Download Please mark the correct answer for each question on the separate

Genetics, Fall 2002
TEST 3 (Final), 12/18/02
Page 1
STUDENT NAME: ___________________________
Please mark the correct answer for each question on the separate answer sheet!
1.
A gene library constructed from the nuclear DNA of a human liver biopsy
a. contains all human genes.
c. is made from reverse transcribed hnRNA.
e. a, b, and c
2.
b. does not contain enhancer sequences.
d. b and c, but not a
Restriction enzymes
a. are sequence-specific exonucleases. b. protect animal cells against viral infections.
c. are mainly found in fungi.
d. participate in DNA replication.
e. cut DNA molecules at specific sites.
3.
Which of the following sequences is not a palindrome?
a. TTCCTT
c. GTTCGAAC
e. GAGCTC
4.
b. CGATCG
d. GGATCC
The identification of a particular gene in a gene library may involve
a. the use of a specific oligonucleotide.
c. the use of a specific antibody.
e. a, b, and c
5.
b. nucleic acid hybridization.
d. a and b, but not c
The diagram below shows a 750 nucleotide-long linear DNA molecule that carries three recognition
sites for Eco RI (E). The positions of these recognition sites on the molecule are given in
parentheses. This molecule was end-labeled with radioactive phosphate (*) and digested with Eco
RI under conditions that allowed the enzyme to cut either once, twice, three times, or not at all
(partial restriction digest). The generated restriction fragments were separated on an agarose gel.
Which lane(s) in the schematic of the
gel on the left represents the
separation of the partial digest
described above?
a. Lane A
b. Lane B
c. Lane C
d. Lane D
e. Lanes A and B
450
6.
*
Genomic DNA fragments have been generated with the restriction enzyme Xma I (recognition
sequence C|CCGGG; | marks the position where the enzyme cuts the DNA strand). Which of the
following restriction sites in a plasmid can be used for cloning of these fragments?
a. Pin A1 (A|CCGGT)
c. Sma I (CCC|GGG)
e. a, b, and c
b. Mro I (T|CCGGA)
d. a and b, but not c
Genetics, Fall 2002
7.
TEST 3 (Final), 12/18/02
The number of recognition sites for a particular restriction enzyme in a DNA molecule depends on
a. the amino acid composition of the enzyme.
c. the length of the recognition sequence.
e. the skills of the experimenter.
8.
Page 2
b. the molecular weight of the enzyme.
d. the concentration of the enzyme.
The genomic DNA of a bacterial cell is not destroyed by the cell’s restriction enzymes because
a. the bacterial DNA is too small to contain the recognition sequence for the enzymes.
b. the restriction sites are occupied by histones.
c. the genome is protected by the nuclear membrane.
d. the pH in the bacterial cell does not allow the restriction enzymes to function.
e. none of the above
9.
Statistically the recognition sequence CCTGCAGG for the restriction enzyme Sse 8387I should
occur in a large DNA molecule every
a. 8 nucleotides.
c. 16.7 million nucleotides.
e. 4096 nucleotide.
10.
Many cloning vectors are derivatives of
a. enzymes.
c. introns.
e. mitochondrial DNA.
11.
b. ampicillin and tetracycline sensitive.
d. ampicillin sensitive, tetracycline resistant.
Which of the following enzymes is used by researchers to generate double stranded cDNA?
a. reverse transcriptase
c. cDNA clonerase
e. all of the above
15.
b. transfection.
d. transformation.
The plasmid pBR322 carries an ampicillin and a tetracycline resistance gene. After cloning a
fragment of foreign DNA into the Pst I restriction site located in the ampicillin resistance gene,
bacterial cells that take up the recombinant plasmid will be
a. ampicillin and tetracycline resistant.
c. ampicillin resistant, tetracycline sensitive.
e. chloramphenicol resistent.
14.
b. complementary 5' overhangs.
d. b and c, but not a
Mammalian cells in culture can be forced to take up “naked” DNA from the environment by a
process called
a. transduction.
c. ingestion.
e. digestion.
13.
b. plasmids.
c. radioactive isotopes.
DNA ligase can covalently link DNA fragments with
a. blunt ends.
c. complementary 3' overhangs.
e. a, b, and c
12.
b. 64 nucleotides.
d. 65536 nucleotides.
b. DNA polymerase
d. a and b, but not c
Which of the parameters of an agarose gel electrophoresis is responsible for the separation of DNA
fragments by their size?
a. the polarity of the electric field
b. the “pore” size of the agarose matrix
c. the geometry of the gel chamber
d. the thickness of the gel
e. the temperature of the power supply
Genetics, Fall 2002
16.
