Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
[CANCER RESEARCH 60, 922–928, February 15, 2000] A Novel SMAD4 Gene Mutation in Seminoma Germ Cell Tumors1 Mourad Bouras, Eric Tabone, Jacques Bertholon, Pascal Sommer, Raymonde Bouvier, Jean-Pierre Droz, and Mohamed Benahmed2 Institut National de la Santé et de la Recherche Médicale U407, Faculté de Médecine Lyon-Sud, 69621 Oullins Cédex [M. Bo., J. B., M. Be., R. B.]; Centre Léon Berard [E. T., J-P. D.] and Institut de Biologie et de Chimie des Protéines [P. S.], 69007 Lyon Cédex 07; and Hôpital Edouard Herriot, 69373 Lyon Cédex [R. B.], France ABSTRACT Transforming growth factor (TGF)- is known as an antiproliferative factor in the majority of mammalian cells, including stem germ cells. Lack of TGF--induced growth inhibition has been associated with disruptions of TGF- receptors and SMADs. In the present study, we performed a mutational analysis of the TGF- signaling system, including TGF- receptor type I and type II and SMADs (SMAD1–SMAD7), in 20 seminoma germ cell tumors. Using reverse transcription-PCR, single-strand conformational polymorphism, and sequencing analysis, the COOHterminal domain of SMAD4 was found to be mutated: a single thymine was inserted between nt 1521 and 1522 in 2 of 20 tumors analyzed. This addition of a thymine creates a frameshift and a new stop signal at codon 492, which leads to premature termination of the encoded protein. Such a mutation potentially abrogates signaling from TGF- as well as the other TGF- family members, including activin and bone morphogenetic protein, which all use the SMAD pathway. Immunohistological analysis confirmed the loss of expression of SMAD4 protein in the seminoma tissues with the insertional mutation. To our knowledge, this is the first description of a novel SMAD4 insertional mutation in seminoma testicular germ cell tumors. This mutational inactivation of SMAD4/COOH-terminal domain may cause TGF- unresponsiveness. It could thus provide a basis for understanding the potential role of the TGF- system in germ cell tumorigenesis. INTRODUCTION The TGF-3 family of growth factors regulates different biological processes including proliferation, differentiation, development, and extracellular matrix production (1). This family represents a large number of peptides including TGF-s, activin/inhibin, AMH, and BMP (1, 2). The members of the TGF- superfamily transduce signals through two different types of serine/threonine protein kinase receptors, known as type I and type II receptors (2). In the TGF- receptor system, ligand binds to the TR-II, which has a constitutively active kinase. TR-I is then recruited into the TGF-/TR-II complex and phosphorylated mainly at the glycine/serine-rich domain, which results in the activation of TR-I kinase (3). The TR-I kinase transduces intracellular signals by activation of various proteins, including SMAD proteins. The signal is transferred to the SMAD protein through the receptor kinase-mediated phosphorylation of pathwayspecific SMADs. For example, SMAD1, SMAD5, and SMAD8 are phosphorylated by the BMP receptors, whereas SMAD2 and SMAD3 are phosphorylated by activin/TGF- receptors (1). The signal is then Received 8/12/99; accepted 12/16/99. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by the Institut National de la Santé et de la Recherche Médicale and by the Ligue Contre le Cancer, Comité Départemental de l’Ain, du Rhône. M. Bo. is a recipient of a grant from the Ligue Contre le Cancer, Comité Départementale de l’Ain, France. 2 To whom requests for reprints should be addressed, at the Institut National de la Santé et de la Recherche Médicale U407, Faculté de Médecine Lyon-Sud, BP 12, 69621 Oullins Cédex, Lyon, France. Phone: 33-4-78-86-31-17; Fax: 33-4-78-86-31-16; E-mail: [email protected]. 