.5
4.9
4.6
4.4
27.6
3.2
99.9
42.3
24.1
12.5
6.5
3.2
12.5
6.5
3.2
3.2
10.0
3.9
15.3
9.7
9.8
4.0
3.8
24.9
12.5
10.1
5.8
12.0
9.8
8.5
4.2
3.5
21.3
26.7
8.2
4.0
30.0
9.2
7.8
9.2
10.5
7.5
10.3
9.8
9.8
10.5
9.8
9.0
8.2
9.2
9.1
10.5
8.6
9.9
10.1
8.8
9.0
8.9
8.4
9.2
8.8
2.8
3.4
4.3
4.4
3.7
5.2
5.2
3.7
4.4
3.2
7.3
3.7
3.9
4.3
4.5
3.8
5.2
5.3
6.4
6.5
5.5
4.7
4.8
4.8
56.8
35.9
6.5
12.0
8.2
37.4
67.5
35.3
12.0
39.7
23.5
30.0
6.5
6.5
12.0
40.5
12.0
32.3
12.5
43.7
6.5
9.7
6.5
37.4
ASM
ACTIVITY
9.5
64.5
25.8
18.0
21.1
75.0
22.7
17.5
21.5
24.1
53.5
>120
-cyclo
dextrin
PSA
Leelamine
Amitriptyline
Amlodipine
Astemizole
AY9944
Benztropine
Chlorpromazine
Chlorprothixene
Clomiphene Citrate
Clomipramine
Cyclobenzaprine
Cyproheptadine
Desipramine
Desloratadine
Doxepin
Fendiline
Fluoxetine
Flupenthixol
Fluphenazine
Fluvoxamine
Hydroxyzin
Imipramine
Maprotiline
Mebhydrolin
Mepacrine
Mibefradil
Norfluoxetine
Nortriptyline
Paroxetine
Penfluridol
Perphenazine
Promazine
Promethazin
Protriptyline
Sertindole
Sertraline
Suloctidil
Tamoxifen
Terfenadine
Thioridazine
Trifluoperazine
Triflupromazine
Zolantidine
Baf. A1
Chemical
Properties
logP
WT
Degree of
Recovery
pKa
MUT MUT
451LuR
WT
451Lu
BRAF
WT
WT
WT
MUT MUT MUT
WM164M
WT
C8161.Cl9
DEL
1205Lu
DEL
UACC 903
PTEN
FF2441
Mut.
Status
IC50 values for human cell lines
WT
NA
11.7
12.0
14.3
22.1
12.7
42.4
22.4
21.8
13.0
26.2
22.2
15.6
21.9
46.6
25.2
13.0
18.2
16.5
37.4
43.0
32.6
13.5
41.9
44.3
20.8
22.5
13.3
31.7
22.0
20.1
33.6
32.2
12.7
12.0
12.3
21.9
4.1
21.8
10.4
8.3
29.5
21.6
105
Figure 3.1
Figure 3.1: Distribution of IC50 values of FIASMAs for various melanoma cell lines
th
th
and FF2441 fibroblasts. Box range shows 25 and 75 percentiles. Whiskers
show outliers with outlier coefficient of 1.5.
To determine whether acid sphingomyelinase inhibitors trigger cell death by
intracellular cholesterol transport inhibition as occurs with leelamine, the
involvement of lysosomotropism and intracellular cholesterol accumulation was
investigated. Since Bafilomycin A1 (BafA1) mediated inhibition of vacuolar
ATPases suppresses lysosomal accumulation of leelamine and hinders
leelamine mediated cell death, the consequence of BafA1 co-treatment with
functional inhibitors of acid sphingomyelinases was investigated. Cell death
mediated by acid sphingomyelinase inhibitors was suppressed by inhibition of
106
vacuolar ATPases, which are listed in Table 1. This suggests that
lysosomotropism plays an essential role in the cell death process. As a matter of
fact, all of the
Figure 3.2
FIASMAs had a
calculated pKa value
ranging between 7
and 11, which is a
reported range for
lysosomotropism (15)
(Table 3.3 and Fig.
3.2).
Figure 3.2: Histogram showing distribution of calculated pKa
values of FIASMAs.
Lysosomal/late endosomal accumulation of leelamine disrupts intracellular
cholesterol homeostasis to trigger cholesterol accumulation in these organelles.
Leelamine mediated cell death is mediated by cholesterol accumulation since
depletion of cholesterol using β-cyclodextrin treatment suppresses cell death. To
determine whether cholesterol depletion using β-cyclodextrin would prevent
killing mediated by acid sphingomyelinase inhibitors, cells were co-treated with
both agents. Similar to leelamine-mediated cell death, depletion of cholesterol
suppressed the cell death mediated by acid sphingomyelinase inhibitors,
suggesting these compounds disrupt intracellular cholesterol homeostasis (Table
3.3).
107
3.4.2 Certain functional inhibitors of acid sphingomyelinase disrupt
egress of cholesterol from late endosomal/lysosomal cell
compartments.
To further characterize the
Figure 3.3
activity of acid
sphingomyelinase inhibitors on
melanoma cells, five
compounds (Desipramine,
Flupentixol, Fluphenazine,
Nortriptyline and
Perphenazine), with low IC50
values, were selected from
Table 1. Effect on viability of
melanoma cell line, UACC 903
and normal human fibroblast
were compared through MTS
assays. UACC 903 cells were
Figure 3.3: Viability of UACC 903 melanoma and
fibroblast cells after 24 hours of treatment with
increasing concentrations of various FIASMA
compounds. Viability graphs are built based on the
B-spline curves for the increasing concentrations of
drug treatments. Error bars represents ± SEM.
killed at 4 – 6 fold lower
concentrations of these compounds than normal fibroblasts (Fig. 3.3).
Compounds were lysosomotropic and induced vacuolization of cells following
their treatment (Fig. 3.4). Bafilomycin A1 co-treatment at 50 nM suppressed cell
death mediated by these agents suggesting that lysosomotropic property of the
compounds play essential role in the induction of cell death (Fig. 3.5). Through
these experiments, Leelamine was used as a positive control; where it was able
108
to induce 70% cell death and
Figure 3.4
that was reduced to ~25% with
Bafilomycin A1 co-treatment.
Next, the effect of these five
compounds on intracellular
cholesterol localization was
assessed through Filipin III
staining. U18666A, a wellstudied cholesterol transport
inhibitor, and leelamine served
as positive controls. Post six
hour treatment, all five
Figure 3.4: FIASMA compounds display
lysosomotropic property hence induce
vacuolization of cells following their treatment.
compounds promoted
intracellular cholesterol
Figure 3.5
accumulation in contrast
to DMSO control
treatment similar to that
observed with leelamine
and U18666A a wellstudied cholesterol
transport inhibitor. (Fig.
3.6-A). Cholesterol
accumulation was
Figure 3.5: Viability of melanoma cells treated with
various FIASMA compounds in the absence or presence of
V-ATPase inhibitor Bafilomycin A1. Error bars represents ±
SEM.
109
observed in late endosomal/ lysosomal cell compartments as shown by colocalization of RFP tagged LAMP1 (lysosome-associated membrane
glycoprotein-1) with cholesterol (Filipin III) (Fig. 3.6-B).
Figure 3.6
A
B
Figure 3.6: A, Fluorescence
microscopy of subcellular cholesterol
localization following Leelamine,
U18666A or FIASMA treatments. B,
co-localization of RFP tagged LAMP1
protein with accumulated cholesterol
following Fluphenazine (10M, 6hr)
treatment. Scatterplot of Filipin-III and
LAMP1-RFP pixel intensities of the
cells shown in B.
To determine whether cholesterol depletion could prevent melanoma cell
death that is triggered by acid sphingomyelinase inhibitors, cells were cotreated
with these agents and beta-cyclodextrin. 1 mM beta-cyclodextrin retarded
UACC 903 cell death mediated by all five compounds similar to that when
leelamine and beta-cyclodextrin are combined (Fig. 3.7). Since FIASMA
compounds mediated cell death through lysosomal/endosomal accumulation of
cholesterol hereafter FIASMA compounds will be referred as intracellular
cholesterol transport inhibitors (CTI) throughout the manuscript.
110
3.4.3 Intracellular cholesterol transport inhibitors effectively supress
xenografted melanoma tumor growth.
To measure the
Figure 3.7
chemotherapeutic
efficacy of Perphenazine,
Nortriptyline and
Desipramine were tested
on xenografted
melanoma mouse
models. Perphenazine
was the most effective at
reducing tumor growth
Figure 3.7: Viability of UACC 903 melanoma cells following
FIASMA treatment alone or in combination with cyclodextrin. Error bars represents ± SEM.
by ~60 % compared to vehicle control whereas Nortriptyline and Desipramine led
to 50% and 30% decrease, respectively (Fig. 3.8-A).
Since, Perphenazine, an antipsychotic agent, was the most promising at
reducing tumor growth, this agent and another more potent antipsychotic CTI,
Fluphenazine, was further investigated for efficacy against UACC 903, 1205Lu
and A2058 (IC50 values for both Perphenazine and Fluphenazine ~10 uM)
melanoma xenografts. In all three cell lines, oral administration of 50 mg/Kg
Perphenazine or 25 mg/Kg Fluphenazine at 4 day intervals led to 40 to 60 %
decrease in tumor development (Figs. 3.8-B, D and E). Weight of tumors
harvested from animals treated with CTIs was significantly lower than control
groups and correlated with the tumor volume measurements (Figs. 3.8-C and F).
111
Figure 3.8
Figure 3.8: A, Bar graph representing the effect of oral administration of Desipramine,
Nortriptyline and Perphenazine on xenografted UACC 903 melanoma tumor growth at day
22. B, D and E, growth kinetics of UACC 903, 1205 Lu and A2058 xenografted tumors
following oral administration of Fluphenazine (25 mg/kg) and Perphenazine (50 mg/kg).
Image (insert) depicting UACC 903 tumors harvested at the end of experiment. C and F,
bar graphs showing percentage of tumor weights in contrast to control treated animals,
harvested from UACC 903 and A2058 xenografted animals, respectively.
Error bars represents ± SEM. NS: Not significant. * p<0.05; ** p<0.01
112
3.4.4 Intracellular cholesterol transport inhibitors block autophagic
flux.
Leelamine mediated
Figure 3.9
disruption of intracellular
cholesterol leads to
inhibition of both
autophagic flux and
cellular endocytosis. To
investigate whether CTIs
also inhibit autophagic
flux, levels of an
autophagosome marker,
LC3B and an autophagic
flux marker,
p62/SQSTM1 were
examined. Western
Figure 3.9: A, Western blot analyses showing LC3B and
P62 protein levels as a marker of autophagic flux in CTI
treated UACC 903 cells; Erk-2 served as a loading control.
B, fluorescence microscopy of GFP-tagged LC3B
suggesting autophagosome accumulation in CTI- or BafA1treated UACC 903 cells.
blotting of cell lysates harvested from Nortriptyline, Perphenazine or
Fluphenazine treated UACC 903 cells, showed dose dependent accumulation of
LC3B and p62 proteins (Fig. 3.9-A). The accumulation of LC3B was also noticed
through fluorescence microscopy of GFP-tagged LC3B expressing UACC 903
cells (Fig. 3.9-B). These results suggests that, similar to leelamine, CTIs inhibit
autophagic flux and causes aggregation of autophagosomes.
113
3.4.5 Inhibition of intracellular cholesterol transport suppresses
cellular endocytosis and retard receptor tyrosine kinase - Akt / Stat3
signaling.
The effect of cholesterol transport inhibitors on cellular endocytosis was
investigated through cellular uptake of Alexa Fluor conjugated transferrin protein.
Transferrin is internalized into early endosomes through clathrin-mediated
endocytosis which serves as the major pathway for uptake of receptor–ligand
complexes (235). Uptake of Alexa Fluor conjugated transferrin protein enables
evaluation of endocytic activity through fluorescence microscopy or flow
cytometry. Cholesterol transport inhibitors significantly suppressed the uptake of
transferrin protein similar to that occurring with leelamine suggesting that
lysosomal/endosomal accumulation of cholesterol halts cellular endocytosis (Fig.
3.10-A). In contrast DMSO treated control cells internalized Alexa Fluor
conjugated transferrin protein. This observation was further confirmed by flow
cytometry based quantitation of transferrin signal which revealed a dosedependent inhibition of endocytosis following cholesterol transport inhibitor
treatment (Fig. 3.10-B).
114
Figure 3.10
Figure 3.10: A, fluorescence microscopy images showing endocytosis of Alexa Fluor–
conjugated transferrin protein following DMSO control or CTI treatments. B, flow
cytometry–based quantification of Alexa Fluor–conjugated transferrin protein endocytosis
following CTI treatments.
