Download A Comparison of Murine and Human Factor XI

From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
A Comparison of Murine and Human Factor XI
By David Gailani, Mao-Fu Sun, and Yuehui Sun
Factor XI is a plasma glycoprotein that is required for contact
activation initiated fibrin formation in vitro and for normal
hemostasis in vivo. In preparation for developing a mouse
model of factor XI deficiency to facilitate investigations into
this protease’s contributions to coagulation, we cloned the
complementary DNA for murine factor XI, expressed the protein in a mammalian expression system, and compared its
properties with human recombinant factor XI. The 2.8-kb
murine cDNA codes for a protein of 624 amino acids with
78% homology to human factor XI. Both recombinant murine and human factor XI are 160 kD homodimers comprised
of two 80 kD polypeptides connected by disulfide bonds.
Murine factor XI shortens the clotting time of human factor
XI deficient plasma in an activated partial thromboplastin
time assay, with a specific activity 50% to 70% that of the
human protein. In a purified system, murine factor XI is acti-
vated by human factor XIIa and thrombin in the presence of
dextran sulfate. Murine factor XI differs from human factor
XI in that it undergoes autoactivation slowly in the presence
of dextran sulfate. This is due primarily to murine factor XIa
preferentially cleaving a site on zymogen factor XI within
the light chain, rather than the activation site between Arg371
and Val372. Northern blots of polyadenylated messenger RNA
show that murine factor XI message is expressed, as expected, primarily in the liver. In contrast, messenger RNA
for human factor XI was identified in liver, pancreas, and
kidney. The studies show that murine and human factor XI
have similar structural and enzymatic properties. However,
there may be variations in tissue specific expression and
subtle differences in enzyme activity across species.
q 1997 by The American Society of Hematology.
F
sity, St Louis, MO).16 Human factor XI and prekallikrein cDNAs
were gifts from D. Chung and E. Davie (University of Washington,
Seattle).17,18 Human factor XII cDNA was a gift from R. MacGillvary
(University of British Columbia, Vancouver, Canada).19 Multitissue
polyA RNA northern blots for human and murine tissues and polyA
enriched RNA from murine liver and pancreas were purchased from
Clonetech (Palo Alto, CA).
Tissue culture. The 293 transformed human embryonal kidney
cell line was purchased from American Tissue Type Collection,
Rockville, MD (ATCC CRL 1573). Dulbecco’s modified Eagle medium (DMEM) and G418 (geneticin) were from GIBCO/BRL,
Gaithersburg, MD and Cellgro complete media was from Fisher
Scientific (Pittsburgh, PA). Soy bean trypsin inhibitor (SBTI), lima
bean trypsin inhibitor (LBTI), and aprotinin were from Sigma Chemicals, St Louis, MO.
Proteins and reagents for protein purification and Western blots.
Benzamidine, heparin agarose, nitroblue tetrazolium (NBT), and 5bromo-4-chloro-3-indolyl phosphate (BCIP) were purchased from
Sigma Chemicals. S-sepharose fast flow resin and a Superose-12
chromatography column were from Pharmacia Biotech (Piscataway,
NJ). Rabbit polyclonal antiserum against human factor XI was raised
using standard techniques,20 and IgG was purified from serum by
staphylococcal protein A chromatography. Purified human factors
XIIa, IX, and X were purchased from Enzyme Research Laboratories
(South Bend, IN). Human thrombin was prepared as previously described.21 Recombinant factor VIII was obtained from Baxter/Hyland
(Glendale, CA).
Plasmas and reagents for clotting assays. Pooled normal human
ACTOR XI is the zymogen of a plasma serine protease
that activates factor IX by limited proteolysis.1 The
importance of this protein in normal hemostasis is demonstrated by the hemorrhagic diathesis associated with congenital factor XI deficiency in humans, dogs, and cattle.2-4 The
physiologic mechanisms by which factor XI is activated and
the contribution this protease makes to normal hemostasis
are presently the topic of much debate. Activated factor XII
(factor XIIa), thrombin, and activated factor XI (factor XIa)
have all been shown to activate human factor XI in vitro
under various conditions5-11; however, the relevance of these
observations to coagulation in vivo remains to be determined. Furthermore, while it is generally agreed that factor
XIa contributes to hemostasis by activating factor IX, it is
not clear if this step is required for initial thrombin formation
or for consolidation of hemostasis after initial formation of
the fibrin clot through the extrinsic (factor VIIa/tissue factor)
pathway.11-15
An animal model of factor XI deficiency would greatly
facilitate investigations into the role of this protein in normal
and pathologic coagulation. Although factor XI deficiency
has been reported in Holstein cattle and sporadically in
dogs,3,4 there are currently no animal models of factor XI
deficiency that are easily adapted to a laboratory setting.
In preparation for developing a murine model of factor XI
deficiency (factor XI ‘‘knockout’’ mouse) to address this
problem, we have cloned the complementary DNA (cDNA)
for murine factor XI and expressed murine and human factor
XI in a mammalian cell culture system. The murine and
human cDNAs and the recombinant factor XI proteins were
used to compare the structural homology and relative activities of the two proteins, as well as to examine the expression
of factor XI messenger RNA in different tissues. Murine
and human factor XI are structurally very similar and have
relatively similar enzymatic activities. Unlike human factor
XI, the murine protein will not undergo autoactivation in the
presence of dextran sulfate. Factor XI mRNA was identified
in liver tissue from both species, however, expression was
also noted in human pancreas and kidney tissue.
MATERIALS AND METHODS
Materials and Reagents
Molecular biology reagents. A murine liver cDNA library in
Lamda Zap vector was a gift from R. Wetzel (Washington Univer-
From the Department of Pathology and Division of Hematology,
Vanderbilt University School of Medicine, Nashville, TN.
Submitted October 4, 1996; accepted March 31, 1997.
Supported by Grant No. HL02917 to D.G. from the National
Heart, Lung and Blood Institute (Bethesda, MD). Y.S. is an Ortho
Biotech Hematology Fellow.