3 The abbreviations used are: TGF, transforming growth factor; CTD, COOH-terminal domain; RT, reverse transcription; SSCP, single-strand conformational polymorphism; BMP, bone morphogenetic protein; AMH, anti-müllerian hormone; TR, TGF- receptor; MH, Mad homology; dNTP, deoxynucleotide triphosphate; nt, nucleotide(s). propagated primarily through protein-protein interactions between SMAD proteins, which are homo-oligomeric, and between SMADs and transcription factors. Specifically, the phosphorylated SMAD: (a) hetero-oligomerizes with the ubiquitous SMAD4 [phosphorylation of pathway-restricted SMADs occurs at the COOH-terminal Ser-Ser-XSer motif (4, 5)]; (b) translocates into the nucleus (6, 7); and (c) activates the transcription of various target genes. SMAD proteins have been shown to interact with DNA-binding proteins, such as winged-helix transcription factors, Xenopus, and human FAST1 and mouse FAST2 (8, 9), and also to bind directly to specific DNA sequences (10 –12). The SMAD proteins consist of two conserved domains: (a) the NH2-terminal MH1 domain; and (b) the COOH-terminal MH2 domain. These two domains are linked by a region of variable length and amino acid sequence. The MH2 domain is a functional domain that has transactivation activity when fused to the Gal4-DNA binding domain (13). The MH2 domain also plays critical roles in its interaction with type I receptors (14), homo- and hetero-oligomerization between SMAD proteins (15, 16), interaction with a transcription factor, FAST1 (17), and association with transcriptional co-activators, p300/CREB-binding protein (18, 19). The MH1 domain exhibits sequence-specific DNA binding activity and negatively regulates the functions of the MH2 domain (20). However, it has been shown that the MH1 domain has an intrinsic function in signal transduction, i.e., direct binding to specific DNA sequences. SMAD3 and SMAD4 have also been shown to bind to specific DNA sequences through their MH1 domains (10 –12, 21). The SMAD4 gene was discovered by virtue of its mutational inactivation in a large fraction of pancreatic cancers (22) and has been found to be mutated in a subset of colorectal cancers (23). The SMAD4 gene is homologous to the Drosophila Mad gene, which is known to be required for signaling by the TGF- family member decapentaplegic (dpp; Ref. 24). Based on this homology, it was suggested that the driving force for SMAD4 inactivation is the abrogation of TGF- signaling (22). This is an attractive hypothesis because many cancers seem to be unresponsive to TGF-, the prototype growth-inhibitory polypeptide (25). In the present study, we examined 20 seminoma germ cell tumors for the TGF- transducing system components including TGF-RI, TGF-RII, and SMAD (SMAD1–SMAD7) genes. Our data indicate that two patients (10%) have the same 1-bp insertion between nt 1521 and 1522 of CTD/SMAD4 tumor suppressor gene. No mutation was detected for the other TGF- components studied. MATERIALS AND METHODS Patients and Samples. Twenty seminoma testicular germ cell tumors were obtained from Dr. R. Bouvier (Department of Pathology, Edouard Herriot Hospital, Lyon, France). The samples were examined histologically by the department of pathology for the presence of tumor cells (the proportion of tumor cells was ⬎70%). Adjacent normal (nontumoral) testes tissue was also taken from 5 of the 20 patients. The patients included in this study met the following criteria: stage I-IIC disease for which complete clinical, histological, and biological information was available. 922 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA Total RNA from four nontumoral testicular tissues was also obtained from Pr. M. Devonec (Department of Urology, Center Hospitalier Lyon-Sud, Lyon, France). The nontumoral testicular tissues were from patients with prostatic carcinoma. RNA Extraction. Total RNA was extracted from samples by using the acid-phenol guanidinium method (26). The integrity of the RNA samples was determined by electrophoresis through denaturing agarose gels and by staining with ethidium bromide. The 18S and 28S RNA bands were visualized under UV light. The yield of RNA was quantified spectrophotometrically. cDNA Synthesis. RT was performed in a final volume of 20 