Inhibition of cellular endocytosis is expected to suppress signaling cascades
that are regulated by receptor tyrosine kinases, since activity of these receptors
depend on functional endocytosis (236). Leelamine has been shown to alter
localization of several receptor tyrosine kinases and inhibit downstream
cascades of the PI3K/AKT, MAPK and STAT3 signaling pathways. The
localization of various receptor tyrosine kinases and activity of these signaling
cascades were investigated through immunofluorescence staining and western
blotting. Treatment of UACC 903 cells with CTIs altered localization of IGF1R
receptors to perinuclear region (Fig. 3.11). Western blotting data also confirmed
115
alterations in receptor
Figure 3.11
tyrosine kinases. For
example, Nortriptyline,
Perphenazine or
Fluphenazine treatments
caused dose-dependent
accumulation of pro HGFR
and pro-IGFIR proteins (Fig.
3.12). Furthermore,
downstream effectors of
receptor tyrosine kinases,
Figure 3.11:
Immunofluorescence
staining of IGF1R-
showing perinuclear
accumulation (arrow
heads) following CTI
treatment.
phospho AKT and phospho
STAT3 levels were also downregulated (Fig. 3.12). Interestingly, phospho
ERK1/2 levels were up-regulated with CTI treatments. Additionally, lysosomal
Cathepsin B levels, which has been reported to be an important protease for
cancer metastases, was also investigated through western blotting (237).
Cathepsin B is a cysteinyl protease that resides inside the lysosomes as an
inactive pro-enzyme until its secretion to the extracellular space where in
melanoma cells it facilitates cell invasiveness and migration (238). Robust
decreases in active Cathepsin B levels with concomitant increase in inactive proCathepsin B levels were observed (Fig. 3.12).
116
Figure 3.12
Figure 3.12: Western blot analysis of UACC 903 cells
treated with increasing concentrations of Nortriptyline,
Perphenazine or Fluphenazine.
3.4.6 Cholesterol transport inhibitors trigger caspase-independent
cell death that involves mitochondrial localization of BAX.
To characterize the downstream signaling cascades that mediate cell death
triggered by CTIs, alterations in various apoptotic signals were examined. First,
to differentiate between viable, early and late apoptotic cells, UACC 903 cells
were treated with CTIs for 24 hours and stained with propidium iodide (PI) in
tandem with APC-conjugated Annexin V. All of the tested CTIs led to a
significant increase in the percentage of early apoptotic cells (Annexin V +, PI -)
(Fig. 3.13). In DMSO treated control cells only ~1 % of the cells were
undergoing apoptosis. However, in the treated cells this percentage was
117
increased to 4-8 %. The increase in the
Figure 3.13
percentage of apoptotic cells was dosedependent. Furthermore, a dramatic
increase (0.5 % vs 10 - 37 %) was
noticed in late apoptotic/necrotic cells
(Annexin V +, PI +).
In order to eliminate the possibility of
cell death through necrosis, NecrostatinV and IM-54, two necrosis inhibitors
were used. This approach has been
recommended by nomenclature
committee on cell death to identify the
cause of cell accumulation in late
apoptotic/necrotic quadrant (239).
Neither IM-54 nor Necrostatin-5
cotreatment was able to protect cells
Figure 3.13: FACs analysis showing
annexin V- APC/PI staining of CTI
treated UACC 903 cells. Cells, in the
lower right quadrant show early
apoptotic cells; in the upper right
quadrant show late apoptotic dead cells.
from leelamine mediated cell death (Fig. 3.14; Left Panel). In addition, their
combination was also not able to protect cells from any of the tested CTIs ruling
out the possibility of involvement of necrosis in the cell death process (Fig. 3.14;
Right Panel).
Loss of transmembrane potential of mitochondria (∆ψmt) plays a central role in
many apoptotic processes (240). As leelamine has been shown to decrease
mitochondrial membrane potential (MMP), the effect of CTIs on MMP was
118
measured through flow cytometry of Tetramethylrhodamine, Ethyl Ester (TMRE)
Figure 3.14
Figure 3.14: Viability of cells treated with leelamine or CTIs in the absence or presence of
necrosis inhibitors IM54 and/or Neecrostatin-V. Error bars represents ± SEM.
stained UACC 903 cells. Positive control, FCCP (an oxidative phosphorylation
uncoupler) treatment diminished the MMP in 100% of the cells. 13% to 15% of
the cells lost their MMP, post 3 hours of
10 uM Nortriptyline or Perphenazine
Figure 3.15
treatments (Fig. 3.15). The decrease in
MMP was dose and time dependent as
evidenced by 19% and 28% decrease
after 6 hour of 10 and 15 uM
Perphenazine treatments respectively.
As a pro-apoptotic member of the
Bcl-2 protein family, BAX is an
important regulator of the apoptotic
process and known to translocate to
Figure 3.15: Histogram showing
mitochondrial membrane potential
following CTI or FCCP (positive control)
treatments.
119
mitochondrial membrane and subsequently induce a rapid loss of MMP (241).
To assess the involvement of BAX in CTI mediated cell death, the sensitivity of
wild-type and BAX-knockout HCT116 cells to CTIs were compared. BAXknockout cells were more resistant to increasing concentrations of Perphenazine
treatment (Fig. 3.16; Left Panel). In fact, including Leelamine, all other tested
CTIs were also more effective towards wild-type HCT116 cells in contrast to BAX
knockouts (Fig. 3.16; Right Panel).
Figure 3.16
Figure 3.16: Viability of wild-type or BAX-knockout HCT116 cells after 24 hours of
treatment with increasing concentrations of Perphenazine (left panel) or other CTIs (right
panel). Error bars represents ± SEM.
It is known that following its mitochondrial localization, BAX mediates
Cytochrome C release from mitochondria which leads to assembly of
apoptosome and consequently activation of caspases (242). To investigate
whether activity of apoptosome is involved in CTI mediated cell death, NS-3694,
an inhibitor of apoptosome formation was used. Interestingly, the response of
CTIs to apoptosome inhibition was variable. 50 M NS-3694 was partially able to
120
protect cells from cell death mediated by Perphenazine, Fluphenazine or
Flupentixol treatment, while it was ineffective against Desipramine, Nortriptyline
or leelamine treatments (Fig. 3.17).
Since, activation of caspase
proteases plays a central role in
several apoptotic programs;
caspase-dependence of CTI
mediated cell death was
examined through pan-caspase
inhibitor z-VAD-fmk co-treatment.
TRAIL treatment was used as a
positive control for this
experiment. 50 ng/mL TRAIL
decreased the viability of UACC 903 cells to 34% of the DMSO treated controls
whereas, co-treatment of 20 mMol/L z-VAD-fmk was able to totally protect cells
from TRAIL (Fig. 3.18). However, inhibition of caspases was unable to protect
cells from any of the fıve CTIs or leelamine suggesting that disruption of
cholesterol transport triggers caspase-independent cell death (Fig.3.18).
It is known that, lysosomal membrane permeabilization can lead to leakage of
lysosomal proteases to cytosol and trigger caspase-independent cell death (119,
243). Although Z-VAD-fmk has repeatedly been shown to inhibit lysosomal
proteases, such as calpains and cathepsins, the involvement of lysosomal
leakage was further studied through various protease inhibitors (239). Co-
121
Figure 3.18
Figure 3.18: Right Panel : Caspase-dependence of CTI mediated cell death measured
through treatment of UACC 903 cells with CTIs in the absence or presence of pan-caspase
inhibitor, z-VAD-fmk (20M). Left panel is a positive control for zVADfmk co-treatment. It
effectively suppresses TRAIL (50ng/mL) mediated caspase activation. Error bars
represents ± SEM. ** p<0.01.
treatment of ALLN (Calpain/Cathepsin Inhibitor-1), leupeptin (cysteine, serine
and threonine protease inhibitor), Pepstatin-A (aspartic proteinase inhibitor) or
AEBSF (serine peptidase inhibitor) were not able to protect cells from the tested
CTIs suggesting that lysosomal proteases are not involved in cell death process.
122
3.5 Discussion
Recently Leelamine, a lysosomotropic compound, was identified as a
chemotherapeutic agent against melanoma (171). Findings related to the
mechanism of action of leelamine suggested a crucial interaction between
lysosomal accumulation of the compound and its activity. Following lysosomal
accumulation, leelamine disrupts intracellular cholesterol transport and induces
a phenotype that mimics type C form of Niemann Pick disease (NPC) (44). NPC
is an autosomal recessively inherited lysosomal storage disease that causes
neuronal cell death through intracellular accumulation of sphingolipids and
cholesterol (244). It is genetically and clinically distinct from type A and B forms
in which loss of function mutations in the acid sphingomyelinase gene renders
lysosomal sphingomyelin accretion and consequently leads to defective
lysosomal/endosomal cholesterol trafficking (245). However, in the type C form,
mutation of NPC1 protein disrupts cholesterol efflux from lysosomes leading to its
build up in lysosomal/late endosomal cell compartments (246).
In two consecutive studies, Kornhuber et al. identified a class of compounds
that were able to inhibit lysosomal acid sphingomyelinase enzyme activity and
hence named them as functional inhibitors of acid sphingomyelinase activity (
FIASMA’s) (231, 232). Most of the functional inhibitors of acid sphingomyelinase
were tricyclic antidepressants, antipsychotics or antihistamines. In their study, a
tricyclic antidepressant, imipramine, was identified as a functional inhibitor of acid
sphingomyelinase (231). Imipramine is one of the few compounds that are also
used to study the NPC disease (247). Similar to leelamine, imipramine disrupts
123
intracellular cholesterol transport and triggers a phenotype that resembles the
NPC disease (247). Considering the facts that: i) Type A and B form of Niemann
Pick disease is triggered by inhibition of the ASM activity; ii) Type C form of the
disease is triggered by disruption of intracellular cholesterol transport; iii)
Imipramine was identified as a functional inhibitor of acid sphingomyelinase and
known to mimic NPC disease; iv) Leelamine mediates melanoma cell death
through induction of intracellular cholesterol accumulation; our study suggest that
FIASMA compounds might function as intracellular cholesterol transport
inhibitors and might have the potential to induce melanoma cell death. In fact, in
this study it was shown that melanoma cells were ~3 times more sensitive to
FIASMA compounds in contrast to normal fibroblasts. Moreover, a slight but
significant correlation between IC50 values and reported residual acid
sphingomyelinase activity of the FIASMA compounds was observed. Thus, the
results of the present study clearly suggest that FIASMA compounds have the
potential to show chemotherapeutic activity through the mechanisms similar to
those that are mediated by leelamine.
Studies carried out by Kornhuber et al. also have suggested that pKa
(dissociation constant) and LogP (partition coefficient) values are detrimental
factors for the structure-property activity relationship of the FIASMA compounds.
The pKa value is the predominant factor that determines the accumulation of the
lysosomotropic compounds in acidic organelles (14). As shown in the current
study, FIASMA compounds tend to have a calculated pKa value around 9.5. On
the other hand, the LogP value represents hydrophobicity (or lipophilicity) of a
124
compound which is an important factor for drug-likeness as it affects drug
absorption and solubility (248). In fact, Lipinski and his colleagues had analyzed
the physicochemical properties of over 2,000 drugs and set the maximum logP
value to 5 as a guideline to drug-likeness (249). FIASMA compounds had a
LogP value around 5 and were expected to diffuse easily through blood-brain
barrier due to their lipophilicity (231). Indeed, most of the FIASMA’s were
tricyclic lysosomotropic antidepressants or antipsychotics Central Nervous
System (CNS) related drugs.
In the literature there is a significant amount of data suggesting that tricyclic
lysosomotropic antidepressant compounds display activity against several
malignancies (67, 69, 250, 251). Many of these antidepressants were reported
to trigger cancer cell death besides restoring sensitivity of multidrug resistant
(MDR) cancer cell lines to various chemotherapeutic agents (10-13). For
instance, Perphenazine has been reported to induce mitochondria-mediated cell
death in human neuroblastoma cells and trigger apoptosis in both wild-type and
MDR B16 melanoma cells (252, 253). Fluphenazine was also effective against
this multi-drug resistant cell line (253). Flupentixol was reported to enhance
sensitivity of murine fibrosarcoma cells to anticancer drugs such as Adriamycin,
Actinomycin D and Vinblastine (254). Also, another antidepressant Desipramine
was shown to trigger apoptotic cell death of colon carcinoma cells through both
mitochondria dependent and independent pathways (255).