Address reprint requests to David Gailani, MD, The Department
of Pathology and Division of Hematology, Vanderbilt University
School of Medicine, 538 Medical Research Bldg II, 2220 Pierce
Ave, Nashville, TN 37232-6350.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
q 1997 by The American Society of Hematology.
0006-4971/97/9003-0015$3.00/0
Blood, Vol 90, No 3 (August 1), 1997: pp 1055-1064
AID
Blood 0003
/
5h3a$$$$41
1055
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1056
GAILANI, SUN, AND SUN
plasma, human factor XI, and factor IX-deficient plasmas were from
George King Biomedical (Overland Park, KS). Normal murine
plasma in 0.38% sodium citrate was from Pel-Freez Biologicals
(Rogers, AK). Thrombosil aPTT reagent was from Ortho Diagnostic
(Raratan, NJ).
Chromogenic substrates. Substrates S-2366 and S-2765 were
from DiaPharma Group (Malmo, Sweden).
Buffers and solutions. 201 SSC is 3.0 mol/L sodium chloride,
0.3 mol/L sodium citrate, pH 7.0. 201 SSPE is 3.0 mol/L sodium
chloride, 0.2 mol/L sodium phosphate monobasic, 20 mmol/L
EDTA, pH 7.4. 501 Denhardt’s solution is 1% Ficoll (Type 400,
Pharmacia), 1% polyvinylpyrrolidone, and 1% bovine serum albumin (BSA).
Miscellaneous reagents. BSA, rabbit brain cephalin, and dextran
sulfate (average molecular weight 500,000 daltons) were from Sigma
Chemicals.
Isolation of the murine factor XI cDNA. A total of 500,000
plaques from the murine liver cDNA library were screened using a
full-length human factor XI cDNA probe labeled with 32P-dATP
using a random hexamer primer method.22 Two clones (lMFXI-1
and lMFXI-2) that hybridized to this probe were obtained and were
purified through two successive plaque purification steps. Sequencing of the cDNA clones was performed using a Sequenase version
2.0 DNA sequencing Kit (Amersham Life Sciences, Arlington
Heights, IL). The sequence of the murine clones was compared with
the published cDNA sequences for human factor XI17 and murine
prekallikrein23 using a MacVector software package (International
Biotechnologies, New Haven, CT).
Expression and purification of recombinant murine and human
factor XI. Full-length cDNAs for human and murine factor XI were
ligated into the EcoRI cloning site of a mammalian expression vector
(pJVCMV24) containing the cytomegalovirus promoter. Two hundred
and ninety-three cells (5 1 107) were cotransfected with 40 mg of
factor XI/pJVCMV and 2 mg of plasmid RSVneo, which contains a
gene conferring resistance to neomycin.24 Transfection was performed
by electroporation using an Electrocell Manipulator 600 (BTX, San
Diego, CA). Transfected cells were grown in DMEM with 5% fetal
bovine serum and penicillin/streptomycin for 24 hours and then
switched to the same medium containing 500 mg/mL of G418. Media
was exchanged every 48 hours. G418 resistant clones were transferred
to 24-well tissue culture plates on day 10 to 14 of selection, and
culture supernatants were tested for factor XI activity in a modified
activated partial thromboplastin time assay (described below). Clones
expressing the highest level of recombinant protein were expanded
in 2-L roller bottles. After reaching confluence, cells were washed
with phosphate-buffered saline and 200 mL of Cellgro complete serum
free media supplemented with 10 mg/mL SBTI, LBTI, and aprotinin
was added to each roller bottle. Conditioned media was supplemented
with benzamidine to 5 mmol/L and stored at 0207C.
Four liters of conditioned media was dialyzed against 50 mmol/
L sodium acetate, pH 5.2, 250 mmol/L NaCl, 1 mmol/L EDTA and
loaded onto a 100-mL S-sepharose fast-flow cation exchange column. No factor XI activity was detected in the flow through by
clotting assay (described below). The column was eluted with a 1-L
linear NaCl gradient (250 to 1,000 mmol/L), and factor XI containing
fractions were pooled and dialyzed against 25 mmol/L Tris-HCl, pH
7.4, 100 mmol/L NaCl (Tris-buffered saline [TBS]). Dialysate was
loaded onto a 10-mL heparin agarose column equilibrated with TBS
and eluted with a 100-mL linear NaCl gradient (100 to 1,000 mmol/
L). Factor XI containing fractions were pooled and concentrated to a
final volume of 500 mL using an Amicon ultrafiltration cell (Amicon,
Beverly, MA). The preparation was then passed over a Superose-12
gel filtration column and 500 mL fractions were collected. Samples of
each fraction were run on a 10% polyacrylamide-sodium dodecyl
sulfate (SDS) gel under nonreducing conditions according to the
AID
Blood 0003
/
5h3a$$$$41
method of Laemmli,25 followed by staining with Coomassie brilliant
blue. Fractions with pure factor XI were pooled and concentrated
as above, dialyzed against TBS, and then stored at 0707C. Protein
concentration was determined by measuring absorbance at 280 nm
using an extinction coefficient (1%) for factor XI of 13.1.
Plasma assay for factor XI activity. Conditioned serum-free media and fractions from purification procedures were screened for
factor XI activity by a modified activated partial thromboplastin time
(aPTT) assay. Sixty microliters of human factor XI-deficient plasma
was mixed with 60 mL of the solution to be assayed and 60 mL of
Thrombosil aPTT reagent. The mixture was incubated for five minutes at 377C, 60 mL of 25 mmol/L CaCl2 was added, and the time
to fibrin clot formation was determined using a Dataclot 2 fibrometer
(Helena Laboratories, Beaumont, TX). To determine the specific
activity of human and murine recombinant factor XI preparations,
proteins were diluted to 5 mg/mL in TBS supplemented with 100
mg/mL BSA (TBSA) and serial 1:2 dilutions of this stock solution
were made in TBSA. Sixty microliters of the stock solution and
each serial dilution were tested for factor XI activity as described
above. Results were compared with standard curves prepared with
pooled normal human or murine plasma. The factor XI concentration
of undiluted pooled normal human plasma was considered to represent 100% activity (1 U factor XI/mL). Preparations were also tested
for factor IX activity by substituting factor IX–deficient plasma for
factor XI–deficient plasma in this assay. Recombinant factor XI
preparations did not show factor IX activity.