l containing 1⫻ reverse transcriptase buffer [1 mM each dNTP, 5 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl (pH 8.3)], 20 units of RNase inhibitor, 50 units of Moloney murine leukemia virus RT kit (Life Technologies, Inc.), 2.5 M random hexamers, and 0.5 g of total RNA. The samples were incubated at 37°C for 1 h, and RT was inactivated by heating at 99°C for 5 min and cooling at 4°C for 5 min. Primers and RT-PCR Conditions. Details of the oligonucleotide primer sets, sizes of the PCR products, and PCR annealing temperatures for all seven SMAD genes used in the present study are summarized in Table 1. Primers were chosen with the aid of the DNA Star (Lasergene, London, United Kingdom) computer program. SMAD1, SMAD5, and SMAD6 were amplified as one fragment, whereas SMAD2, SMAD3, SMAD4, and SMAD7 were split into two fragments (A and B) for amplification. TR-I and TR-II details of the primer sets were available, respectively (27, 28). The PCR reaction was carried out in a final volume of 25 l containing 1 l of the RT reaction mix, composed of 10 M each primer, 200 M each dNTP, 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1 unit of AmpliTaq DNA polymerase (Promega, Madison, WI). The PCR procedure comprised the following: (a) initial denaturation at 95°C for 5 min; (b) 40 cycles of 0.5 min at 95°C, 1 min at 50 –55°C, and 1.5 min at 72°C; and (c) a final extension step of 10 min at 72°C. Aliquots of the reaction were analyzed by electrophoresis on 1.5% agarose gels. RT-PCR-SSCP Analysis. PCR was performed in a 10-l final volume including 0.5 l of the RT reaction mix, composed of 10 M each of the primers, 200 M dNTP, 1.5 mM MgCl2, 1.5 Ci of [␣-33P]dATP (2.500 Ci/mmol; Amersham, Buckinghamshire, United Kingdom), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.1% Triton X-100, and 2 units of Taq DNA polymerase (Promega). The 33P-labeled PCR products were heated for 3 min at 95°C with 20 l of formamide denaturing dye mixture (95% formamide, 20 mM EDTA, 0.05% xylene cyanol, and 0.05% bromphenol blue) and then applied (3–5 l) to 6% polyacrylamide gel (Acrylamide for Mutation Detection; Sigma-Aldrich, St. Louis, MO) containing 45 mM Tris-borate (pH 8.3) and 4 mM EDTA. Electrophoresis was performed at 6 W for 14 h. The gel was dried on 3 MM paper and exposed to X-ray film for 1 day. Samples exhibiting band shifts were reassayed using separate PCR products to verify that the shifts were not due to a Taq-induced error. Direct Sequencing. For sequencing of PCR products, a small piece of the gel corresponding to the abnormal band detected by SSCP analysis was cut out, immersed in 100 l of water, and heated at 100°C for 15 min. The centrifuged water was extracted, subjected to 35 cycles of PCR, and purified with Wizard PCR Preps DNA Purification System (Promega). The purified DNA fragments were sequenced using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branchburg, NJ). The same 5⬘ and 3⬘ side primers used for RT-PCR-SSCP were applied. The products were electrophoresed on a 6% polyacrylamide gel containing 8 M urea. All mutations were checked by sequencing two different PCR products in separate experiments. Immunohistochemistry. Paraffin sections of Bouin-fixed tumors were cut onto silanized slides. The samples were deparaffinized, rehydrated, incubated in antigen retrieval solution (pH 6 citrate buffer), and heated in a microwave oven for 15 min. They remained in the hot solution for more than 20 min. Slides were washed in PBS, endogenous peroxidases were quenched in 3% H2O2 for 15 min, and nonspecific binding was blocked with a protein solution (CSA system; DAKO, Copenhagen, Denmark) for 15 min. The SMAD4 primary antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA), which have been validated previously in an antibody supershift electrophoretic mobility shift assay (28), were diluted in the antibody diluent [(DAKO); 1:600 H-552 rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc., catalogue number sc-7154), 1:600 N-16 goat polyclonal antibody (Santa Cruz Biotechnology, Inc., catalogue number sc-1908) and 1:800 C-20 goat polyclonal antibody (Santa Cruz Biotechnology, Inc., catalogue number sc-1909)] and incubated for 2 h at room temperature. After washing, secondary antibodies were applied according to the specificity of the primary antibody: LSAB ⫹ prediluted secondary antibody (DAKO) for H-552 antibody and 1:800 rabbit antigoat immunoglobulins (DAKO) for N-16 and C-20 antibodies. A catalyzed amplification of the signal (CSA system; DAKO) was performed as recommended by the manufacturer for the rest of the procedure with the following modification: 3-amino-9-ethylcarbazole (Biomeda, Foster City, CA) that gives a red signal was used as peroxidase chromogen. Sections were briefly counterstained with Harris hematoxylin and mounted in aqueous mounting medium (Biomeda). RESULTS Presence of Abnormal cDNA in SMAD4/CTD Revealed by RT-PCR-SSCP. Twenty seminoma testicular germ cell tumor samples were assessed for mutations in TGF- receptors and SMAD (SMAD1–SMAD7) genes. Primers flanking the SMADs CTD were used to generate PCR products of different sizes (Table 1). To detect the presence of mutations, electrophoresis was performed under optimal running conditions that yielded the most dramatic mobility shift for mutants when compared to the wild-type cDNA both in TR-I and -II and in SMAD genes. To compare the mutational status between normal (nontumoral) and seminoma samples, total RNA was isolated from both normal (nontumoral) and tumor surgical tissues and then reverse-transcribed to generate first-strand cDNAs. From each tumor sample, two overlapping RT-PCR fragments covering all exons of TR-I and -II and the Table 1 Oligonucleotide primers used to amplify SMAD gene segments analyzed by RT-PCR-SSCP and sequencing Sequence Oligonucleotide namea SMAD1 SMAD2 SMAD2 SMAD3 SMAD3 SMAD4 SMAD4 SMAD5 SMAD6 SMAD7 SMAD7 (A) (B) (A) (B) (A) (B) (A) (B) Sense Antisensec Product size (bp)d Annealing temperature (°C)e GAGGGGGCCGTGCAGATGTAT CGTCTGCCTTCGGTATTCTG ATAGGGGGACCACAACACCAATG GGGGAGGGTGCCGGTGGTGTAATA CTCCCTCCCTCCCCATCCCAAGTC GAGCTATTCCACCTACTGAT TAAGGGCCCCAACGGTAAA TAGGCAGGAGGAGGCGTATCAGC GTCCGTGGGGGCTGTGTCTCTGG GTCGAAAGCCTTGATGGAGAAACC GGCTACCGGCTGTTGAA 353 269 235 283 286 264 274 395 297 294 283 53 53 53 59 50 53 53 50 55 55 55 b GGCGGCATATTGGAAAAGGAGTT TAGGTGGGGAAGTTTTTGCTGATG GTGAAAGGGTGGGGAGCAGAATAC GGAGGGCAGGCTTGGGGAAAATG TAAGTGAGCAGAACAGGTAGTATT AAGGTGAAGGTGATGTTTG TGGCCCAGGATCAGTAGGTG TGGCCGGATTTGCAGAGTCAT CCCCCGGCTACTCCATCAAGGTGT GTGGGGAGGCTCTACTGTGTC ACCGCAGCAGTTACCCCATCTT a Name of primer sequences for amplification of each SMAD. SMAD2, SMAD3, SMAD4, and SMAD7 were split into two fragments (A and B) for amplification. Sense primer sequence (5⬘–3⬘). Antisense primer sequence (5⬘–3⬘). d Size of PCR product obtained. e Annealing temperature optimized for each SMAD sequence. b c 923 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA DISCUSSION Fig. 1. SSCP analysis of the SMAD4 gene segment. SSCP analysis was performed on reverse-transcribed RNAs from seminoma testicular germ cell tumors using primers flanking the COOH-terminal SMAD4 gene (primer sense position, nt 1303–1321; primer antisense position, nt 1547–1566). Altered mobility in PCR-amplified single-stranded DNAs corresponding to nt insertion (nt 1521 Ins T) is indicated by arrows. Lanes 4 and 5 correspond to the normal (nontumoral) testis tissue, and Lanes 6 –9 correspond to seminoma testicular germ cell tumors. CTD region of each SMAD were analyzed, and SSCP analysis was performed. A typical analysis is shown in Fig. 1. The characteristic double-band representing the two complementary cDNA strands of SMAD4 was observed in each of the tumors examined with the exception of that from patient 7, where there was a marked mobility shift of the PCR products. It is worth noting that the PCR signal of the remaining wild-type allele in patient 7 was detectable, suggesting the presence of the normal allele; consequently, this patient is heterozygous for SMAD4 