TEST 3 (Final), 12/18/02
Page 3
Which of the following steps is used in the detection of a particular gene in a restriction digest of
genomic DNA (Southern blot) but NOT in the screening of a gene library for a specific clone?
a. transfer of DNA to a filter membrane
b. denaturation of DNA into single strands
c. hybridization of a labeled probe to its complementary “target” DNA
d. gel electrophoresis of DNA
e. none of the above
17.
The property of a DNA molecule that makes it move in an electric field during gel electrophoresis is
its
a. double helical structure.
c. positive charge.
e. none of the above
18.
The genome of some phages is linear in the phage particle but circular inside the host cell. If you
cut a mixture of both forms with a restriction enzyme that has one recognition site in the phage
genome, how many DNA fragments would you generate?
a. 2
c. 4
e. several hundred
19.
b. length.
d. base pair composition.
b. 3
d. 4 or 6 depending on the humidity in the lab
The diagram below shows the autoradiograph of a DNA sequencing gel. What is the sequence of
the template strand, read from 5' to 3'?
a. GGTAACTTGGAGCTGGATAAC
b. CCATTGAACCTCGACCTATTG
c. CAATAGGTCGAGGTTCAATGG
d. CGGCGAATATAGGCGGTTAAT
e. CCCGGGGGGGAAAAAATTTTT
20.
Which of the following reagents is NOT used in enzymatic sequencing of DNA?
a. DNA polymerase
c. deoxynucleoside triphosphates
e. oligonucleotide primers
21.
How many DNA molecules can be generated in a PCR reaction after 12 rounds of amplification
under optimal conditions, starting with 100 molecules?
a. 1200
c. 14400
e. one billion
22.
b. dideoxynucleoside triphosphates
d. adenosine triphosphate
b. 2400
d. 409600
Which of the following steps is NOT part of a typical polymerase chain reaction?
a. primer annealing
c. primer extension by Taq polymerase
e. none of the above
b. ligation of DNA fragments by DNA ligase
d. heat denaturation of double stranded DNA
Genetics, Fall 2002
23.
TEST 3 (Final), 12/18/02
The DNA strand AAAAGCCTTTTCAG serves as template strand in a sequencing reaction using the
dideoxy method. The reaction mixture that contains the normal deoxynucleotides and
dideoxyguanosine triphosphate will produce DNA fragments that are
a. 6, 7, and 12 nucleotides long.
c. 5 and 14 nucleotides long.
24.
b. 3, 8, and 9 nucleotides long.
d. none of these
In an average sequencing reaction researchers can read approximately 300 bp of sequence
information. How many reactions were roughly necessary to cover the human genome?
a. one million
c. ten million
e. three billion
25.
Page 4
b. one billion
d. one hundred thousand
Which of the following statements about the expression of a eukaryotic cDNA in bacteria is TRUE?
a. The eukaryotic promoter of the cDNA will function in the bacterial cells.
b. The primary transcript will be capped.
c. Expression of the cDNA will always yield a functional protein.
d. The stop codon of the cDNA will cause the termination of translation.
e. The protein will undergo the same posttranslational modifications as in eukaryotic cells.
26.
Prokaryotes control the expression of their genes mainly at the level of
a. translation.
c. gene amplification.
e. replication.
27.
b. transcription.
d. RNA splicing.
Which of the following statements about the lactose operon in E. coli is FALSE?
a. it contains the genes that encode the proteins for lactose metabolism.
b. its transcription is blocked when allolactose binds to the lac repressor.
c. it contains a promoter and an operator.
d. it is strongly transcribed when lactose is present in the medium and glucose is absent.
e. it is constitutively transcribed when the lac repressor is not produced.
28.
Allolactose
a. acts as a co-repressor of gene transcription.
c. is synthesized from lactic acid.
e. none of the above
29.
b. binds to the lac operator.
d. enables the lac repressor to bind the operator.
The catabolite activator protein (CAP)
a. binds to the lac repressor.
b. inactivates the lac operon.
c. is assisted by lactose in DNA binding.
d. catalyzes the capping of prokaryotic mRNAs.
e. changes its three-dimensional structure when binding cyclic AMP.
30.
The maximal transcription of the lac operon
a. requires the presence of glucose.
b. occurs when the operator is occupied.
c. requires a complex of CAP and cAMP.
d. does not require RNA polymerase.
e. is only possible when the repressor is mutated.
31.
Which of the following lac merozygotes makes β-galactosidase only in the presence of lactose?
a. i+ o+ z-/F’ i- o+ z+
c. i- oc z-/F’ i- o+ ze. i- oc z-/F’ iS o+ z+
b. i+ oc z+/F’ i- o+ z+
d. i- o+ z+/F’ i- o+ z-
Genetics, Fall 2002
32.