Results of the present study suggest that lysosomotropic cholesterol transport
inhibitors mediate melanoma cell death through inhibition of autophagic flux and
125
cellular endocytosis. As a consequence, they inhibit RTK-AKT/STAT3 signaling
cascades that are known to be highly activated in the significant portion of
melanomas (256-258). Melanoma cell lines which harbor PTEN deletion tends to
have high AKT activity which may explain their increased sensitivity to the
cholesterol transport inhibitors. As a master regulator of apoptosis, AKT
activation suppresses many apoptotic stimuli through inhibition of BAX
localization to the mitochondrial membrane (259). In fact, in this study it was
shown that FIASMA compounds suppressed AKT signaling and BAX knock-out
cells were resistant to cell death mediated by these agents. When BAX localizes
to mitochondria, it triggers mitochondrial membrane depolarization and
cytochrome C release (260). Consequently this induces apoptosome formation
and caspase activation. Investigated CTIs also diminished the mitochondrial
membrane potential and activated the caspases. Apoptosome inhibitor NS-3694
was able to partially suppress the cell death whereas pan-caspase inhibitor,
zVAD-fmk, failed to rescue cells from cell death. This controversy findings
suggests that an unusual caspase 3/7 independent but apoptosome dependent
cell death process was triggered by CTIs. One possible pathway might involve
caspase-9 activity since NS-3694 is known to disrupt apoptosome/caspase-9
interaction and zVAD-fmk is reported to be able to enhance caspase 9 activity
(261, 262). A similar kind of cell death process which involves caspase 9 but not
3 has been previously reported (263). However, further studies are warranted to
identify the details of this unusual cell death process.
126
Interestingly, in a case-control study that involves follow up of a cohort of
6168 chronic schizophrenic patients for 27 years, a significant association
between reduced risk of prostate cancer and use of high-dose tricyclic
antidepressants was discovered (114). In another case-control study,
association between previous tricyclic antidepressant usage and cancer
incidence was investigated (85). After adjusting for other possible influences,
such as age, gender, smoking, alcohol usage, etc., a statistically significant
inverse association between previous tricyclic antidepressant usage and
incidence of glioma as well as colorectal cancers was detected. Notably, these
associations were reported to be dose- and time-dependent suggesting that
tricyclic antidepressants may have potential as chemotherapeutic agents.
Many of the agents that were identified as FIASMA compounds are currently
being tested in clinical trials for their efficacy against various cancers including
leukemia, myeloma, lung, prostate and colorectal cancers (264-268). The
chemotherapeutic potential of Quinacrine (Mepacrine), an antimalarial basic
tricyclic amine, on prostate cancer was assessed in a phase 2 trial (265). The
trial was conducted in patients who did not responded to previous
chemotherapies and no drug-related serious adverse effects were observed.
Although only one of the 31 patients showed partial response to the treatment,
50% of the patients showed stabilization or decrease in the rate of disease
progression. More recently, Sage et al. reported the activity of tricyclic
antidepressants against small cell lung cancers and carried out a phase-IIa
clinical study with Desipramine (266, 269). Although their plan was starting
127
patients on doses of 75 mg/day and increasing this up to 450 mg/day, all patients
but one were not able to tolerate a dosage above 150 mg/day (personal
communication). This intolerability coupled with lack of efficacy led to the early
termination of the study suggesting that alternative approaches in the
administration of these drugs may be required.
In this report, in vivo studies exhibited significant anti-melanoma potential of
Perphenazine and Fluphenazine, two CNS active compounds. Both agents led
to a 50 to 60 % decrease in the growth of xenografted melanoma tumors.
However, drowsiness was a prevalent complication in these studies and external
heat support was applied in order to reverse the effects of lowered blood
pressure. As an antipsychotic drug, the suggested dosage of Perphenazine for
humans is 0.2 to 0.4 mg/kg (12 to 24 mg/day) for a 60 kg human but in rare
conditions, such as hospitalized patients with schizophrenia, this dosage can be
increased up to ~1 mg/kg (64 mg/day). According to the FDA guidelines this
dosage range corresponds to 2.5 to 5 mg/kg and can go up to 12.5 mg/kg in
mice. For Fluphenazine the suggested dosage in humans is generally less than
0.33 mg/kg (20 mg/day) for a 60 kg human which corresponds to 4.1 mg/kg in
mice. In this study, however, the doses given were 4 to 10 times greater than the
standard dosage range in mice in order to induce chemotherapeutic activity.
Although these dosages are currently impractical in humans, decreasing the
blood-brain-barrier permeability of these compounds could make these high
doses a viable option. Liposomal formulation could represent a potential
approach for decreasing the blood-brain-barrier permeability and allow clinical
128
trials such as that conducted by Sage et al to reach doses required for
chemotherapeutic efficacy.
Antidepressants have multifaceted value in cancer therapeutics and hence
have been proposed by World Health Organization as a supportive care for
cancer patients (65, 270). They can reduce severity of cancer-associated pain,
anxiety, depression as well as adverse effects of chemotherapy such as vomiting
(251). As it was reported in this manuscript, many correlative studies suggested
that tricyclic antidepressants have potential chemotherapeutic anti-cancer
activities. However, further studies and clinical trials are required to determine
which antidepressants (or cholesterol transport inhibitors or FIASMA`s) are
effective, and whether or when they can be combined with other
chemotherapeutic agents.
3.6 Acknowledgements
We are thankful to Dr. Sabatini DM for providing LAMP1-mRFP-FLAG
plasmid, Dr. Jin-Ming Yang, Dr. Robert Levenson, Dr. Sinisa Dovat, Dr. Rogerio
Neves, and Dr. Raghavendra Gowda for their guidance throughout the
experiments.
129
CHAPTER 4
Conclusions and Future Directions
130
4.1 Conclusions
The study presented in this dissertation details the mechanism of action of
hydrophobic lysosomotropic compounds to induce cell death in melanoma cells.
This study was initiated with the aim of identifying the mechanism of
chemotherapeutic action of a naturally derived small molecule, leelamine. It was
discovered that, leelamine mediates cancer cell death through inhibiting
intracellular cholesterol transport. The findings of the leelamine study formed the
basis for the identification and characterization of class-II lysosomotropic
compounds as intracellular cholesterol transport inhibitors.
In these studies we have identified that, hydrophobic lysosomotropic
compounds (e.g., leelamine, Perphenazine, Fluphenazine) accumulate in acidic
organelles due to their lysosomotropic property leading to disruption of lipid
homeostasis and accumulation of cholesterol in these organelles. As a
consequence, autophagic flux and cellular endocytosis were inhibited resulting in
suppression of multiple oncogenic signaling pathways, such as AKT and STAT3.
In vitro, these compounds were able to kill mutant BRAF/ PTEN-/- melanoma cells
in 3 to 5 fold less concentrations compared to normal skin cells. The cancer cell
death was dependent on both lysosomotropic property of the compounds and
intracellular cholesterol accumulation since inhibition of v-ATPases or depletion
of cholesterol was able to suppress cell death. Cholesterol transport inhibitors
were able to inhibit xenografted melanoma tumor growth development, in vivo. It
was demonstrated that, oral administration of Perphenazine (50 mg/kg) or
131
Fluphenazine (25 mg/kg) was able to decrease tumor growth up to 50-60 % of
the controls.
Incidence and mortality rates for malignant melanoma continue to rise
annually. It is estimated that there will be approximately 76,000 new cases of
melanoma and over 9,000 deaths this year. Advanced-stage metastatic
melanoma carries a poor prognosis, with an overall median survival of ~2–8
months, and with only 5% of patients surviving beyond 5 years. For last few
decades systemic treatment options for melanoma were ineffective for the longterm treatment of the disease. Therefore; new and novel approaches are needed
to augment existing ones that could enhance melanoma treatment options. The
research presented in this dissertation demonstrated that class-II lysosomotropic
compounds exhibit anti-melanoma potential through inhibiting lysosomal egress
of cholesterol. Since many of these agents are therapeutic drugs approved by
FDA for their antidepressant, antipsychotic or antihistamine activities, the results
of these studies would be unique in terms of repurposing these generic drugs as
anti-cancer agents. Since these drugs have well-known toxicity profiles, the
transition to clinic for the treatment would be rapid.
132
4.2 Future Directions
Following studies are suggested to extend the observations made in this
dissertation by further assessing the chemotherapeutic activity of class-II
lysosomotropic compounds as inhibitors of intracellular cholesterol transport.
● In this dissertation, including leelamine we have tested 43 compounds for
their activity against melanoma cell lines as well as normal fibroblasts.
Although all of these, compounds were able to trigger cell death in several
fold lower concentrations in melanoma cells compared to normal
fibroblasts, the range of IC50 values was very wide. This suggests that
some of the compounds could be more effective due to their
physicochemical properties. Therefore, to identify the “best” cholesterol
transport inhibitor (CTI) a QSAR study can be conducted. Development of
a good QSAR model might allow modification of these existing
compounds to enhance anti-cancer activity.
● Since drugs are extensively metabolized in vivo, efficacies and toxicities
could show great variability in contrast to their in vitro effects. Therefore, a
full range of drug metabolism and pharmacokinetic studies can be
conducted to identify the most potent CTI as an anti-cancer candidate. A
variety of in-silico tools can be used to predict the enzymes that are likely
to metabolize a compound as well as the metabolites of the compound
(271).
133
● Although many of the class-II lysosomotropic compounds are generic
drugs with well-known toxicity profiles and regime, their application as a
chemotherapeutic agent would further require dose and time interval
related studies. In our studies we have observed that Perphenazine which
has an IC50 value of ~10 µM for UACC 903 cells in-vitro, was able to
decrease xenografted tumor size ~50% when administered 50 mg/Kg
once in every four day. According to FDAs human equivalent dosage
calculation guidelines this dosage corresponds to 3 mg/Kg for humans.
Whereas, for hospitalized schizophrenia patients, the highest dosage
suggested for this drug is 1 mg/kg per day. Therefore, it would be
pertinent to do dose escalation studies for establishing a tolerable and
efficacious dosage regime.
● Another important concern related to the in-vivo applicability of cholesterol
transport inhibitors involves the potential adverse effects of these
compounds. Treatment of rats with high doses of U18666A was reported
to cause cataracts, especially when treatment was initiated immediately
after birth (45). It was hypothesized that alteration of the cholesterol
content of the lens fiber cell plasma membrane could be the basis of lens
opacification caused by U18666A treatment. Interestingly in many casecontrol studies, a significant risk of development of cataract has been
linked with antidepressant or antipsychotic usage (272-274). Moreover,
since many of the class-II lysosomotropic compounds are CNS active
134
drugs (e.g., antidepressants, antipsychotics), their application at highdoses might cause severe adverse effects. In fact, symptoms associated
with drowsiness-sleepiness were observed with Perphenazine (50 mg/kg)
or Fluphenazine (25 mg/kg) treated animals, which persisted as long as
48 hours for some of these animals. As a consequence, this caused
dehydration as well as decrease in body temperature requiring external
heat support for the recovery. Therefore, alternative treatment
approaches can be required to prevent toxicity issues.
● The CNS activity of class-II lysosomotropic compounds is associated with
high blood-brain-barrier (BBB) permeability due to high lipophilicity of
these compounds. Therefore, decreasing the BBB permeability could
overcome the CNS associated side effects of these agents. Since
liposomes have low BBB permeability, intravenous administration of these
agents in liposome encapsulated formulations could be a potential
approach to overcome CNS related side effects. Therefore, development
of nanoparticles containing cholesterol transport inhibitors and evaluating
therapeutic potential following intravenous delivery is warranted. The
ideal agent is predicted to kill the melanoma cells by inhibiting the key
pathways to which the cancer cell has become addicted during its
evolution and have a minimal effect on the CNS by not passing the bloodbrain barrier.
135
● In this dissertation, the efficacy of leelamine and several class-II
lysosomotropic compounds on melanoma cell lines and xenografted
tumors were investigated. In-vitro studies suggested that, these agents
were more effective on BRAF mutant / PTEN-/- melanoma cell lines in
contrast to other melanoma cells. The possible mechanisms leading to
increased sensitivity of these compounds were discussed in the last part
of the chapter one of this dissertation. However, these mechanisms might
require further studies to identify which cancers would respond better to
CTI treatment. Moreover, the efficacy of the class-II lysosomotropic
compounds on some other cancer types has been reported previously.
Therefore, it is worthwhile to conduct a screen on various cancer cell lines
in order to explore the chemotherapeutic potential of these agents on
other cancer types.
● Another important subject that requires further investigation is related to
the effect of class-II lysosomotropic compounds on drug resistance.
Currently, targeted therapies such as Zelboraf and Dabrafenib, two FDA
approved mutant B-RAF inhibitors, are being used for the short-term
management of melanomas. However, an aggressive and drug resistant
disease usually develops just after few months of treatment. As discussed
in the first chapter, class-II lysosomotropic compounds have been
reported to induce sensitivity of multidrug resistant cell lines to various
chemotherapeutic agents. Therefore, it would be interesting to assess
136
whether combinatorial treatment of BRAF targeted agents with class-II
lysosomotropic compounds would increase the efficacy of treatment while
preventing drug resistance.