mutation. Under comparable experimental conditions, we detected no mutation for the other SMADs and TR-I and -II genes in the 20 seminomas studied. Sequencing Analysis and Identification of the Insertional Mutation at SMAD4/CTD. To investigate the genetic alteration responsible for the allelic shift in the SMAD4/CTD gene, a PCR-amplified fragment encompassing this region was examined for all tumor samples including that from patient 7 (positive case for SSCP analysis) and subjected to sequence analysis. Of the 20 cDNAs examined, two displayed the same disparity from the wild-type nt sequence: cDNA from patients 6 and 7 was positive for the insertional mutation. As shown in Fig. 2, the modification in SMAD4/CTD sequence involves the insertion of 1 bp between nt 1521 and 1522, resulting in the modification of the protein reading frame from codon 465 and the truncation of the protein at codon 492, which causes the loss of the L3-loop region (Fig. 3). The sequence analysis of TR-I, TR-II, and SMADs (SMAD1, SMAD2, SMAD3, SMAD5, SMAD6, and SMAD7) detected no mutations in any of the sequences studied. Expression of SMAD4 Protein by Immunohistochemistry. The SMAD4 gene product was examined immunohistochemically in seminoma testicular germ cell tumors that appeared to be negative or positive for the insertional mutation. Nonmutated testicular tissues showed strong positive staining for the whole molecule (H-552) as well as for the NH2- and COOH-terminal regions of SMAD4 protein (positive controls). They were strongly stained by either the antibody directed against the NH2 terminus (N-16) or the antibody directed against the whole molecule (H-552) or by the antibody directed against the COOH terminus (examples are shown in Fig. 4, A–C). The N-16 antibody directed against the NH2 terminus of SMAD4 protein as well as the H-552 directed against the whole molecule also strongly stained tumor cells with mutated SMAD4, whereas tumor cells with mutated SMAD4 (patients 6 and 7), were mostly negative with the antibody directed against COOH-terminus of SMAD4 protein. Only very rare cells were positive with the C-20 antibody (Fig. 4, D–F). Several members of TGF- family are involved in gonadal development: (a) TGF-s; (b) inhibins; (c) activins; (d) AMH; and (e) BMP-8b. These proteins play either a stimulatory role or an inhibitory role in the division, differentiation, and apoptosis of gonadal cells. In addition, work with transgenic mice has demonstrated that two TGF- family members, inhibin and AMH, act as gonadal tumor suppressors (1, 2, 29). TGF- is well known for its antiproliferative activity in the majority of mammalian cells, and loss of TGF- responsiveness has been documented to be associated with aggressive neoplasms (30). It has therefore been suggested that loss of the activity of a TGF- signaling pathway component, such as SMAD4, would be selected for the clonal evolution of neoplasms. Furthermore, a recent report (31) has linked SMAD4 to other pathways including the stress-activated protein kinase/c-Jun NH2-terminal kinase cascade, implicating SMAD4 in both the control of cell cycle arrest and apoptosis. This suggests that a SMAD4-dependent malignancy may also arise after disruption of these key regulatory mechanisms. The screening of SMAD genes in seminoma testicular germ cell tumors by RT-PCR-SSCP analysis revealed a SMAD4 insertional mutation in one patient. We performed direct sequencing of SMAD4 in the remaining 19 samples from patients with normal SSCP band patterns. All normal (nontumoral) and seminoma patient samples were sequenced for SMAD4 mutations to test the reliability of the SSCP analysis. The data obtained showed the presence, in another sample, of a mutation similar to that detected by the SSCP approach. Both of these cases were found to carry an insertional mutation (T insertion between nt 1521 and 1522) in a highly conserved residue at codon 465 within the MH2 region of the SMAD4 protein. This insertion causes a frameshift that creates a new stop