TEST 3 (Final), 12/18/02
Page 5
A lac repressor that cannot bind allolactose due to a mutation in the lacI gene (is)
a. can still bind the inducer galactose.
b. can still bind the lac operator.
c. effects the binding of cAMP to CAP.
d. will override the effect of an oc mutation.
e. has no consequence for the normal regulation of the lac operon.
33.
Polygenic mRNAs
a. are common in humans.
c. are made from operons in bacteria.
e. b and c, but not a
34.
b. encode more than one protein.
d. a and b, but not c
Which of the following statements about the tryptophan operon in E. coli is TRUE?
a. It needs an inducer for gene expression.
b. It contains the gene for lactose permease.
c. Its whole regulation is based on attenuation. d. It has no operator.
e. It contains a leader peptide upstream of the structural genes.
35.
Tryptophan
a. binds to the promoter of the Trp operon.
b. binds to the operator of the Trp operon.
c. binds to RNA polymerase.
d. is one of the four bases in DNA (T).
e. facilitates the binding of the Trp repressor to the operator.
36.
Attenuator control of the Trp operon
a. involves a second repressor protein.
b. would also work in lower eukaryotic cells.
c. requires direct repeat sequences.
d. is dependent on the tryptophan concentration.
e. regulates translational initiation of the structural genes of the operon.
37.
Which of the statements about the attenuator region of the Trp operon is TRUE?
a. It is located upstream of the promoter.b. It is located upstream of the operator.
c. It is located upstream of the structural genes. d. Its transcription is not regulated by tryptophan.
e. It contains splice acceptor and splice donor sites.
38.
Which of the following RNA sequences can form a stem-loop structure?
a. GGUAGGCAUUACGGAUGG
c. GAGAGAGAUUAGAGAGAG
e. GGGGGGGAUUAGGGGGGG
39.
b. GGUAGGCAUUAGGUAGGC
d. GAGAGAGAUUACUCUCUC
The structural genes of the Trp operon are NOT transcribed
a. when a ribosome stalls at the Trp codons in the leader peptide coding region.
b. when a ribosome can synthesize the complete leader peptide.
c. when formation of the terminator loop is prevented.
d. when there are no Trp-tRNATrp molecules in the cell.
e. none of the above
40.
Transcription in eukaryotes
a. involves generally more proteins than in prokaryotes.
b. is often regulated by transcriptional activators.
c. involves protein binding sites called enhancers.
d. can be regulated by a multitude of extracellular stimuli.
e. all of the above
Genetics, Fall 2002
41.
TEST 3 (Final), 12/18/02
Page 6
Which of the following statements about the galactose gene system in yeast is TRUE?
a. Binding of galactose to the GAL80 protein frees the GAL4 DNA-binding domain.
b. The GAL4 protein binds to the enhancer in the presence or absence of galactose.
c. GAL7, GAL10, and GAL1 are under the control of the same promoter.
d. In the absense of galactose GAL7, GAL10, and GAL1 are transcribed.
e. Gal4 is a transcriptional repressor of the GAL7, Gal10, and Gal1 genes.
42.
GAL7
a. encodes an enzyme involved in galactose metabolism in yeast.
b. is transcribed as part of an operon that contains three structural genes.
c. is the gene for the galactose repressor in yeast.
d. is expressed in the absence of galactose.
e. is an intergalactic space station.
43.
Which of the following substances is NOT a component of a eukaryotic chromosome?
a. DNA
c. nonhistone proteins
e. none of the above
44.
b. histones
d. chromium
Histones and DNA have a strong attraction for each other because
a. they can base-pair with each other.
b. both are hydrophobic.
c. both are negatively charged.
d. both are large molecules.
e. DNA is negatively charged and histones are positively charged.
45.
The compaction of chromatin in a eukaryotic cell’s nucleus includes
a. nucleosome formation.
c. the formation of superhelices.
e. all of the above
46.
b. the organization of superhelices into loops.
d. the organization of loops into rosettes.
Compared to the normal A allele, the disease causing allele in sickle cell anemia (S allele) is
missing an Mst II restriction site. On a Southern blot of genomic DNA cut with Mst II and hybridized
with the probe shown on the diagram below, a person that is a heterozygous carrier of the sickle cell
allele will show
a. a single band at 1.1 kb.
b. a single band at 1.3 kb.
c. a single band at 0.2 kb.
d. one band at 0.2 and one at 1.3 kb.
e. one band at 1.1 and one at 1.3 kb.
47.
In contrast to eukaryotic cells, bacteria
a. contain a single circular chromosome. b. divide by prokaryotic fission.
c. are resistant to viral infections.
d. do not contain DNA as genetic material.
e. a and b, but not c or d