● It has been determined in this dissertation that lysosomal/late endosomal
accumulation of cholesterol has an essential role in induction of cell death
in melanoma cell lines. However, it is presently unclear whether in-vivo
efficacy of these agents also depends on intracellular cholesterol
accumulation in tumors. Hence, it would be important to determine,
whether class-II lysosomotropic compounds could induce same alterations
in tumor tissues compared to what was observed in in-vitro studies. In
addition, as it was discussed in the last section of chapter one, the
increased levels of cholesterol in cancer cells may contribute to their
sensitivity to CTIs. The validity of this hypothesis can be checked by
assessing the cholesterol levels in various cell lines as well as tumors.
● Further investigation related to the identification of link between
cholesterol accumulation and cell death is required. As discussed in the
first chapter, lysosomal sphingosine accumulation is a hallmark of NPC1
disease and has also been observed following U18666A treatment. In
fact, U18666A treatment has been demonstrated to elevate sphingosine
levels prior to cholesterol accumulation and treatment of cells with
sphingosine was able to trigger lysosomal cholesterol accumulation.
137
Although this suggests that increased sphingosine levels could be the
initiator of cholesterol accumulation; currently the source of elevated
sphingosine is unknown. It was hypothesized that, NPC1 could also be a
transporter for sphingosine. This hypothesis was supported and
contradicted by the findings of various studies. Hence further studies are
required to understand how class-II lysosomotropic compounds elevate
sphingosine levels and inhibit cholesterol egress from acidic cell
compartments.
● Although several studies have been conducted to identify any association
between the risk of cancer development and usage of antidepressants,
antipsychotics or antihistamines, contradictory results were obtained.
Many factors, such as size and quality of analyzed data, might have
contributed to these contradictions. However, as discussed earlier, classII lysosomotropic compounds are more effective in cancers with unique
mutations. Therefore, conducting case-control studies in subtypes of
cancers could identify better associations between decreased risk of
cancers and cholesterol transport inhibitors. In addition, it would be
interesting to conduct an epidemiological study to identify whether there is
a decreased risk of cancer development in NPC patients, since their cells
already have decreased levels of intracellular cholesterol transport.
138
● During our studies we have identified four compounds, -cyclodextrin,
baicalein, staurosporine and Go6976, that were able to suppress
leelamine mediated cell death. As leelamine resembles Niemann Pick
Type C disease these compounds might also show protective activity
against this neurodegenerative disease. In fact, on May 2010, cyclodextrin has gained orphan drug status and designated as a promising
agent for the treatment of NPC disease. However very high concentrations
of -cyclodextrin is required for the treatment. In vitro, 1 mM -cyclodextrin
was able to suppress leelamine mediated cell death while in clinical trials
-cyclodextrin was administered at 2500 mg/kg as an eight-hour infusion,
twice weekly (203). However, any of the other compounds that are
identified in this study, were studied for the treatment of NPC. Since these
agents were also able to suppress leelamine mediated cell death at very
low concentrations (Go6976, 500nM; Staurosporine, 5nM; and Baicalein,
35 uM) assessment of their efficacy for the therapeutics of NPC disease
could raise a potential hope for NPC patients.
139
References
1.
de Duve C, de Barsy T, Poole B, Trouet A, Tulkens P, Van Hoof F.
Commentary. Lysosomotropic agents. Biochemical pharmacology.
1974;23:2495-531.
2.
Oblak E, Krasowska A. [The biological activity of lysosomotropic agents].
Postepy higieny i medycyny doswiadczalnej. 2010;64:459-65.
3.
Duvvuri M, Krise JP. A novel assay reveals that weakly basic model
compounds concentrate in lysosomes to an extent greater than pH-partitioning
theory would predict. Molecular pharmaceutics. 2005;2:440-8.
4.
Kaufmann AM, Krise JP. Lysosomal sequestration of amine-containing
drugs: analysis and therapeutic implications. Journal of pharmaceutical sciences.
2007;96:729-46.
5.
Kallunki T, Olsen OD, Jaattela M. Cancer-associated lysosomal changes:
friends or foes? Oncogene. 2013;32:1995-2004.
6.
Mellman I. Endocytosis and molecular sorting. Annual review of cell and
developmental biology. 1996;12:575-625.
7.
Goldman SD, Funk RS, Rajewski RA, Krise JP. Mechanisms of amine
accumulation in, and egress from, lysosomes. Bioanalysis. 2009;1:1445-59.
8.
Kornhuber J, Retz W, Riederer P. Slow accumulation of psychotropic
substances in the human brain. Relationship to therapeutic latency of neuroleptic
and antidepressant drugs? Journal of neural transmission Supplementum.
1995;46:315-23.
9.
Homewood CA, Warhurst DC, Peters W, Baggaley VC. Lysosomes, pH
and the anti-malarial action of chloroquine. Nature. 1972;235:50-2.
10.
Hait WN, Gesmonde JF, Murren JR, Yang JM, Chen HX, Reiss M.
Terfenadine (Seldane): a new drug for restoring sensitivity to multidrug resistant
cancer cells. Biochemical pharmacology. 1993;45:401-6.
11.
Akiyama S, Shiraishi N, Kuratomi Y, Nakagawa M, Kuwano M.
Circumvention of multiple-drug resistance in human cancer cells by thioridazine,
trifluoperazine, and chlorpromazine. Journal of the National Cancer Institute.
1986;76:839-44.
12.
Peer D, Margalit R. Fluoxetine and reversal of multidrug resistance.
Cancer letters. 2006;237:180-7.
13.
Zhou T, Duan J, Wang Y, Chen X, Zhou G, Wang R, et al. Fluoxetine
synergys with anticancer drugs to overcome multidrug resistance in breast
cancer cells. Tumour biology : the journal of the International Society for
Oncodevelopmental Biology and Medicine. 2012;33:1299-306.
14.
Marceau F, Bawolak MT, Lodge R, Bouthillier J, Gagne-Henley A,
Gaudreault RC, et al. Cation trapping by cellular acidic compartments: beyond
the concept of lysosomotropic drugs. Toxicology and applied pharmacology.
2012;259:1-12.
15.
Nadanaciva S, Lu S, Gebhard DF, Jessen BA, Pennie WD, Will Y. A high
content screening assay for identifying lysosomotropic compounds. Toxicology in
vitro : an international journal published in association with BIBRA. 2011;25:71523.
140
16.
Daniel WA. Mechanisms of cellular distribution of psychotropic drugs.
Significance for drug action and interactions. Progress in neuropsychopharmacology & biological psychiatry. 2003;27:65-73.
17.
Daniel WA, Wojcikowski J. Contribution of lysosomal trapping to the total
tissue uptake of psychotropic drugs. Pharmacology & toxicology. 1997;80:62-8.
18.
Daniel WA, Wojcikowski J. Lysosomal trapping as an important
mechanism involved in the cellular distribution of perazine and in
pharmacokinetic interaction with antidepressants. European
neuropsychopharmacology : the journal of the European College of
Neuropsychopharmacology. 1999;9:483-91.
19.
Miller DK, Griffiths E, Lenard J, Firestone RA. Cell killing by
lysosomotropic detergents. The Journal of cell biology. 1983;97:1841-51.
20.
Seglen PO, Grinde B, Solheim AE. Inhibition of the lysosomal pathway of
protein degradation in isolated rat hepatocytes by ammonia, methylamine,
chloroquine and leupeptin. European journal of biochemistry / FEBS.
1979;95:215-25.
21.
Seglen PO, Gordon PB. Effects of lysosomotropic monoamines, diamines,
amino alcohols, and other amino compounds on protein degradation and protein
synthesis in isolated rat hepatocytes. Molecular pharmacology. 1980;18:468-75.
22.
Kubo M, Hostetler KY. Mechanism of cationic amphiphilic drug inhibition of
purified lysosomal phospholipase A1. Biochemistry. 1985;24:6515-20.
23.
Abe A, Hiraoka M, Shayman JA. A role for lysosomal phospholipase A2 in
drug induced phospholipidosis. Drug metabolism letters. 2007;1:49-53.
24.
Liscum L, Faust JR. The intracellular transport of low density lipoproteinderived cholesterol is inhibited in Chinese hamster ovary cells cultured with 3beta-[2-(diethylamino)ethoxy]androst-5-en-17-one. The Journal of biological
chemistry. 1989;264:11796-806.
25.
Mellon SH, Gong W, Schonemann MD. Endogenous and synthetic
neurosteroids in treatment of Niemann-Pick Type C disease. Brain research
reviews. 2008;57:410-20.
26.
Lange Y, Ye J, Steck TL. Circulation of cholesterol between lysosomes
and the plasma membrane. The Journal of biological chemistry. 1998;273:1891522.
27.
Lloyd-Evans E, Morgan AJ, He X, Smith DA, Elliot-Smith E, Sillence DJ, et
al. Niemann-Pick disease type C1 is a sphingosine storage disease that causes
deregulation of lysosomal calcium. Nature medicine. 2008;14:1247-55.
28.
Rodriguez-Lafrasse C, Rousson R, Pentchev PG, Louisot P, Vanier MT.
Free sphingoid bases in tissues from patients with type C Niemann-Pick disease
and other lysosomal storage disorders. Biochimica et biophysica acta.
1994;1226:138-44.
29.
Kagedal K, Zhao M, Svensson I, Brunk UT. Sphingosine-induced
apoptosis is dependent on lysosomal proteases. The Biochemical journal.
2001;359:335-43.
30.
Lloyd-Evans E, Platt FM. Lipids on trial: the search for the offending
metabolite in Niemann-Pick type C disease. Traffic. 2010;11:419-28.
141
31.
Blom T, Li Z, Bittman R, Somerharju P, Ikonen E. Tracking sphingosine
metabolism and transport in sphingolipidoses: NPC1 deficiency as a test case.
Traffic. 2012;13:1234-43.
32.
Subbaiah PV, Sowa JM, Singh DK. Sphingolipids and cellular cholesterol
homeostasis. Effect of ceramide on cholesterol trafficking and HMG CoA
reductase activity. Archives of biochemistry and biophysics. 2008;474:32-8.
33.
Underwood KW, Jacobs NL, Howley A, Liscum L. Evidence for a
cholesterol transport pathway from lysosomes to endoplasmic reticulum that is
independent of the plasma membrane. The Journal of biological chemistry.
1998;273:4266-74.
34.
Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, GreenThompson ZW, et al. Regulation of mammalian autophagy in physiology and
pathophysiology. Physiological reviews. 2010;90:1383-435.
35.
Pietrocola F, Izzo V, Niso-Santano M, Vacchelli E, Galluzzi L, Maiuri MC,
et al. Regulation of autophagy by stress-responsive transcription factors.
Seminars in cancer biology. 2013;23:310-22.
36.
Cheng Y, Ren X, Hait WN, Yang JM. Therapeutic targeting of autophagy
in disease: biology and pharmacology. Pharmacological reviews. 2013;65:116297.
37.
Weidberg H, Shvets E, Elazar Z. Biogenesis and cargo selectivity of
autophagosomes. Annual review of biochemistry. 2011;80:125-56.
38.
Sahu R, Kaushik S, Clement CC, Cannizzo ES, Scharf B, Follenzi A, et al.
Microautophagy of cytosolic proteins by late endosomes. Developmental cell.
2011;20:131-9.
39.
Li WW, Li J, Bao JK. Microautophagy: lesser-known self-eating. Cellular
and molecular life sciences : CMLS. 2012;69:1125-36.
40.
Kaushik S, Cuervo AM. Chaperone-mediated autophagy: a unique way to
enter the lysosome world. Trends in cell biology. 2012;22:407-17.
41.
Eskelinen EL. New insights into the mechanisms of macroautophagy in
mammalian cells. International review of cell and molecular biology.
2008;266:207-47.
42.
Ouimet M, Franklin V, Mak E, Liao X, Tabas I, Marcel YL. Autophagy
regulates cholesterol efflux from macrophage foam cells via lysosomal acid
lipase. Cell metabolism. 2011;13:655-67.
43.
Elrick MJ, Yu T, Chung C, Lieberman AP. Impaired proteolysis underlies
autophagic dysfunction in Niemann-Pick type C disease. Human molecular
genetics. 2012;21:4876-87.
44.
Kuzu OF, Gowda R, Sharma A, Robertson GP. Leelamine mediates
cancer cell death through inhibition of intracellular cholesterol transport.
Molecular cancer therapeutics. 2014;13:1690-703.
45.
Cenedella RJ. Cholesterol synthesis inhibitor U18666A and the role of
sterol metabolism and trafficking in numerous pathophysiological processes.
Lipids. 2009;44:477-87.
46.
Cheng J, Ohsaki Y, Tauchi-Sato K, Fujita A, Fujimoto T. Cholesterol
depletion induces autophagy. Biochemical and biophysical research
communications. 2006;351:246-52.
142
47.
Huang X, Suyama K, Buchanan J, Zhu AJ, Scott MP. A Drosophila model
of the Niemann-Pick type C lysosome storage disease: dnpc1a is required for
molting and sterol homeostasis. Development. 2005;132:5115-24.