codon, producing a truncated protein at codon 492 (nt 1785–1787 of the wild-type sequence), with loss of critical regions for normal function, such as the L3-loop region. All of the other tumors analyzed showed the sequence of wild-type CTD-SMAD4 gene. In support of the functional significance of the loop/helix region, mutations in Drosophila and Caenorhabditis elegans in this region produce null or severe developmental phenotypes (32). These mutations map to Gly508 (Drosophila Mad, C. elegans sma-2), Gly510 (sma-3), and Glu520 (Mad) of the L3-loop in the loop/helix region. Thus, the location of conserved, solventexposed residues and the location of mutations derived from tumors or from Drosophila and C. elegans genetic screens together indicate that the loop/helix region and the three-helix bundle are critical for mediating SMAD activity. All four of the tumorigenic mutations that are important at the trimer interface (Asp351, Arg361, Val370, and Asp537) disrupt homo-oligomerization of the SMAD4/CTD and the full-length SMAD4 (33). G508S had no effect on homo-oligomerization. This Fig. 2. Characterization of the mutant CTD/SMAD4 gene. nt sequence analysis flanking codon 465 showing wild-type and mutant SMAD4 (Cases 6 and 7) sequences. The insertion of 1 bp at codon 465 in the mutant strand of SMAD4 is indicated by arrows. 924 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA Fig. 3. Segment of the human wild-type and mutated forms of the COOH-terminal SMAD4 gene structure. A, schematic representation of a segment of wild-type COOH-terminal SMAD4; the L3-loop sequence is underlined. B, schematic representation of a segment of the COOH-terminal SMAD4 sequence after insertional mutation. The nt inserted is indicated by the arrow at codon 465. mutation maps to the L3-loop, which is the only portion of the loop/helix region that is not involved in the trimer interface. Both the tumor-derived trimer interface and the L3-loop mutants abolished hetero-oligomerization between the CTDs of SMAD4 and SMAD2. Because the L3-loop developmental mutation, which does not significantly affect homo-oligomerization, disrupts hetero-oligomer formation, the L3-loop may participate in hetero-oligomerization. In addition, mutations preventing homo-oligomerization also disrupt hetero-oligomerization, indicating that the former is a prerequisite for the latter. Although several models of hetero-oligomerization could explain our results, the one that appears to be most relevant from a structural perspective is the formation of a heterohexamer between SMAD4 and SMAD2 trimers. The trimer structure resembles a disc, with the L3-loops forming undulations on the face of the disc. Two discs could fit together face to face through their L3 loops, which could explain why L3-loop mutations disrupt hetero-oligomerization. Heterohexamer formation would depend on homotrimer formation and would thus explain how tumorigenic mutations that disrupt homooligomerization can prevent the formation of a functional heterooligomeric complex and interfere with signal transduction. SSCP analysis has been used successfully to detect single-base changes in diverse previous studies (34, 35), and we readily detected the same single-base insertion in one patient in the present study. Accordingly, the efficiency of the SSCP approach in detecting the SMAD4 gene mutation was limited to only one of the two patients with the mutation. However, it remains possible that RT-PCR-SSCP analysis using RNAs from microdissected tumor specimen rather than from the macroscopic specimen used in our study might yield higher mutation frequencies of SMAD genes. It may also be worth examining noncodon regions of SMAD4 and the methylation status of this gene. With regard to our present finding, to our knowledge, this is the first report that associates the SMAD4 gene mutation with the seminoma testicular germ cell tumor. Considering the mutation rates of other tumor suppressor genes, this result suggests that the SMAD4 gene plays an important