Preparation and activity of recombinant factor XIa. Purified recombinant murine or human factor XI (100 mg/mL) was supplemented with human factor XIIa (2 mg/mL) and incubated at 377C.
Activation was confirmed by demonstrating complete conversion of
the single chain zymogen to the two-chain active form on Coomassie
Blue–stained SDS-polyacrylamide gels run under reducing conditions. Factor XIIa was neutralized by the addition of corn trypsin
inhibitor (CTI) as previously described.26 Kinetic parameters for the
cleavage of S-2366 by factor XIa were determined as previously
reported.24 Briefly, 20 mL of factor XIa at 5 mg/mL in TBS with
0.1% BSA (TBSA) was mixed with 75 mL of TBSA and 5 mL of
CTI and incubated for 20 minutes at room temperature. The mixture
was diluted to 900 mL with TBSA and 100 mL of chromogenic
substrate S-2366 at varying concentrations (50 to 1,000 mmol/L final
concentration) was added. Cleavage of S-2366 was followed by
measuring the change in absorbance at 405 nm with a Beckman
DU-640 spectrophotometer. Michaelis-Menten constants (Km and
Vmax) for the cleavage of the chromogenic substrates were determined by standard methods. The value for Vmax was converted to
nanomolar para-nitroanaline (pNA) generated/sec using an extinction coefficient for pNA of 9,800 optical density (OD) units (405
nm)/mol pNA. Turn-over number (kcat ) was calculated from the ratio
of Vmax to enzyme concentration.
The activation of factor IX by recombinant factor XIa was determined by our previously published method.24 Purified human factor
IX (0.05 to 10.0 mmol/L) was incubated with 5 mmol/L CaCl2 and
0.5 nmol/L factor XIa for 60 seconds at 377C. The reaction was
stopped by adding EDTA to a final concentration of 25 mmol/L and
chilling to 47C. The reaction mixture was diluted 1:100 in TBSA
and 10 mL of the dilution was mixed with 50 mL of human factor
VIII (8 U/mL), 10 mmol/L CaCl2 , rabbit brain cephalin (1:5 dilution
of stock) and 10 mL of human thrombin (0.6 U/mL). After incubation
at 377C for 60 seconds to allow the thrombin to activate the factor
VIII, 30 mL of human factor X (450 nmol/L) was added and the
incubation was continued for an additional 5 minutes. The activation
of factor X by factor IXa was stopped by adding EDTA to 25 mmol/
L final concentration and placing the reaction on ice. Fifty microliters
of the reaction was diluted into 490 mL of TBSA, 60 mL of 5
mmol/L chromogenic substrate S-2765 was added, and the change
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
A COMPARISON OF MURINE AND HUMAN FACTOR XI
in absorbance at 405 nm was followed. The results were compared
with a control curve constructed with known concentrations of factor
IXa to determine the extent of factor IX activation by factor XIa.
Michaelis-Menten kinetic parameters were determined using the average of two sets of experiments for each enzyme.
Western blot analysis of activation of factor XI by factor XIIa,
thrombin, and factor XIa. Recombinant factor XI was diluted to 5
mg/mL in TBS supplemented with 1 mg/mL dextran sulfate (average
molecular weight, 500,000 daltons), in the absence or presence of
human factor XIIa (2.5 nmol/L), thrombin (2.5 nmol/L), or factor
XIa (either murine or human, 5 nmol/L). All reactions were 400 mL
in volume and were incubated at 377C. At various time intervals,
30-mL samples were removed and mixed with 10 mL of reducing
SDS-sample buffer (500 mmol/L Tris-HCl, pH 6.8, 40% glycerol,
20% 2-mercaptoethanol, 10% SDS). Samples were run on 10% polyacrylamide-SDS gels, transferred to nitrocellulose membranes using
a Bio-Rad mini-protean II electrophoresis apparatus, and then
blocked for 2 hours in 5% powdered milk in TBS. The primary
detection antibody was a rabbit antihuman factor XI polyclonal IgG,
and the secondary antibody a goat-antirabbit IgG conjugated to alkaline phosphatase. Blots were developed with a solution of 100 mmol/
L Tris-HCl, pH 9.0, 100 mmol/L NaCl, 5 mmol/L MgSO4 , 100 mg/
mL NBT, and 50 mg/mL BCIP.
Northern blot analysis of factor XI, factor XII, and prekallikrein
in human and murine tissue. Two microgram samples of murine
liver and pancreas polyA RNA were size fractionated on a 1.2%
agarose, 0.62 mol/L formaldehyde gel in 20 mmol/L 3-[N-morpholino]propane-sulfonic acid (MOPS), pH 7.0, 8 mmol/L sodium acetate, 1 mmol/L EDTA followed by transfer to a nylon membrane
using a Turbo Blot apparatus (Schleicher and Schuell, Keene, NH).
Full-length human factor XI, factor XII and prekallikrein cDNAs,
and the full-length murine factor XI cDNA were labeled with 32PdATP using the random hexamer primer technique.22 In addition,
the human factor XI cDNA was digested with restriction endonuclease Pst I and Bst EII and size fractionated on a 1.2% agarose gel in
TBE buffer. The three cDNA fragments were cut from the gel,
purified using a Qiaex II gel extraction kit (Qiagen, Chatworth, CA),
and then labeled with 32P as above. Finally, a human b-actin probe,
used as a control to insure equal lane loading of RNA, was labeled
in a similar manner. Blots were prehybridized in 51 SSPE, 50%
formamide, 51 Denhardt’s solution, 10% high molecular weight
dextran sulfate, 1% SDS with 100 mg/mL boiled salmon sperm
DNA for 2 hours at 427C. Hybridization with 32P-labeled probes was
performed in fresh prehybridization solution overnight at 427C. Blots
were washed with two exchanges of 21 SSC, 0.1% SDS at room
temperature (30 minutes for each exchange), and then twice with
0.11 SSC, 0.1% SDS at 55 to 607C (20 minutes per exchange).
Autoradiography was done at 0707C with enhancer screens for 24
to 72 hours using XAR-5 film (Kodak, Rochester, NY).