48.
Lieberman AP, Puertollano R, Raben N, Slaugenhaupt S, Walkley SU,
Ballabio A. Autophagy in lysosomal storage disorders. Autophagy. 2012;8:71930.
49.
Jeon SH, Kim SH, Kim Y, Kim YS, Lim Y, Lee YH, et al. The tricyclic
antidepressant imipramine induces autophagic cell death in U-87MG glioma
cells. Biochemical and biophysical research communications. 2011;413:311-7.
50.
Hanyaloglu AC, von Zastrow M. Regulation of GPCRs by endocytic
membrane trafficking and its potential implications. Annual review of
pharmacology and toxicology. 2008;48:537-68.
51.
Pike LJ. The challenge of lipid rafts. Journal of lipid research. 2009;50
Suppl:S323-8.
52.
Kolter T, Sandhoff K. Principles of lysosomal membrane digestion:
stimulation of sphingolipid degradation by sphingolipid activator proteins and
anionic lysosomal lipids. Annual review of cell and developmental biology.
2005;21:81-103.
53.
Linke T, Wilkening G, Lansmann S, Moczall H, Bartelsen O, Weisgerber J,
et al. Stimulation of acid sphingomyelinase activity by lysosomal lipids and
sphingolipid activator proteins. Biological chemistry. 2001;382:283-90.
54.
Kornhuber J, Tripal P, Reichel M, Muhle C, Rhein C, Muehlbacher M, et
al. Functional Inhibitors of Acid Sphingomyelinase (FIASMAs): a novel
pharmacological group of drugs with broad clinical applications. Cellular
physiology and biochemistry : international journal of experimental cellular
physiology, biochemistry, and pharmacology. 2010;26:9-20.
55.
Abdul-Hammed M, Breiden B, Adebayo MA, Babalola JO, Schwarzmann
G, Sandhoff K. Role of endosomal membrane lipids and NPC2 in cholesterol
transfer and membrane fusion. Journal of lipid research. 2010;51:1747-60.
56.
Schulze H, Sandhoff K. Sphingolipids and lysosomal pathologies.
Biochimica et biophysica acta. 2014;1841:799-810.
57.
Saftig P, Sandhoff K. Cancer: Killing from the inside. Nature.
2013;502:312-3.
58.
Reagan JW, Jr., Hubbert ML, Shelness GS. Posttranslational regulation of
acid sphingomyelinase in niemann-pick type C1 fibroblasts and free cholesterolenriched chinese hamster ovary cells. The Journal of biological chemistry.
2000;275:38104-10.
59.
Kornhuber J, Tripal P, Gulbins E, Muehlbacher M. Functional inhibitors of
acid sphingomyelinase (FIASMAs). Handbook of experimental pharmacology.
2013:169-86.
60.
Yoshida Y, Arimoto K, Sato M, Sakuragawa N, Arima M, Satoyoshi E.
Reduction of acid sphingomyelinase activity in human fibroblasts induced by AY9944 and other cationic amphiphilic drugs. Journal of biochemistry.
1985;98:1669-79.
143
61.
Schulze H, Kolter T, Sandhoff K. Principles of lysosomal membrane
degradation: Cellular topology and biochemistry of lysosomal lipid degradation.
Biochimica et biophysica acta. 2009;1793:674-83.
62.
Elojeimy S, Holman DH, Liu X, El-Zawahry A, Villani M, Cheng JC, et al.
New insights on the use of desipramine as an inhibitor for acid ceramidase.
FEBS letters. 2006;580:4751-6.
63.
Canals D, Perry DM, Jenkins RW, Hannun YA. Drug targeting of
sphingolipid metabolism: sphingomyelinases and ceramidases. British journal of
pharmacology. 2011;163:694-712.
64.
Mao X, Hou T, Cao B, Wang W, Li Z, Chen S, et al. The tricyclic
antidepressant amitriptyline inhibits D-cyclin transactivation and induces
myeloma cell apoptosis by inhibiting histone deacetylases: in vitro and in silico
evidence. Molecular pharmacology. 2011;79:672-80.
65.
Zhang Z, Du X, Zhao C, Cao B, Zhao Y, Mao X. The antidepressant
amitriptyline shows potent therapeutic activity against multiple myeloma. Anticancer drugs. 2013;24:792-8.
66.
Wiklund ED, Catts VS, Catts SV, Ng TF, Whitaker NJ, Brown AJ, et al.
Cytotoxic effects of antipsychotic drugs implicate cholesterol homeostasis as a
novel chemotherapeutic target. International journal of cancer Journal
international du cancer. 2010;126:28-40.
67.
Levkovitz Y, Gil-Ad I, Zeldich E, Dayag M, Weizman A. Differential
induction of apoptosis by antidepressants in glioma and neuroblastoma cell lines:
evidence for p-c-Jun, cytochrome c, and caspase-3 involvement. Journal of
molecular neuroscience : MN. 2005;27:29-42.
68.
Daley E, Wilkie D, Loesch A, Hargreaves IP, Kendall DA, Pilkington GJ, et
al. Chlorimipramine: a novel anticancer agent with a mitochondrial target.
Biochemical and biophysical research communications. 2005;328:623-32.
69.
Arimochi H, Morita K. Characterization of cytotoxic actions of tricyclic
antidepressants on human HT29 colon carcinoma cells. European journal of
pharmacology. 2006;541:17-23.
70.
Hsu SS, Huang CJ, Chen JS, Cheng HH, Chang HT, Jiann BP, et al.
Effect of nortriptyline on intracellular Ca2+ handling and proliferation in human
osteosarcoma cells. Basic & clinical pharmacology & toxicology. 2004;95:124-30.
71.
Wu Q, Yang Z, Nie Y, Shi Y, Fan D. Multi-drug resistance in cancer
chemotherapeutics: mechanisms and lab approaches. Cancer letters.
2014;347:159-66.
72.
Shiraishi N, Akiyama S, Kobayashi M, Kuwano M. Lysosomotropic agents
reverse multiple drug resistance in human cancer cells. Cancer letters.
1986;30:251-9.
73.
Pommerenke EW, Volm M. Reversal of doxorubicin-resistance in solid
tumors by clomipramine. In vivo. 1995;9:99-101.
74.
Ioannou YA. Multidrug permeases and subcellular cholesterol transport.
Nature reviews Molecular cell biology. 2001;2:657-68.
75.
Varga A, Nugel H, Baehr R, Marx U, Hever A, Nacsa J, et al. Reversal of
multidrug resistance by amitriptyline in vitro. Anticancer research. 1996;16:20911.
144
76.
Morita SY, Tsuda T, Horikami M, Teraoka R, Kitagawa S, Terada T. Bile
salt-stimulated phospholipid efflux mediated by ABCB4 localized in nonraft
membranes. Journal of lipid research. 2013;54:1221-30.
77.
Le May C, Berger JM, Lespine A, Pillot B, Prieur X, Letessier E, et al.
Transintestinal cholesterol excretion is an active metabolic process modulated by
PCSK9 and statin involving ABCB1. Arteriosclerosis, thrombosis, and vascular
biology. 2013;33:1484-93.
78.
Pal A, Mehn D, Molnar E, Gedey S, Meszaros P, Nagy T, et al.
Cholesterol potentiates ABCG2 activity in a heterologous expression system:
improved in vitro model to study function of human ABCG2. The Journal of
pharmacology and experimental therapeutics. 2007;321:1085-94.
79.
Jeannesson E, Siest G, Bastien B, Albertini L, Aslanidis C, Schmitz G, et
al. Association of ABCB1 gene polymorphisms with plasma lipid and
apolipoprotein concentrations in the STANISLAS cohort. Clinica chimica acta;
international journal of clinical chemistry. 2009;403:198-202.
80.
van Nieuwerk CM, Groen AK, Ottenhoff R, van Wijland M, van den Bergh
Weerman MA, Tytgat GN, et al. The role of bile salt composition in liver
pathology of mdr2 (-/-) mice: differences between males and females. Journal of
hepatology. 1997;26:138-45.
81.
Kimura Y, Morita SY, Matsuo M, Ueda K. Mechanism of multidrug
recognition by MDR1/ABCB1. Cancer science. 2007;98:1303-10.
82.
de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, et al.
Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis.
Proceedings of the National Academy of Sciences of the United States of
America. 1998;95:282-7.
83.
Fraile PQ, Hernandez EM, Martinez de Aragon A, Macias-Vidal J, Coll MJ,
Espert AN, et al. [Niemann-Pick type C disease: From neonatal cholestasis to
neurological degeneration. Different phenotypes]. Anales de pediatria.
2010;73:257-63.
84.
Choi HY, Karten B, Chan T, Vance JE, Greer WL, Heidenreich RA, et al.
Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human
Niemann-Pick type C disease. The Journal of biological chemistry.
2003;278:32569-77.
85.
Walker AJ, Card T, Bates TE, Muir K. Tricyclic antidepressants and the
incidence of certain cancers: a study using the GPRD. British journal of cancer.
2011;104:193-7.
86.
Xu W, Tamim H, Shapiro S, Stang MR, Collet JP. Use of antidepressants
and risk of colorectal cancer: a nested case-control study. The Lancet Oncology.
2006;7:301-8.
87.
Coogan PF, Strom BL, Rosenberg L. Antidepressant use and colorectal
cancer risk. Pharmacoepidemiology and drug safety. 2009;18:1111-4.
88.
Chubak J, Boudreau DM, Rulyak SJ, Mandelson MT. Colorectal cancer
risk in relation to antidepressant medication use. International journal of cancer
Journal international du cancer. 2011;128:227-32.
145
89.
Cronin-Fenton DP, Riis AH, Lash TL, Dalton SO, Friis S, Robertson D, et
al. Antidepressant use and colorectal cancer risk: a Danish population-based
case-control study. British journal of cancer. 2011;104:188-92.
90.
Hilakivi-Clarke L, Wright A, Lippman ME. DMBA-induced mammary tumor
growth in rats exhibiting increased or decreased ability to cope with stress due to
early postnatal handling or antidepressant treatment. Physiology & behavior.
1993;54:229-36.
91.
Wernli KJ, Hampton JM, Trentham-Dietz A, Newcomb PA. Antidepressant
medication use and breast cancer risk. Pharmacoepidemiology and drug safety.
2009;18:284-90.
92.
Cotterchio M, Kreiger N, Darlington G, Steingart A. Antidepressant
medication use and breast cancer risk. American journal of epidemiology.
2000;151:951-7.
93.
Halbreich U, Shen J, Panaro V. Are chronic psychiatric patients at
increased risk for developing breast cancer? The American journal of psychiatry.
1996;153:559-60.
94.
Sharpe CR, Collet JP, Belzile E, Hanley JA, Boivin JF. The effects of
tricyclic antidepressants on breast cancer risk. British journal of cancer.
2002;86:92-7.
95.
Kelly JP, Rosenberg L, Palmer JR, Rao RS, Strom BL, Stolley PD, et al.
Risk of breast cancer according to use of antidepressants, phenothiazines, and
antihistamines. American journal of epidemiology. 1999;150:861-8.
96.
Lawlor DA. Re: "antidepressant medication use and breast cancer risk".
American journal of epidemiology. 2000;152:1104; author reply 5.
97.
Fulton-Kehoe D, Rossing MA, Rutter C, Mandelson MT, Weiss NS. Use of
antidepressant medications in relation to the incidence of breast cancer. British
journal of cancer. 2006;94:1071-8.
98.
Tamim H, Boivin JF, Hanley J, Stang M, Collet JP. Risk of breast cancer
in association with exposure to two different groups of tricyclic antidepressants.
Pharmacoepidemiology and drug safety. 2006;15:689-97.
99.
Chien C, Li CI, Heckbert SR, Malone KE, Boudreau DM, Daling JR.
Antidepressant use and breast cancer risk. Breast cancer research and
treatment. 2006;95:131-40.
100. Coogan PF, Palmer JR, Strom BL, Rosenberg L. Use of selective
serotonin reuptake inhibitors and the risk of breast cancer. American journal of
epidemiology. 2005;162:835-8.
101. Gonzalez-Perez A, Garcia Rodriguez LA. Breast cancer risk among users
of antidepressant medications. Epidemiology. 2005;16:101-5.
102. Steingart A, Cotterchio M, Kreiger N, Sloan M. Antidepressant medication
use and breast cancer risk: a case-control study. International journal of
epidemiology. 2003;32:961-6.
103. Moorman PG, Grubber JM, Millikan RC, Newman B. Antidepressant
medications and their association with invasive breast cancer and carcinoma in
situ of the breast. Epidemiology. 2003;14:307-14.
146
104. Nadalin V, Cotterchio M, Kreiger N. Antihistamine use and breast cancer
risk. International journal of cancer Journal international du cancer.
2003;106:566-8.