role in the development of testicular tumors. Such a mutation of SMAD4 may affect not only the activity of TGF- but also that of the other members of the peptide family, including activin and BMP. Indeed, the signaling pathway analysis of activin, BMP, and TGF- signaling in different systems (Xenopus embryos and mammalian cells) in diverse studies showed that all of the responses tested depend on interactions between SMAD4 and one of the other SMADs. The TGF- signaling network is disrupted in other tumors by mutations in SMAD4 and also in SMAD2. SMAD4 was originally identified as a candidate tumor suppressor gene in chromosome 18q21 that was somatically deleted or mutated in half of all human pancre- 925 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA Fig. 4. Immunohistochemistry of SMAD4 protein in samples 6 and 7 (mutated SMAD4) and in two nonmutated samples (positive controls). As observed in all tested seminoma, nonmutated tumor cells were strongly stained with C-20 antibody, but the surrounding inflammatory cells were not (A). On the contrary, tumors sharing insertional mutation of SMAD4 were almost negative for staining with the C-20 antibody (D). Higher magnifications show that only rare, isolated cells were stained by the C-20 antibody (E and F) in tumors sharing insertional mutation, whereas nonmutated tumor cells were strongly positive for C-20 staining (B and C). A and D, ⫻130; B, C, E, and F, ⫻530). atic carcinomas examined (21). Biallelic SMAD4 inactivation also occurs in a significant proportion of colorectal tumors (36). SMAD4 is rarely mutated in breast (37), ovarian (37), head and neck (38), prostatic (36), esophageal and gastric cancers (39). In the mouse, SMAD4 inactivation causes intestinal tumors in accordance with inactivation of another tumor suppressor gene, adenomatosis polyposis coli (40). The loss of TGF- responsiveness in colon cancer may therefore be due to mutations in TR-II, SMAD2, or SMAD4. Interestingly, the predominance of SMAD4 mutations in pancreatic cancer, together with the low frequency of mutations in TR-II in these tumors (41), raises the possibility that loss of SMAD4 function might be selected during tumorigenesis for resistance to an endogenous 926 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA factor other than TGF- itself. It is therefore significant that a number of mutations have been identified within the SMAD4 gene itself, strongly supporting a causal link between loss of function and the occurrence of malignancy. These findings raise the possibility that SMAD4 acts as a global tumor suppressor gene. However, SMAD4 loss has been found to be relatively rare in a range of other tumor types. SMAD2 is also located at 18q21 and is also the target for inactivating mutations in colon cancer (42). The prevalence of SMAD2 mutations in other neoplasms is not well characterized to date, although there is evidence to suggest that SMAD2 may be mutated in a subset of leukemias and lymphomas (43) and also in lung carcinomas (approximately 4%; Ref. 34). Disruption of the SMAD2 gene during development results in a complete loss of embryonic germ layer tissues (44), confirming that SMAD2, like SMAD4, plays an essential role in development. However, based on our data, SMAD2 alterations do not appear to be associated with seminomas. Interestingly, there are at least two reports indicating an alteration in chromosome 18: (a) by using comparative genomic hybridization, losses within the entire genome represented 43% of the total number of alterations often affecting chromosomes and chromosome arm 4, 5, 11, 13q, and particularly 18q (where the SMAD4 gene is located; Ref. 45); and (b) by using cytogenetic analysis in a series of four testicular tumors, it has been shown that chromosome 18 was underrepresented in all these tumors (46). In summary, a technical approach comprising RT-PCR-SSCP, sequencing, and immunohistochemistry was used to perform mutational analysis of the TGF- signaling components TGF-RI, TGF-RII, and