Reverse transcription/polymerase chain reaction (RT/PCR) detection of murine factor XI transcripts in RNA. RT/PCR was performed on 1 mg each of murine liver and pancreas polyA RNA using
a First-Strand cDNA Synthesis Kit (Pharmacia, Piscataway, NJ)
according to the manufacturer’s recommendations. Murine factor XI
primers were: 5*ATCAGCTTTCAAGGAGGT (representing sequence in the third exon of the murine factor XI gene) and 5*ACGACAGACAAAAGCATCTGG (within the seventh exon). Murine
p53 (control) primers were: 5*AGAAGTCACAGCACAT-GACGGAGG (upstream primer) and 5*TGTTTTTTCTTTTGCGGGGGAGAGG (downstream primer). PCR products were size fractionated on a 2.0% agarose gel, stained with ethidium bromide, and
photographed.
RESULTS
The murine factor XI cDNA. Two clones from the murine liver cDNA library, designated lMFXI-1 and lMFXI-
AID
Blood 0003
/
5h3a$$$$41
1057
2, were hybridized with the human factor XI cDNA probe
and purified for further analysis. The cDNA inserts of both
clones were 2.8 kb in size, and sequencing of the 5* and
3* ends of the inserts, as well as with an oligonucleotide
recognizing a sequence in the human factor XI catalytic
(light chain) domain, confirmed that they were identical. l
MFXI-1 contained an 1,872-bp open reading frame coding
for a 624 amino acid protein, including an 18 amino acid
leader peptide (Fig 1). The amino acid sequence coding for
mature murine factor XI is 78% homologous to human factor
XI (Fig 2) and 58% homologous to mouse prekallikrein.17,23
By comparison, human factor XI and human prekallikrein
are also 58% homologous.17 lMFXI-1 contained approximately 140 bp of 5* and 800 bp of 3* untranslated sequence
terminating in a polyadenylated tail.
Human plasma factor XI is a 160-kD glycoprotein that is
a dimer of two identical 80-kD polypeptides connected by
a single disulfide bond.5,17,27 Each polypeptide consists of an
N-terminal heavy chain comprised of four tandem repeats
called apple domains, and a C-terminal trypsin-like catalytic
light chain.17,27 Activation of factor XI by either factor XIIa
or thrombin is accomplished by a single proteolytic cleavage
after amino acid 369 of the heavy chain (Fig 2).7,8,17 The l
MFXI-1 sequence predicts that each murine factor XI polypeptide contains 34 half-cystine residues compared with 35
residues in the human molecule. The cystine residue at position 11 in the human molecule is replaced with serine in the
mouse. In the human molecule, Cys11 forms a disulfide bond
with free cystine, and its function is unknown.27 Otherwise,
the location of the cystine residues are identical in the two
species indicating that murine and human factor XI share a
similar tertiary structure. The sequence Asn-Pro-Arg immediately N-terminal to the factor XIIa cleavage site in murine
factor XI resembles the Lys-Pro-Arg sequence found at this
location in the human molecule and is a typical sequence
for a thrombin cleavage site.28 Cys321 is involved in the interchain disulfide bond between the two polypeptides of the
factor XI homodimer, and its conservation in the murine
cDNA indicates that mouse factor XI may also be dimeric.27
Recombinant factor XI. 293 cells, a human fetal kidney
fibroblast line that does not constitutively express factor XI,
were used to produce recombinant proteins. On SDS-polyacrylamide gel, murine and human recombinant factor XI
migrate as a single band of 160 kD under nonreducing conditions, and as single bands at 80 kD when reduced, confirming
that murine factor XI is a disulfide-linked dimer (Fig 3A).
Using a modified aPTT assay in human factor XI-deficient
substrate plasma, the specific activity of the recombinant
human protein was determined to be approximately 200 U/
mg, virtually identical to plasma derived factor XI.5,24 Murine
factor XI has 50% to 70% of the activity (100 to 140 U/mg)
of human factor XI when tested in this human plasma system.
Recombinant factor XIa. Recombinant murine and human factor XIa both appear as two bands when run under
reducing conditions on SDS-polyacrylamide gels (Fig 3B).
The heavy chain of the murine molecule appears to be larger
than its human counterpart. This difference cannot be entirely accounted for by the fact that the murine heavy chain
is two amino acids longer than the human protein, and may
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1058
GAILANI, SUN, AND SUN
Fig 1. Nucleotide sequence
and predicted amino acid sequence of the opened reading
frame of the cDNA in lMFXI-1.
The nucleotide numbering system starts at the ATG triplet coding for the initiator methionine
residue of the leader peptide.
be due to differences in glycosylation. The murine light
chain, which is three amino acids shorter than the human
light chain, runs slightly smaller than its human counterpart.
S-2366 (L-pyroglutamyl-prolyl-arginine-p-nitroaniline) is a
chromogenic substrate commonly used to measure human
factor XIa activity.8,24 It is also readily cleaved by rabbit
factor XIa (D. Gailani, unpublished observation, November
1991). We compared the kinetic parameters of S-2366 cleavage by recombinant human and murine factor XIa (Table 1).
The calculated catalytic efficiency (kcat /Km ) is approximately
AID
Blood 0003
/
5h3a$$$$41
twofold to threefold higher for human factor XIa, mostly
attributable to a higher turn-over number (kcat ) for the human
enzyme.