105. Lawlor DA, Juni P, Ebrahim S, Egger M. Systematic review of the
epidemiologic and trial evidence of an association between antidepressant
medication and breast cancer. Journal of clinical epidemiology. 2003;56:155-63.
106. Weiss SR, McFarland BH, Burkhart GA, Ho PT. Cancer recurrences and
secondary primary cancers after use of antihistamines or antidepressants.
Clinical pharmacology and therapeutics. 1998;63:594-9.
107. Azoulay L, Yin H, Renoux C, Suissa S. The use of atypical antipsychotics
and the risk of breast cancer. Breast cancer research and treatment.
2011;129:541-8.
108. Linos E, Raine T, Alonso A, Michaud D. Atopy and risk of brain tumors: a
meta-analysis. Journal of the National Cancer Institute. 2007;99:1544-50.
109. McCarthy BJ, Rankin K, Il'yasova D, Erdal S, Vick N, Ali-Osman F, et al.
Assessment of type of allergy and antihistamine use in the development of
glioma. Cancer epidemiology, biomarkers & prevention : a publication of the
American Association for Cancer Research, cosponsored by the American
Society of Preventive Oncology. 2011;20:370-8.
110. Scheurer ME, El-Zein R, Thompson PA, Aldape KD, Levin VA, Gilbert MR,
et al. Long-term anti-inflammatory and antihistamine medication use and adult
glioma risk. Cancer epidemiology, biomarkers & prevention : a publication of the
American Association for Cancer Research, cosponsored by the American
Society of Preventive Oncology. 2008;17:1277-81.
111. Amirian ES, Marquez-Do D, Bondy ML, Scheurer ME. Antihistamine use
and immunoglobulin E levels in glioma risk and prognosis. Cancer epidemiology.
2013;37:908-12.
112. Mortensen PB. The incidence of cancer in schizophrenic patients. Journal
of epidemiology and community health. 1989;43:43-7.
113. Tamim HM, Mahmud S, Hanley JA, Boivin JF, Stang MR, Collet JP.
Antidepressants and risk of prostate cancer: a nested case-control study.
Prostate cancer and prostatic diseases. 2008;11:53-60.
114. Mortensen PB. Neuroleptic medication and reduced risk of prostate
cancer in schizophrenic patients. Acta psychiatrica Scandinavica. 1992;85:390-3.
115. Hippisley-Cox J, Vinogradova Y, Coupland C, Parker C. Risk of
malignancy in patients with schizophrenia or bipolar disorder: nested casecontrol study. Archives of general psychiatry. 2007;64:1368-76.
116. Guo JJ. Schizophrenia associated with increased risk of colon cancer but
reduced risk of respiratory cancer. Evidence-based mental health. 2008;11:93.
117. Maxfield FR, van Meer G. Cholesterol, the central lipid of mammalian
cells. Current opinion in cell biology. 2010;22:422-9.
118. Kennedy BE, Charman M, Karten B. Niemann-Pick Type C2 protein
contributes to the transport of endosomal cholesterol to mitochondria without
interacting with NPC1. Journal of lipid research. 2012;53:2632-42.
119. Boya P, Kroemer G. Lysosomal membrane permeabilization in cell death.
Oncogene. 2008;27:6434-51.
147
120. Yuan XM, Li W, Brunk UT, Dalen H, Chang YH, Sevanian A. Lysosomal
destabilization during macrophage damage induced by cholesterol oxidation
products. Free radical biology & medicine. 2000;28:208-18.
121. Reverter M, Rentero C, de Muga SV, Alvarez-Guaita A, Mulay V, Cairns
R, et al. Cholesterol transport from late endosomes to the Golgi regulates tSNARE trafficking, assembly, and function. Molecular biology of the cell.
2011;22:4108-23.
122. Jaattela M, Tschopp J. Caspase-independent cell death in T lymphocytes.
Nature immunology. 2003;4:416-23.
123. Tabas I. Consequences of cellular cholesterol accumulation: basic
concepts and physiological implications. The Journal of clinical investigation.
2002;110:905-11.
124. Nakamura H, Yasufuku K, Makiyama T, Matsumoto I, Fujino H, Murayama
T. Arachidonic acid metabolism via cytosolic phospholipase A2 alpha induces
cytotoxicity in niemann-pick disease type C cells. Journal of cellular physiology.
2012;227:2847-55.
125. Zhao M, Brunk UT, Eaton JW. Delayed oxidant-induced cell death
involves activation of phospholipase A2. FEBS letters. 2001;509:399-404.
126. Zhang G, Yi YP, Zhang GJ. Effects of arachidonic acid on the lysosomal
ion permeability and osmotic stability. Journal of bioenergetics and
biomembranes. 2006;38:75-82.
127. Wissing D, Mouritzen H, Egeblad M, Poirier GG, Jaattela M. Involvement
of caspase-dependent activation of cytosolic phospholipase A2 in tumor necrosis
factor-induced apoptosis. Proceedings of the National Academy of Sciences of
the United States of America. 1997;94:5073-7.
128. Roussi S, Gosse F, Aoude-Werner D, Zhang X, Marchioni E, Geoffroy P,
et al. Mitochondrial perturbation, oxidative stress and lysosomal destabilization
are involved in 7beta-hydroxysitosterol and 7beta-hydroxycholesterol triggered
apoptosis in human colon cancer cells. Apoptosis : an international journal on
programmed cell death. 2007;12:87-96.
129. Wang C, Youle RJ. The role of mitochondria in apoptosis*. Annual review
of genetics. 2009;43:95-118.
130. Lucken-Ardjomande S, Montessuit S, Martinou JC. Bax activation and
stress-induced apoptosis delayed by the accumulation of cholesterol in
mitochondrial membranes. Cell death and differentiation. 2008;15:484-93.
131. Baggetto LG, Clottes E, Vial C. Low mitochondrial proton leak due to high
membrane cholesterol content and cytosolic creatine kinase as two features of
the deviant bioenergetics of Ehrlich and AS30-D tumor cells. Cancer research.
1992;52:4935-41.
132. Yu W, Gong JS, Ko M, Garver WS, Yanagisawa K, Michikawa M. Altered
cholesterol metabolism in Niemann-Pick type C1 mouse brains affects
mitochondrial function. The Journal of biological chemistry. 2005;280:11731-9.
133. Higgins SC, Pilkington GJ. The in vitro effects of tricyclic drugs and
dexamethasone on cellular respiration of malignant glioma. Anticancer research.
2010;30:391-7.
148
134. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that
mediate cell death. Nature reviews Molecular cell biology. 2008;9:47-59.
135. Kagedal K, Johansson AC, Johansson U, Heimlich G, Roberg K, Wang
NS, et al. Lysosomal membrane permeabilization during apoptosis--involvement
of Bax? International journal of experimental pathology. 2005;86:309-21.
136. Feldstein AE, Werneburg NW, Li Z, Bronk SF, Gores GJ. Bax inhibition
protects against free fatty acid-induced lysosomal permeabilization. American
journal of physiology Gastrointestinal and liver physiology. 2006;290:G1339-46.
137. Shatz M, Liscovitch M. Caveolin-1: a tumor-promoting role in human
cancer. International journal of radiation biology. 2008;84:177-89.
138. Subtil A, Gaidarov I, Kobylarz K, Lampson MA, Keen JH, McGraw TE.
Acute cholesterol depletion inhibits clathrin-coated pit budding. Proceedings of
the National Academy of Sciences of the United States of America.
1999;96:6775-80.
139. Kuech E-M, Shammas H, Maalouf KE, von Koeckritz-Blickwede M, Das
AM, Naim HY. Lipid raft abnormalities and subsequent protein trafficking effects
in Niemann-Pick type C1 (LB158). The FASEB Journal. 2014;28:LB158.
140. Mukherjee S, Maxfield FR. Cholesterol: stuck in traffic. Nature cell biology.
1999;1:E37-8.
141. Goh LK, Sorkin A. Endocytosis of receptor tyrosine kinases. Cold Spring
Harbor perspectives in biology. 2013;5:a017459.
142. Puthenveedu MA, Yudowski GA, von Zastrow M. Endocytosis of
neurotransmitter receptors: location matters. Cell. 2007;130:988-9.
143. Fletcher R, Gribben C, Ma X, Burchfield JG, Thomas KC, Krycer JR, et al.
The role of the niemann-pick disease, type c1 protein in adipocyte insulin action.
PloS one. 2014;9:e95598.
144. Ong QR, Lim ML, Chua CC, Cheung NS, Wong BS. Impaired insulin
signaling in an animal model of Niemann-Pick Type C disease. Biochemical and
biophysical research communications. 2012;424:482-7.
145. Romanelli RJ, LeBeau AP, Fulmer CG, Lazzarino DA, Hochberg A, Wood
TL. Insulin-like growth factor type-I receptor internalization and recycling mediate
the sustained phosphorylation of Akt. The Journal of biological chemistry.
2007;282:22513-24.
146. Ceresa BP, Kao AW, Santeler SR, Pessin JE. Inhibition of clathrinmediated endocytosis selectively attenuates specific insulin receptor signal
transduction pathways. Molecular and cellular biology. 1998;18:3862-70.
147. Chow JC, Condorelli G, Smith RJ. Insulin-like growth factor-I receptor
internalization regulates signaling via the Shc/mitogen-activated protein kinase
pathway, but not the insulin receptor substrate-1 pathway. The Journal of
biological chemistry. 1998;273:4672-80.
148. Shah M, Patel K, Mukhopadhyay S, Xu F, Guo G, Sehgal PB. Membraneassociated STAT3 and PY-STAT3 in the cytoplasm. The Journal of biological
chemistry. 2006;281:7302-8.
149. Yamashiro DJ, Maxfield FR. Acidification of endocytic compartments and
the intracellular pathways of ligands and receptors. Journal of cellular
biochemistry. 1984;26:231-46.
149
150. Mercer J, Schelhaas M, Helenius A. Virus entry by endocytosis. Annual
review of biochemistry. 2010;79:803-33.
151. Carette JE, Raaben M, Wong AC, Herbert AS, Obernosterer G, Mulherkar
N, et al. Ebola virus entry requires the cholesterol transporter Niemann-Pick C1.
Nature. 2011;477:340-3.
152. Cote M, Misasi J, Ren T, Bruchez A, Lee K, Filone CM, et al. Small
molecule inhibitors reveal Niemann-Pick C1 is essential for Ebola virus infection.
Nature. 2011;477:344-8.
153. Wei H, Kim SJ, Zhang Z, Tsai PC, Wisniewski KE, Mukherjee AB. ER and
oxidative stresses are common mediators of apoptosis in both
neurodegenerative and non-neurodegenerative lysosomal storage disorders and
are alleviated by chemical chaperones. Human molecular genetics. 2008;17:46977.
154. Ridsdale A, Denis M, Gougeon PY, Ngsee JK, Presley JF, Zha X.
Cholesterol is required for efficient endoplasmic reticulum-to-Golgi transport of
secretory membrane proteins. Molecular biology of the cell. 2006;17:1593-605.
155. Vitner EB, Platt FM, Futerman AH. Common and uncommon pathogenic
cascades in lysosomal storage diseases. The Journal of biological chemistry.
2010;285:20423-7.
156. Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of
endoplasmic reticulum resident chaperone genes in the unfolded protein
response. Molecular and cellular biology. 2003;23:7448-59.
157. Hori O, Ichinoda F, Yamaguchi A, Tamatani T, Taniguchi M, Koyama Y, et
al. Role of Herp in the endoplasmic reticulum stress response. Genes to cells :
devoted to molecular & cellular mechanisms. 2004;9:457-69.
158. Meir O, Dvash E, Werman A, Rubinstein M. C/EBP-beta regulates
endoplasmic reticulum stress-triggered cell death in mouse and human models.
PloS one. 2010;5:e9516.
159. Varadarajan S, Bampton ET, Smalley JL, Tanaka K, Caves RE,
Butterworth M, et al. A novel cellular stress response characterised by a rapid
reorganisation of membranes of the endoplasmic reticulum. Cell death and
differentiation. 2012;19:1896-907.
160. Larroque-Cardoso P, Swiader A, Ingueneau C, Negre-Salvayre A, Elbaz
M, Reyland ME, et al. Role of protein kinase C delta in ER stress and apoptosis
induced by oxidized LDL in human vascular smooth muscle cells. Cell death &
disease. 2013;4:e520.
161. Yadav V, Yanez NC, Fenton SE, Denning MF. Loss of protein kinase C
delta gene expression in human squamous cell carcinomas: a laser capture
microdissection study. The American journal of pathology. 2010;176:1091-6.
162. Lin C-C, Ou H-C, Pi I, You Y-C. Baicalein attenuates oxLDL-induced
oxidative functional damages in endothelial cells. The FASEB Journal. 2010.
163. Kyo R, Nakahata N, Sakakibara I, Kubo M, Ohizumi Y. Baicalin and
baicalein, constituents of an important medicinal plant, inhibit intracellular Ca2+
elevation by reducing phospholipase C activity in C6 rat glioma cells. The Journal
of pharmacy and pharmacology. 1998;50:1179-82.
150
164. Choi JH, Choi AY, Yoon H, Choe W, Yoon KS, Ha J, et al. Baicalein
protects HT22 murine hippocampal neuronal cells against endoplasmic reticulum
stress-induced apoptosis through inhibition of reactive oxygen species production
and CHOP induction. Experimental & molecular medicine. 2010;42:811-22.
165. Chang WT, Li J, Haung HH, Liu H, Han M, Ramachandran S, et al.
Baicalein protects against doxorubicin-induced cardiotoxicity by attenuation of
mitochondrial oxidant injury and JNK activation. Journal of cellular biochemistry.
2011;112:2873-81.
166. Qi X, Mochly-Rosen D. The PKCdelta -Abl complex communicates ER
stress to the mitochondria - an essential step in subsequent apoptosis. Journal of
cell science. 2008;121:804-13.
167. Storz P, Doppler H, Toker A. Protein kinase Cdelta selectively regulates
protein kinase D-dependent activation of NF-kappaB in oxidative stress signaling.
Molecular and cellular biology. 2004;24:2614-26.
168. Hurd C, Waldron RT, Rozengurt E. Protein kinase D complexes with CJun N-terminal kinase via activation loop phosphorylation and phosphorylates the
C-Jun N-terminus. Oncogene. 2002;21:2154-60.
169. Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Mueller HJ, Johannes
FJ. Inhibition of protein kinase C mu by various inhibitors. Differentiation from
protein kinase c isoenzymes. FEBS letters. 1996;392:77-80.
170. Fehrenbacher N, Bastholm L, Kirkegaard-Sorensen T, Rafn B, Bottzauw
T, Nielsen C, et al. Sensitization to the lysosomal cell death pathway by
oncogene-induced down-regulation of lysosome-associated membrane proteins
1 and 2. Cancer research. 2008;68:6623-33.
171. Gowda R, Madhunapantula SV, Kuzu OF, Sharma A, Robertson GP.
Targeting multiple key signaling pathways in melanoma using leelamine.
Molecular cancer therapeutics. 2014;13:1679-89.
172. Petersen NH, Olsen OD, Groth-Pedersen L, Ellegaard AM, Bilgin M,
Redmer S, et al. Transformation-associated changes in sphingolipid metabolism
sensitize cells to lysosomal cell death induced by inhibitors of acid
sphingomyelinase. Cancer cell. 2013;24:379-93.
173. Schneede A, Schmidt CK, Holtta-Vuori M, Heeren J, Willenborg M, Blanz
J, et al. Role for LAMP-2 in endosomal cholesterol transport. Journal of cellular
and molecular medicine. 2011;15:280-95.
174. Weinstein IB, Joe A. Oncogene addiction. Cancer research.
2008;68:3077-80; discussion 80.
175. Yan R, Hallam A, Stockley PG, Boyes J. Oncogene dependency and the
potential of targeted RNAi-based anti-cancer therapy. The Biochemical journal.
2014;461:1-13.
176. Arkenau HT, Kefford R, Long GV. Targeting BRAF for patients with
melanoma. British journal of cancer. 2011;104:392-8.
177. Tas F. Metastatic behavior in melanoma: timing, pattern, survival, and
influencing factors. Journal of oncology. 2012;2012:647684.
178. Wang AX, Qi XY. Targeting RAS/RAF/MEK/ERK signaling in metastatic
melanoma. IUBMB life. 2013;65:748-58.
151
179. Finn L, Markovic SN, Joseph RW. Therapy for metastatic melanoma: the
past, present, and future. BMC medicine. 2012;10:23.
180. Newman DJ, Cragg GM. Natural products as sources of new drugs over
the last 25 years. Journal of natural products. 2007;70:461-77.
181. Aicher TD, Damon RE, Koletar J, Vinluan CC, Brand LJ, Gao J, et al.
Triterpene and diterpene inhibitors of pyruvate dehydrogenase kinase (PDK).
Bioorganic & medicinal chemistry letters. 1999;9:2223-8.
182. Lovinger DM. Presynaptic modulation by endocannabinoids. Handbook of
experimental pharmacology. 2008:435-77.
183. N'Diaye EN, Kajihara KK, Hsieh I, Morisaki H, Debnath J, Brown EJ. PLIC
proteins or ubiquilins regulate autophagy-dependent cell survival during nutrient
starvation. EMBO reports. 2009;10:173-9.
184. Gowda R, Madhunapantula SV, Desai D, Amin S, Robertson GP.
Selenium-containing histone deacetylase inhibitors for melanoma management.
Cancer biology & therapy. 2012;13:756-65.
185. Cheadle C, Vawter MP, Freed WJ, Becker KG. Analysis of microarray
data using Z score transformation. The Journal of molecular diagnostics : JMD.
2003;5:73-81.
186. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification.
Canadian journal of biochemistry and physiology. 1959;37:911-7.
187. Kupke IR, Zeugner S. Quantitative high-performance thin-layer
chromatography of lipids in plasma and liver homogenates after direct application
of 0.5-microliter samples to the silica-gel layer. Journal of chromatography.
1978;146:261-71.
188. Klionsky DJ, Abeliovich H, Agostinis P, Agrawal DK, Aliev G, Askew DS,
et al. Guidelines for the use and interpretation of assays for monitoring
autophagy in higher eukaryotes. Autophagy. 2008;4:151-75.
189. Settembre C, Fraldi A, Jahreiss L, Spampanato C, Venturi C, Medina D, et
al. A block of autophagy in lysosomal storage disorders. Human molecular
genetics. 2008;17:119-29.
190. Futerman AH, van Meer G. The cell biology of lysosomal storage
disorders. Nature reviews Molecular cell biology. 2004;5:554-65.
191. Ishizaki J, Yokogawa K, Ichimura F, Ohkuma S. Uptake of imipramine in
rat liver lysosomes in vitro and its inhibition by basic drugs. The Journal of
pharmacology and experimental therapeutics. 2000;294:1088-98.
192. Geng Y, Kohli L, Klocke BJ, Roth KA. Chloroquine-induced autophagic
vacuole accumulation and cell death in glioma cells is p53 independent. Neurooncology. 2010;12:473-81.
193. Lemieux B, Percival MD, Falgueyret JP. Quantitation of the
lysosomotropic character of cationic amphiphilic drugs using the fluorescent
basic amine Red DND-99. Analytical biochemistry. 2004;327:247-51.
194. Belmokhtar CA, Hillion J, Segal-Bendirdjian E. Staurosporine induces
apoptosis through both caspase-dependent and caspase-independent
mechanisms. Oncogene. 2001;20:3354-62.
152
195. Liu CY, Takemasa A, Liles WC, Goodman RB, Jonas M, Rosen H, et al.
Broad-spectrum caspase inhibition paradoxically augments cell death in TNFalpha -stimulated neutrophils. Blood. 2003;101:295-304.
196. Chen LB. Mitochondrial membrane potential in living cells. Annual review
of cell biology. 1988;4:155-81.
197. Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the
release of apoptogenic cytochrome c by the mitochondrial channel VDAC.
Nature. 1999;399:483-7.
198. Cadoudal T, Distel E, Durant S, Fouque F, Blouin JM, Collinet M, et al.
Pyruvate dehydrogenase kinase 4: regulation by thiazolidinediones and
implication in glyceroneogenesis in adipose tissue. Diabetes. 2008;57:2272-9.
199. Blazquez C, Carracedo A, Barrado L, Real PJ, Fernandez-Luna JL,
Velasco G, et al. Cannabinoid receptors as novel targets for the treatment of
melanoma. FASEB journal : official publication of the Federation of American
Societies for Experimental Biology. 2006;20:2633-5.
200. Kobayashi T, Beuchat MH, Lindsay M, Frias S, Palmiter RD, Sakuraba H,
et al. Late endosomal membranes rich in lysobisphosphatidic acid regulate
cholesterol transport. Nature cell biology. 1999;1:113-8.
201. Lange Y, Ye J, Rigney M, Steck T. Cholesterol movement in NiemannPick type C cells and in cells treated with amphiphiles. The Journal of biological
chemistry. 2000;275:17468-75.
202. Schneider P, Korolenko TA, Busch U. A review of drug-induced lysosomal
disorders of the liver in man and laboratory animals. Microscopy research and
technique. 1997;36:253-75.
203. Matsuo M, Togawa M, Hirabaru K, Mochinaga S, Narita A, Adachi M, et al.
Effects of cyclodextrin in two patients with Niemann-Pick Type C disease.
Molecular genetics and metabolism. 2013;108:76-81.
204. Maxfield FR, McGraw TE. Endocytic recycling. Nature reviews Molecular
cell biology. 2004;5:121-32.
205. Sobo K, Le Blanc I, Luyet PP, Fivaz M, Ferguson C, Parton RG, et al. Late
endosomal cholesterol accumulation leads to impaired intra-endosomal
trafficking. PloS one. 2007;2:e851.
206. Zhang M, Dwyer NK, Love DC, Cooney A, Comly M, Neufeld E, et al.
Cessation of rapid late endosomal tubulovesicular trafficking in Niemann-Pick
type C1 disease. Proceedings of the National Academy of Sciences of the United
States of America. 2001;98:4466-71.
207. Pause A, Belsham GJ, Gingras AC, Donze O, Lin TA, Lawrence JC, Jr., et
al. Insulin-dependent stimulation of protein synthesis by phosphorylation of a
regulator of 5'-cap function. Nature. 1994;371:762-7.
208. Basque J, Martel M, Leduc R, Cantin AM. Lysosomotropic drugs inhibit
maturation of transforming growth factor-beta. Canadian journal of physiology
and pharmacology. 2008;86:606-12.
209. Incardona JP, Eaton S. Cholesterol in signal transduction. Current opinion
in cell biology. 2000;12:193-203.
153
210. Wang Y, Thiele C, Huttner WB. Cholesterol is required for the formation of
regulated and constitutive secretory vesicles from the trans-Golgi network.
Traffic. 2000;1:952-62.
211. Bastiaanse EM, Hold KM, Van der Laarse A. The effect of membrane
cholesterol content on ion transport processes in plasma membranes.
Cardiovascular research. 1997;33:272-83.
212. Simons K, Ikonen E. How cells handle cholesterol. Science.
2000;290:1721-6.
213. Sztolsztener ME, Dobrzyn A, Pikula S, Tylki-Szymanska A, BandorowiczPikula J. Impaired dynamics of the late endosome/lysosome compartment in
human Niemann-Pick type C skin fibroblasts carrying mutation in NPC1 gene.
Molecular bioSystems. 2012;8:1197-205.
214. Pacheco CD, Kunkel R, Lieberman AP. Autophagy in Niemann-Pick C
disease is dependent upon Beclin-1 and responsive to lipid trafficking defects.
Human molecular genetics. 2007;16:1495-503.
215. Sorkin A, von Zastrow M. Endocytosis and signalling: intertwining
molecular networks. Nature reviews Molecular cell biology. 2009;10:609-22.
216. Kholodenko BN. Four-dimensional organization of protein kinase signaling
cascades: the roles of diffusion, endocytosis and molecular motors. The Journal
of experimental biology. 2003;206:2073-82.
217. Gschwind A, Fischer OM, Ullrich A. The discovery of receptor tyrosine
kinases: targets for cancer therapy. Nature reviews Cancer. 2004;4:361-70.
218. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al.
Mutations of the BRAF gene in human cancer. Nature. 2002;417:949-54.
219. Stahl JM, Sharma A, Cheung M, Zimmerman M, Cheng JQ, Bosenberg
MW, et al. Deregulated Akt3 activity promotes development of malignant
melanoma. Cancer research. 2004;64:7002-10.
220. Sangai T, Akcakanat A, Chen H, Tarco E, Wu Y, Do KA, et al. Biomarkers
of response to Akt inhibitor MK-2206 in breast cancer. Clinical cancer research :
an official journal of the American Association for Cancer Research.
2012;18:5816-28.
221. Zhang W, Zong CS, Hermanto U, Lopez-Bergami P, Ronai Z, Wang LH.
RACK1 recruits STAT3 specifically to insulin and insulin-like growth factor 1
receptors for activation, which is important for regulating anchorage-independent
growth. Molecular and cellular biology. 2006;26:413-24.
222. Bromberg J, Darnell JE, Jr. The role of STATs in transcriptional control
and their impact on cellular function. Oncogene. 2000;19:2468-73.
223. Frank DA. STAT signaling in the pathogenesis and treatment of cancer.
Molecular medicine. 1999;5:432-56.
224. Niu G, Bowman T, Huang M, Shivers S, Reintgen D, Daud A, et al. Roles
of activated Src and Stat3 signaling in melanoma tumor cell growth. Oncogene.