The kinetic parameters for the activation of human factor
IX by human and murine factor XIa are shown in Table 1.
As there is no commercially available chromogenic substrate
for factor IX, a two-stage assay was used in which factor
IX is activated by factor XIa in the first step and the resulting
factor IXa activates factor X in the presence of factor VIIIa
and phospholipid in the second step. Factor Xa generation
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
A COMPARISON OF MURINE AND HUMAN FACTOR XI
1059
Fig 2. Comparison of the
amino acid sequences of human
and murine factor XI. The amino
acid numbering system used is
for human factor XI.17 Amino
acids Ï18 to Ï1 represent the
leader peptide and the N-terminal heavy chain is numbered 1369. The C-terminal catalytic
light chain is numbered 1-238
and begins immediately after
the heavy chain sequence. Alignment required the insertion of
one gap in the human factor XI
sequence after amino acid 325 of
the heavy chain and one gap in
the murine sequence after
amino acid 20 of the light chain.
The black arrowhead after Arg369
of the heavy chain designates
the factor XIIa and thrombin activation cleavage site. The positions of the serine protease catalytic triad of His, Asp, Ser in the
light chain are designated by
black circles. The asterisk (*)
designates the cystine residue at
position 321 of the heavy chain
involved in the disulfide bond
connecting the two polypeptides of the homodimer. Amino
acid positions with identical residues are enclosed in the shaded
boxes.
is then easily determined by chromogenic substrate assay.24
The results of the analysis show that recombinant factor XIa
from both species activate human factor IX similarly and
are consistent with our previous data for factor IX activation
by human factor XIa using this technique.24
Activation of murine factor XI by factor XIIa, thrombin,
and autoactivation. In purified systems, human factor XI
is activated slowly by factor XIIa or thrombin in the absence
of a negatively charged surface.8 The rate of these reactions
are markedly increased by polyanions such as dextran sulfate.7,8 In addition, dextran sulfate promotes the activation
of factor XI by factor XIa (autoactivation).7,8 The activation
of human factor XI in the presence of dextran sulfate may
be followed indirectly by noting the conversion of the 80kD zymogen to a 45- to 50-kD heavy chain and 35- to 38kD light chain on western blots of reduced protein.8 As in
the case with the human protein, murine factor XI was slowly
activated by either human factor XIIa or thrombin in the
absence of a negatively charged surface (data not shown).
When murine factor XI is incubated with factor XIIa or
thrombin in the presence of dextran sulfate, activation occurs
Table 1. Kinetic Parameters of Chromogenic Substrate
S-2366 Cleavage and Human Factor IX Activation
by Recombinant Human and Murine Factor XIa
Fig 3. Recombinant murine and human (A) factor XI and (B) factor
XIa. Recombinant protein expressed in 293 fibroblasts was purified
as described in Materials and Methods. Two microgram samples of
each protein were size fractionated under reducing and nonreducing
conditions on a 10% polyacrylamide SDS-gel, followed by staining
with Coomassie brilliant blue. The positions of molecular weight
markers in kD are shown at the left of the figure.
AID
Blood 0003
/
5h3a$$$$41
S-2366
Factor IX
Km
(mmol/L)
kcat
(min01)
Km
(nmol/L)
kcat
(min01)
kcat /Km
Enzyme
Human factor XIa
Murine factor XIa
260
190
130
37
216
147
3.5
1.5
16.2
10.2
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1060
GAILANI, SUN, AND SUN
much more rapidly, however, an additional band (fXIc, for
factor XI cleaved) is noted at approximately 75 kD (Fig 4)
that is not seen in human factor XI activation under similar
conditions (data not shown). The protease responsible for
this cleavage could be the factor XIIa or thrombin used to
initiate the reaction or the factor XIa subsequently generated.
To evaluate the later possibility, murine factor XI was incubated with dextran sulfate and murine factor XIa (Fig 5A).
The result indicates that murine XIa prefers to cleave murine
factor XI at a site other than the activation cleavage site, as
the fXIc band is generated more rapidly than the heavy chain
of factor XIa. The 38-kD band representing the light chain
of factor XIa is not seen in this time course, probably because
the cleavage that produces fXIc is within the light chain. An
approximately 28-kD band (C, for cleavage) is faintly seen
and may represent a portion of the cleaved light chain. A
similar result was obtained when murine factor XI was incubated with dextran sulfate and human XIa (data not shown)
indicating that murine factor XI zymogen differs from human zymogen, which is preferentially cleaved by factor XIa
at the activation site between Arg369 and Ile370 in the presence
of polyanions.7,8 The preference for cleavage at a site other
than the activation site suggests that zymogen murine factor
XI would undergo autoactivation on dextran sulfate slowly,
if at all. This is confirmed by the experiment shown in Fig
5B. Figure 5C shows murine factor XIa, before and after
incubation with dextran sulfate and supports the premise that
Fig 4. Western blots of recombinant murine factor XI activated
by (A) thrombin and (B) factor XIIa in the presence of dextran sulfate.
Murine factor XI (5 mg/mL) was incubated with 1 mg/mL dextran
sulfate and either human thrombin or factor XIIa (2.5 nmol/L) at 377C.
At various time points, samples were removed and mixed with SDSreducing sample buffer. Western blots were prepared as described
in Materials and Methods. The positions of molecular weight markers
in kD are shown at the left of the figure. Abbreviations: fXI, factor XI
zymogen; fXIc, factor XI cleaved; HC, factor XIa heavy chain; and LC,
factor XIa light chain.
AID
Blood 0003
/
5h3a$$$$41
Fig 5. Western blots of murine factor XI. (A) Murine factor XI
activation by murine factor XIa in the presence of dextran sulfate.
Murine factor XI (5 mg/mL) was incubated with 1 mg/mL dextran
sulfate and murine factor XIa (5 nmol/L) at 377C. (B) Murine factor
XI autoactivation. Murine factor XI (5 mg/mL) was incubated with 1
mg/mL dextran sulfate at 377C. (C) Murine factor XIa (5 mg/mL) was
incubated with 1 mg/mL dextran sulfate at 377C. Western blots were
prepared for all experiments as described in Materials and Methods.
The positions of molecular weight markers in kD are shown at the
left of the figure. Abbreviations: fXI, factor XI zymogen; fXIc, factor
XI cleaved; HC, factor XIa heavy chain; LC, factor XIa light chain; and
C, cleavage product-possibly of the light chain. The sample in lane
XIa is an activated murine factor XI standard prepared by incubating
factor XI with factor XIIa in the absence of dextran sulfate.
the active enzyme makes a proteolytic cleavage within the
light chain.
Tissue expression of factor XI messenger RNA. To identify tissues in which factor XI message is expressed, multitissue northern blots containing polyA RNA were initially hybridized with 32P-labeled full-length factor XI cDNA probes
(Fig 6A and B). Factor XI message is present, as expected,
in the liver of both species. Two messages are present in
human liver at approximately 2.4 and 4.0 kb, while the
mouse message is primarily a single species of 2.8 kb. Surprisingly, 2.4 and 4.0 kb messages were also detected in
human pancreas and kidney (Fig 6A). The 2.4 kb message
in kidney is not seen well on the blot shown, but was detected
on some blots in several repeat experiments. Several higher
molecular weight bands are seen in the pancreas lane and
probably represent incompletely spliced factor XI mRNA.
Identical high molecular weight bands were also detected
in some experiments in RNA from liver. To examine the
possibility that signals seen in human pancreas and kidney
represent RNA species related to, but distinct from factor
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
A COMPARISON OF MURINE AND HUMAN FACTOR XI
1061
Fig 6. Northern blots of human and murine tissues for factor XI and contact activation protease
expression. (A) Human tissue Northern blots hybridized with a full-length human factor XI cDNA probe,
(B) murine tissue Northern blots hybridized with a
full-length murine factor XI cDNA probe, and (C) human tissue Northern blots hybridized with either a
full-length human factor XII or human prekallikrein
cDNA probe. Blots were subsequently stripped and
hybridized with a human b-actin cDNA probe to
show equal lane loading of RNA. The position of molecular weight markers in kilobases is shown at the
left of the figures.
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1062
GAILANI, SUN, AND SUN
Fig 7. Reverse transcription/PCR analysis of murine liver and pancreas for factor XI expression. PolyA RNA from liver (L) and pancreas
(P) were reverse transcribed as described in Materials and Methods,
followed by PCR with oligonucleotides specific for the murine factor
XI or murine p53 cDNAs. PCR products were size fractionated on a
2.0% agarose gel followed by staining with ethidium bromide. The
position of molecular weight markers in DNA kilobases is shown at
the left of the figure.
XI, the human factor XI cDNA was divided into three pieces
and each was used as a probe for the northern blot. Identical
results to those seen in Fig 6A were obtained with probes
representing: (1) the signal peptide and first three apple domains, (2) the fourth apple domain and the first 15 amino
acids of the light chain, and (3) the remainder of the catalytic
light chain (data not shown). This indicates that the signals
in human pancreas and kidney are, indeed, factor XI mRNA.
The human Northern blots were subsequently probed with
full-length cDNA probes for the human contact activation
proteases, factor XII, and prekallikrein (Fig 6C). Full-length
message for these proteins was detected only in RNA from
liver. The signal at approximately 0.8 to 1.0 kb seen for both
proteins in the pancreas lane is too small to encode either
factor XII or prekallikrein and likely represents a related
protease species, such as trypsinogen.
Northern blots are not particularly sensitive assays, and it
is possible that a tissue such as murine pancreas could be
expressing factor XI mRNA at levels below the detection
threshold of the Northern blot. To examine this possibility,
polyA RNA from murine liver and pancreas were reverse
transcribed, and PCR was performed on the reverse transcribed material with oligonucletoides that specifically copy
a 600-bp fragment from the murine factor XI cDNA. Oligonucleotides specific for the murine p53 cDNA were used as
controls to demonstrate that reverse transcription was successful. This technique is several orders of magnitude more
sensitive than northern blot hybridization. The results of this
analysis (Fig 7) show that factor XI message, while easily
detected in murine liver, is not present in murine pancreas.
DISCUSSION
We have successfully isolated and expressed a complimentary DNA for murine factor XI and compared the proper-
AID
Blood 0003
/
5h3a$$$$41
ties of this protein with human factor XI. While factor XI
has been purified from the plasma of several species,5,29-31
the nucleotide and amino acid sequences are known only for
the human form.17 Human factor XI consists of a C-terminal
trypsin-like catalytic light chain and an N-terminal noncatalytic heavy chain comprised of four repeated 90-91 amino
acid subunits called apple domains.5,6,17 Only the highly related protease plasma prekallikrein has been shown to contain similar domains.18 The murine factor XI cDNA predicts
a high degree of sequence homology (78%) with human
factor XI, and the two proteins appear to contain identical
disulfide bonds and domain structures. A notable difference
is the absence of the cystine residue at amino acid position
eleven in murine factor XI. Cys11 in human factor XI forms
a disulfide bond with a molecule of free cystine, and its
function, if any, is not clear.27 Meijers et al32 have reported
that this residue may be changed in recombinant factor XI
to serine by site directed mutagenesis without altering the
properties of the enzyme in an aPTT assay.