2002;21:7001-10.
225. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA: a cancer
journal for clinicians. 2013;63:11-30.
226. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM,
Matrisian LM. Projecting cancer incidence and deaths to 2030: the unexpected
154
burden of thyroid, liver, and pancreas cancers in the United States. Cancer
research. 2014;74:2913-21.
227. Settleman J. Optimizing the treatment of BRAF mutant melanoma.
Genome medicine. 2014;6:30.
228. Wiley HS, Burke PM. Regulation of receptor tyrosine kinase signaling by
endocytic trafficking. Traffic. 2001;2:12-8.
229. Chen N, Karantza V. Autophagy as a therapeutic target in cancer. Cancer
biology & therapy. 2011;11:157-68.
230. Vanier MT. Niemann-Pick disease type C. Orphanet journal of rare
diseases. 2010;5:16.
231. Kornhuber J, Muehlbacher M, Trapp S, Pechmann S, Friedl A, Reichel M,
et al. Identification of novel functional inhibitors of acid sphingomyelinase. PloS
one. 2011;6:e23852.
232. Kornhuber J, Tripal P, Reichel M, Terfloth L, Bleich S, Wiltfang J, et al.
Identification of new functional inhibitors of acid sphingomyelinase using a
structure-property-activity relation model. Journal of medicinal chemistry.
2008;51:219-37.
233. Kaufmann AM, Krise JP. Niemann-Pick C1 functions in regulating
lysosomal amine content. The Journal of biological chemistry. 2008;283:2458493.
234. Zoncu R, Bar-Peled L, Efeyan A, Wang S, Sancak Y, Sabatini DM.
mTORC1 senses lysosomal amino acids through an inside-out mechanism that
requires the vacuolar H(+)-ATPase. Science. 2011;334:678-83.
235. Liu AP, Aguet F, Danuser G, Schmid SL. Local clustering of transferrin
receptors promotes clathrin-coated pit initiation. The Journal of cell biology.
2010;191:1381-93.
236. Sorkin A, Von Zastrow M. Signal transduction and endocytosis: close
encounters of many kinds. Nature reviews Molecular cell biology. 2002;3:600-14.
237. Sloane BF, Honn KV, Sadler JG, Turner WA, Kimpson JJ, Taylor JD.
Cathepsin B activity in B16 melanoma cells: a possible marker for metastatic
potential. Cancer research. 1982;42:980-6.
238. Matarrese P, Ascione B, Ciarlo L, Vona R, Leonetti C, Scarsella M, et al.
Cathepsin B inhibition interferes with metastatic potential of human melanoma:
an in vitro and in vivo study. Molecular cancer. 2010;9:207.
239. Galluzzi L, Vitale I, Abrams JM, Alnemri ES, Baehrecke EH, Blagosklonny
MV, et al. Molecular definitions of cell death subroutines: recommendations of
the Nomenclature Committee on Cell Death 2012. Cell death and differentiation.
2012;19:107-20.
240. Ly JD, Grubb DR, Lawen A. The mitochondrial membrane potential
(deltapsi(m)) in apoptosis; an update. Apoptosis : an international journal on
programmed cell death. 2003;8:115-28.
241. Smaili SS, Hsu YT, Sanders KM, Russell JT, Youle RJ. Bax translocation
to mitochondria subsequent to a rapid loss of mitochondrial membrane potential.
Cell death and differentiation. 2001;8:909-20.
242. Gomez-Crisostomo NP, Lopez-Marure R, Zapata E, Zazueta C, MartinezAbundis E. Bax induces cytochrome c release by multiple mechanisms in
155
mitochondria from MCF7 cells. Journal of bioenergetics and biomembranes.
2013;45:441-8.
243. Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES,
Baehrecke EH, et al. Classification of cell death: recommendations of the
Nomenclature Committee on Cell Death 2009. Cell death and differentiation.
2009;16:3-11.
244. Vanier MT. Niemann-Pick diseases. Handbook of clinical neurology.
2013;113:1717-21.
245. Leventhal AR, Chen W, Tall AR, Tabas I. Acid sphingomyelinase-deficient
macrophages have defective cholesterol trafficking and efflux. The Journal of
biological chemistry. 2001;276:44976-83.
246. Chang TY, Reid PC, Sugii S, Ohgami N, Cruz JC, Chang CC. NiemannPick type C disease and intracellular cholesterol trafficking. The Journal of
biological chemistry. 2005;280:20917-20.
247. Roff CF, Goldin E, Comly ME, Cooney A, Brown A, Vanier MT, et al. Type
C Niemann-Pick disease: use of hydrophobic amines to study defective
cholesterol transport. Developmental neuroscience. 1991;13:315-9.
248. Mannhold R, Kubinyi H, Timmerman H, Pliska V, Testa B, Waterbeemd H.
Lipophilicity in drug action and toxicology: John Wiley & Sons; 2008.
249. Lipinski CA, Lombardo F, Dominy BW, Feeney PJ. Experimental and
computational approaches to estimate solubility and permeability in drug
discovery and development settings. Advanced drug delivery reviews. 2001;46:326.
250. Lieb J. Defeating cancer with antidepressants. Ecancermedicalscience.
2008;2:88.
251. Lieb J. The multifaceted value of antidepressants in cancer therapeutics.
European journal of cancer. 2008;44:172-4.
252. Perez-Alvarez S, Iglesias-Guimarais V, Solesio ME, Melero-Fernandez de
Mera RM, Yuste VJ, Galindo MF, et al. Methadone induces CAD degradation
and AIF-mediated necrotic-like cell death in neuroblastoma cells.
Pharmacological research : the official journal of the Italian Pharmacological
Society. 2011;63:352-60.
253. Gil-Ad I, Shtaif B, Levkovitz Y, Nordenberg J, Taler M, Korov I, et al.
Phenothiazines induce apoptosis in a B16 mouse melanoma cell line and
attenuate in vivo melanoma tumor growth. Oncology reports. 2006;15:107-12.
254. Fan D, Poste G, Seid C, Earnest LE, Bull T, Clyne RK, et al. Reversal of
multidrug resistance in murine fibrosarcoma cells by thioxanthene flupentixol.
Investigational new drugs. 1994;12:185-95.
255. Arimochi H, Morita K. Desipramine induces apoptotic cell death through
nonmitochondrial and mitochondrial pathways in different types of human colon
carcinoma cells. Pharmacology. 2008;81:164-72.
256. Davies MA. The role of the PI3K-AKT pathway in melanoma. Cancer
journal. 2012;18:142-7.
257. Kortylewski M, Jove R, Yu H. Targeting STAT3 affects melanoma on
multiple fronts. Cancer metastasis reviews. 2005;24:315-27.
156
258. Xie TX, Huang FJ, Aldape KD, Kang SH, Liu M, Gershenwald JE, et al.
Activation of stat3 in human melanoma promotes brain metastasis. Cancer
research. 2006;66:3188-96.
259. Tsuruta F, Masuyama N, Gotoh Y. The phosphatidylinositol 3-kinase
(PI3K)-Akt pathway suppresses Bax translocation to mitochondria. The Journal
of biological chemistry. 2002;277:14040-7.
260. Boya P, Gonzalez-Polo RA, Poncet D, Andreau K, Vieira HL, Roumier T,
et al. Mitochondrial membrane permeabilization is a critical step of lysosomeinitiated apoptosis induced by hydroxychloroquine. Oncogene. 2003;22:3927-36.
261. Rodriguez-Enfedaque A, Delmas E, Guillaume A, Gaumer S, Mignotte B,
Vayssiere JL, et al. zVAD-fmk upregulates caspase-9 cleavage and activity in
etoposide-induced cell death of mouse embryonic fibroblasts. Biochimica et
biophysica acta. 2012;1823:1343-52.
262. Lademann U, Cain K, Gyrd-Hansen M, Brown D, Peters D, Jaattela M.
Diarylurea compounds inhibit caspase activation by preventing the formation of
the active 700-kilodalton apoptosome complex. Molecular and cellular biology.
2003;23:7829-37.
263. Cui Q, Yu JH, Wu JN, Tashiro S, Onodera S, Minami M, et al. P53mediated cell cycle arrest and apoptosis through a caspase-3- independent, but
caspase-9-dependent pathway in oridonin-treated MCF-7 human breast cancer
cells. Acta pharmacologica Sinica. 2007;28:1057-66.
264. Ontario Clinical Oncology G, Hamilton Health Sciences C, Juravinski
Cancer Centre F. Safety Study of Thioridazine in Combination With Cytarabine to
Treat Relapsed or Refractory Acute Myeloid Leukemia. 2015.
265. Cleveland B. Quinacrine Treatment in Patients With AndrogenIndependent Prostate Cancer. 2008.
266. Joel N, Stanford U. Phase IIa Desipramine in Small Cell Lung Cancer and
Other High-Grade Neuroendocrine Tumors. 2014.
267. Immune C. Study of Fluphenazine in Relapsed or Relapsed-andRefractory Multiple Myeloma. 2010.
268. Sidney Kimmel Comprehensive Cancer C, National Cancer I, Tau
Therapeutics LLC. Mibefradil Dihydrochloride and Temozolomide in Treating
Patients With Recurrent Glioma. 2015.
269. Jahchan NS, Dudley JT, Mazur PK, Flores N, Yang D, Palmerton A, et al.
A drug repositioning approach identifies tricyclic antidepressants as inhibitors of
small cell lung cancer and other neuroendocrine tumors. Cancer discovery.
2013;3:1364-77.
270. Laird B, Colvin L, Fallon M. Management of cancer pain: basic principles
and neuropathic cancer pain. European journal of cancer. 2008;44:1078-82.
271. Dimelow RJ, Metcalfe PD, Thomas S. In Silico Models of Drug Metabolism
and Drug Interactions. Encyclopedia of Drug Metabolism and Interactions. 2012.
272. Souza VB, Moura Filho FJ, Souza FG, Rocha CF, Furtado FA, Goncalves
TB, et al. Cataract occurrence in patients treated with antipsychotic drugs.
Revista brasileira de psiquiatria. 2008;30:222-6.
157
273. Smith D, Pantelis C, McGrath J, Tangas C, Copolov D. Ocular
abnormalities in chronic schizophrenia: clinical implications. The Australian and
New Zealand journal of psychiatry. 1997;31:252-6.
274. Etminan M, Mikelberg FS, Brophy JM. Selective serotonin reuptake
inhibitors and the risk of cataracts: a nested case-control study. Ophthalmology.
2010;117:1251-5.
Curriculum Vitae
Ömer Faruk KUZU
EDUCATION:
2011- to present
2009-2011
2003-2008:
Ph.D., Genetics Department,
Penn State University, College of Medicine
Master of Science, Genetics Department,
Penn State University, College of Medicine
Bachelors of Science,
Molecular Biology and Genetics Department,
Bilkent University, Turkey
PUBLICATIONS:
Kuzu OF, Gowda R, Sharma A, Robertson GP. Leelamine mediates cancer cell death
through inhibition of intracellular cholesterol transport, Mol Cancer Ther. 2014
Jul;13(7):1690-703.
Gowda R, Madhunapantula SV, Kuzu OF, Sharma A, Robertson GP. Targeting
multiple key signaling pathways in melanoma using leelamine, Mol Cancer Ther.
2014 Jul;13(7):1679-89.
Gowda R, Madhunapantula SV, Sharma A, Kuzu OF, Robertson GP Nanolipolee007, a novel nanoparticle based drug containing leelamine for the treatment of
melanoma, Mol Cancer Ther. 2014 Jul 31
AWARDS:
2011 Student Award for Excellence in Innovation, Penn State University, College of
Medicine
PROVISIONAL PATENTS/PATENTS/LICENSING OF PATENTS
1. Composition and methods relating to proliferative diseases. Inventors: Robertson
GP., Gowda R, Subbarao Madhunapantula, Kuzu OF, Gajanan Inamdar. 2013/10/16.
WO Patent publication number: EP2648706 A2.
PRESENTATIONS AND PUBLISHED ABSTRACTS
Gowda R, Madhunapantula SV, Kuzu OF, Sharma A and Robertson GP. Naturally
occurring leelamine inhibits melanoma development by targeting multiple. AACR104 th Annual meeting, Washington, DC, April 6-10th, 2013. (Poster Presentation)
Kuzu OF, Raghavendra Gowda, Arati Sharma, G. P. Robertson. Leelamine targets
the sucide bags of the cells. 25 th Annual Graduate Student Research Forum, Penn
State College of Medicine, Penn State University, Hershey, PA 17033 held on March
1, 2013. (Oral Presentation)
Kuzu OF, Gowda R, Madhunapantula SV, Sharma A, Robertson GP. Using protein
arrays and system biology to identify targets of leelamine. International Melanoma
Congress, Tampa, USA, 2011. (Poster Presentation)