Human factor XI is unique among the proteases of the
coagulation cascade in that it circulates as a disulfide bondlinked homodimer with two catalytic sites.5,17,32 The cystine
residue involved in the interchain bond in the human cDNA
(Cys321) is conserved in the murine cDNA and, indeed, murine factor XI is expressed as a dimer. Factor XI purified
from bovine and porcine plasma are also dimeric, however,
rabbit factor XI lacks the interchain disulfide bond.29-31 The
significance of this is not clear and rabbit factor XI may
circulate as a noncovalent dimer.31 In fact, mutation of Cys321
in human factor XI to serine does not affect dimer formation,
as other interactions in the fourth apple domain effectively
hold the dimer together.32 It is not known if factor XI must
exist as a dimer to be functional in vivo. Recently, we prepared a factor XI mutant in which the entire fourth apple
domain was replaced with the corresponding domain from
prekallikrein (FXI/PKA4).24 This effectively removes the sequences required for dimer formation and results in a monomeric protein. FXI/PKA4 is activated by factor XIIa, and
activated FXI/PKA4 activates factor IX with similar kinetic
parameters to those of wild type factor XI.24
Human factor XI is activated by factor XIIa, thrombin, and
activated factor XI (autoactivation) on a negatively charged
surface.5,7,8,14 The amino acid sequence immediately preceding the activation cleavage site is of interest. Thrombin
cleaves many of its substrates immediately after the sequence
X-Pro-Arg (P3-P1 positions, respectively), and this sequence
is present in both human and murine factor XI.17 By comparison, the sequence preceding the factor XIIa cleavage site in
murine and human prekallikrein are Asn-Ala-Arg and SerThr-Arg, respectively.18,23 These are not typical thrombin
cleavage sites, and human prekallikrein is not activated by
thrombin.33 We have prepared a recombinant factor XI molecule in which the factor XIIa cleavage site has been changed
to that of prekallikrein (manuscript in preparation). This molecule is activated normally by factor XIIa, but is not activated by thrombin confirming the importance of this sequence to thrombin mediated cleavage. Like human factor
XI, murine factor XI is activated by factor XIIa and thrombin. In contrast, the murine protein undergoes autoactivation
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
A COMPARISON OF MURINE AND HUMAN FACTOR XI
poorly on dextran sulfate because murine factor XIa prefers
to cleave its zymogen at a location other than the activation
cleavage site. The physiologic importance of factor XI autoactivation is not clear. Factor XII and factor VII bound to
tissue factor have been reported to undergo autoactivation,
and one could postulate that these reactions may be physiologic triggers for contact activation and the extrinsic pathway, respectively.34,35 Alternatively, autoactivation could
serve to amplify an enzymatic reaction after initial activation
from another protease.
The major source of plasma factor XI is thought to be the
liver. Factor XI levels decrease in liver disease, and a patient
acquired mild factor XI deficiency after orthotopic liver
transplantation from a factor XI–deficient donor.36 Factor
XI activity has been reported to be associated with a 200kD protein on platelet membranes, however, the activity
has not been completely characterized, and it has not been
definitively determined that this protein is a product of the
factor XI gene.37 The identification of mRNA for human
factor XI in organs other than the liver, therefore, is somewhat surprising. Furthermore, the absence of detectable expression in murine kidney and pancreas raises the possibility
that factor XI may be required for somewhat different functions in the two species. The presence of mRNA in renal
tissue is particularly intriguing as bleeding from the urinary
tract, particularly after surgical procedures, is common in
severe factor XI deficiency in humans.2,13 Factor XI has been
postulated to be required for fibrin clot stability in the face
of fibrinolysis, and the tissues of the urinary tract contain
significant amounts of urokinase.11-14 Local expression of
factor XI may, therefore, be required for maintaining fibrin
integrity in the face of brisk fibrinolysis. The expression of
factor XI mRNA in human pancreas is more difficult to
explain. The result does not appear to be due to the nonspecific expression of a trypsin-like protease because mRNA
for prekallikrein, a protease with a high degree of homology
to factor XI, is not seen in pancreas. It is conceivable that
factor XI has specific activities within the pancreas or gut,
as trypsin has been shown to effectively activate human
factor XI in a purified protein system.38
It is important to note that the presence of mRNA in a
tissue may represent illegitimate transcription and is not
proof of protein expression. We attempted to demonstrate
factor XI protein in human liver tissue by immunohistochemistry using monoclonal antibodies24 that easily detect factor
XI in human plasma by Western blot and enzyme-linked
immunosorbent assay (ELISA) (data not shown). Unfortunately, these studies were not successful, possibly because
the amount of factor XI in hepatic tissue is small. In the
absence of a clear demonstration of factor XI protein, therefore, our northern blot results must be considered preliminary
evidence for extra-hepatic expression of factor XI, rather
than definitive proof. Even if organs other than the liver
are expressing factor XI, it is unlikely that they contribute
substantially to plasma levels of factor XI.
Our data show that murine and human factor XI are structurally homologous and have similar enzymatic properties,
particularly in regard to the activation of factor IX. The
autoactivation studies in the purified protein systems, how-
AID
Blood 0003
/
5h3a$$$$41
1063
ever, suggest that there are subtle differences in enzymatic
properties. Furthermore, there are differences in tissue specific expression of factor XI mRNA between humans and
mice. These findings raise the possibility that factor XI functions in hemostasis differently in the two species, or that the
protein may be involved in functions unrelated to hemostasis.
REFERENCES
1. Walsh PN, Bradford H, Sinha D, Piperno JR, Tuszynski GP:
Kinetics of the factor XIa catalyzed activation of human blood coagulation factor IX. J Clin Invest 73:1392, 1984
2. Seligsohn U: Factor XI deficiency. Thromb Haemost 70:68,
1993
3. Knowles C, Giger U, Dodds WJ, Brooks M: Factor XI deficiency in Kerry Blue Terriers. J Am Vet Med Assoc 205:1157, 1994
4. Gentry PA: The relationship between factor XI coagulant and
factor XI antigen in cattle. Can J Comp Med 48:58, 1984
5. Bouma BN, Griffin JH: Human blood coagulation factor XI,
purification, properties, and mechanism of activation by activated
factor XII. J Biol Chem 252:6432, 1977
6. Kurachi K, Davie EW: Activation of human factor XI (plasma
thromboplastin antecedent) by factor XIIa (activated Hageman factor). Biochemistry 16:5831, 1977
7. Naito K, Fujikawa K: Activation of human blood coagulation
factor XI independent of factor XII: Factor XI is activated by thrombin and factor XIa in the presence of negatively charged surfaces. J
Biol Chem 255:2667, 1991
8. Gailani D, Broze GJ: Factor XI activation in a revised model
of blood coagulation. Science 253:909, 1991
9. von dem Borne PA, Koppelman SJ, Bouma BN, Meijers JCM:
Surface independent factor XI activation by thrombin in the presence
of high molecular weight kininogen. Thromb Haemost 72:397, 1994
10. von Dem Borne PA, Meijers JCM, Bouma BN: Effect of
heparin on the activation of factor XI by fibrin-bound thrombin.
Thromb Haemost 76:347, 1996
11. von Dem Borne PA, Meijers JCM, Bouma BN: Feedback
activation of factor XI by thrombin in plasma results in additional
formation of thrombin that protects fibrin clots from fibrinolysis.
Blood 86:3035, 1995
12. Broze GJ: The role of tissue factor pathway inhibitor in a
revised coagulation cascade. Sem Hematol 29:159, 1992
13. Broze GJ, Gailani D: The role of factor XI in coagulation.
Thromb Haemost 70:72, 1993
14. Davie EW, Fujikawa K, Kisiel W: The coagulation cascade:
Initiation, maintenance and regulation. Biochemistry 30:10363, 1991
15. Cawthern KM, van’t Veer C, Lock JB, Branda RF, Mann
KG: Regulation of thrombin generation by tissue factor, factor VIIIa,
and factor XIa in a whole blood model. Blood 88:520A, 1996
16. Wetzel RA, Ogata RT, Tack BF: Primary structure of the
fifth component of murine complement. Biochemistry 25:737, 1987
17. Fujikawa K, Chung DW, Hendrickson LE, Davie EW: Amino
acid sequence of human factor XI, a blood coagulation factor with
four tandem repeats that are highly homologous with plasma prekallikrein. Biochemistry 25:2417, 1986
18. Chung DW, Fujikawa K, McMullen BA, Davie EW: Human
plasma prekallikrein, a zymogen to a serine protease that contains
four tandem repeats. Biochemistry 25:2410, 1986
19. Cool DE, Edgell CS, Louie GV, Zoller MJ, Brayer GD, MacGillivray RTA: Characterization of human blood coagulation factor
XII cDNA. J Biol Chem 260:13666, 1985
20. Immunizing animals, in Harlow E, Lane D (eds): Antibodies,
A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1988, p 92
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1064
GAILANI, SUN, AND SUN
21. Miletich J, Jackson C, Majerus PW: Properties of the factor
Xa binding site on human platelets. J Biol Chem 253:6908, 1978
22. Feinberg AP, Vogelstein B: A technique for radiolabelling
DNA restriction endonuclease fragments to high specific activity.
Anal Biochem 132:6, 1983
23. Seidah NG, Sawyer N, Hamelin J, Mion P, Beaubien G,
Brachpapa L, Rochemont J, Mbikay M, Chrétien M: Mouse plasma
kallikrein: cDNA structure, enzyme characterization, and comparison of protein and mRNA levels among species. DNA Cell Biol
9:737, 1990
24. Sun Y, Gailani D: Identification of a factor IX binding site
on the third apple domain of activated factor XI. J Biol Chem
271:29023, 1996
25. Laemmli UK: Cleavage of structural proteins during assembly
of the head of the bacteriophage T4. Nature 227:680, 1970
26. Gailani D, Broze GJ: Effects of glycosaminoglycans on factor
XI activation by thrombin. Blood Coagul Fibrinolysis 4:15, 1993
27. McMullen BA, Fujikawa K, Davie EW: Location of the disulfide bonds in human coagulation factor XI: The presence of tandem
apple domains. Biochemistry 30:2056, 1991
28. Mann KG: Prothrombin and thrombin, in Colman RW, Hirsh
J, Marder VJ, Salzman EW (eds): Hemostasis and Thrombosis, Basic
Principles and Clinical Practice. Philadelphia, PA, Lippincott, 1994,
p 184
29. Koide H, Kato H, Davie EW: Isolation and characterization of
AID
Blood 0003
/
5h3a$$$$41
bovine factor XI (plasma thromboplastin antecedent). Biochemistry
16:2279, 1977
30. Mashiko H: Factor XI: Purification from porcine plasma by
affinity chromatography and some properties of factor XI and activated factor XI. Biol Chem Hoppe Seyler 375:481, 1994
31. Wiggins RC, Cochrane CG, Griffin JH: Rabbit blood coagulation factor XI. Purification and properties. Thromb Res 15:475, 1979
32. Meijers JCM, Mulvihill ER, Davie EW, Chung DW: Apple
four in human blood coagulation factor XI mediates dimer formation.
Biochemistry 31:4680, 1992
33. Gailani D, Broze GJ: Factor XI activation by thrombin and
factor XIa. Semin Thromb Hemost 19:396, 1993
34. Kaplan AP, Silverberg M: The coagulation-kinin pathway of
human plasma. Blood 70:1, 1987
35. Pedersen AH, Lund-Hansen T, Bisgaard-Frantzen H, Olsen
F, Petersen LC: Autoactivation of human recombinant coagulation
factor VII. Biochemistry 28:9331, 1989
36. Clarkson K, Rosenfeld B, Fair J, Klein A, Bell W: Factor XI
deficiency acquired by liver transplantation. Ann Intern Med
115:877, 1991
37. Tuszynski GP, Bevacqua SJ, Schmaier AH, Colman RW,
Walsh PN: Factor XI antigen and activity in human platelets. Blood
59:1148, 1982
38. Mannhalter C, Schiffman S, Jacobs A: Trypsin activation of
human factor XI. J Biol Chem 255:2667, 1980
07-02-97 18:49:28
blda
WBS: Blood
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1997 90: 1055-1064
A Comparison of Murine and Human Factor XI
David Gailani, Mao-Fu Sun and Yuehui Sun
Updated information and services can be found at:
http://www.bloodjournal.org/content/90/3/1055.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.