SMAD1–SMAD7. The only component of the TGF- signaling system that was found to be affected in seminomas is SMAD4. Indeed, a novel mutation (insertional mutation) in the SMAD4 gene was detected in 10% of the 20 seminomas examined. No mutation was found in the other SMADs or in the TR-I and -II genes. The size of the subject cohort used in this study was too small to permit any meaningful analysis of the relationship between the SMAD4 gene mutation, protein expression, patient survival, and clinical characteristics. ACKNOWLEDGMENTS We thank Dr. J. L. Requin (Ligue Contre le Cancer, Comité Départemental de l’Ain, France) for constant support during the course of this study. We thank Drs. G. Quach (INSERM U329, Lyon, France) and S. Krantic (INSERM U407, Lyon, France) for critical reading of the manuscript. REFERENCES 1. Massagué, J. TGF- signal transduction. Annu. Rev. Biochem., 67: 753–791, 1998. 2. Derynck, R., and Feng, X-H. TGF- receptor signaling. Biochim. Biophys. Acta, 1333: F105–F150, 1997. 3. Wrana, J-L., Attisano, L., Wieser, R., Ventura, F., and Massagué, J. Mechanism of activation of the TGF- receptor. Nature (Lond.), 370: 341–347, 1994. 4. Souchelnytskyi, S., Tamaki, K., Engstrom, U., Wernstedt, C., ten Dijke, P., and Heldin, C. H. Phosphorylation of Ser465 and Ser467 in the C-terminus of SMAD2 mediates interaction with SMAD4 and is required for transforming growth factor- signaling. J. Biol. Chem., 272: 28107–28115, 1997. 5. Abdollah, S., Macias-Silva, M., Tsukazaki T, Hayashi, H., Attisano, L., and Wrana J. L. TRI phosphorylation of SMAD2 on Ser465 and Ser467 is required for SMAD2SMAD4 complex formation and signaling. J. Biol. Chem., 272: 27678 –27685, 1997. 6. Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O’Connor, M. B., Attisano, L., and Wrana, J. L. MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell, 85: 489 –500, 1996. 7. Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and Massagué, J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature (Lond.), 381: 620 – 623, 1996. 8. Zhou, S., Zawel, L., Lengauer, C., Kinzler, K. W., and Vogelstein, B. Characterization of human FAST-1, a TGF- and activin signal transducer. Mol. Cell, 2: 121–127, 1998. 9. Labbe, E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L. SMAD2 and SMAD3 positively and negatively regulate TGF-dependent transcription through the forkhead DNA-binding protein FAST-2. Mol. Cell, 2: 109 –120, 1998. 10. Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., and Kern, S. E. Human SMAD3 and SMAD4 are sequence specific transcription activators. Mol. Cell, 1: 611– 617, 1998. 11 Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. M. Direct binding of SMAD3 and SMAD4 to critical TGF-inducible elements in the promoter of human plasminogen activator inhibitor-type1 gene. EMBO J., 17: 3091–3100, 1998. 12. Jonk, L. J. C., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. Identification and functional characterization of a SMAD binding element (SBE) in the Jun B promoter that acts as a transforming growth factor-, activin, and bone morphogenetic proteininducible enhancer. J. Biol. Chem., 273: 21145–21152, 1998. 13. Meersseman, G., Verschueren, K., Nelles, L., Blumenstock, C., Kraft, H., Wuytens, G., Remacle, J., Kozak, C. A., Tylzanowski, P., Niehrs, C., and Huylebroeck, D. The C-terminal domain of Mad-like signal transducers is sufficient for biological activity in the Xenopus embryo and transcriptional activation. Mech. Dev., 61: 127–140, 1997. 14. Lo, R. S., Chen, Y-G., Shi, Y., Pavletich, N. P., and Massagué, J. The L3 loop: a structural motif determining specific interactions between SMAD proteins and TGF receptors. EMBO J., 17: 996 –1005, 1998. 15. Wu, R-Y., Zhang, Y., Feng, X-H., and Derynck, R. Heteromeric and homomeric interactions correlate with signaling activity and functional cooperativity of SMAD3 and SMAD4/DPC4. Mol. Cell. Biol., 17: 2521–2528, 1997. 16. Zhang, Y., Musci, T., and Derynck, R. The tumor suppressor SMAD4/DPC4 as a central mediator of SMAD function. Curr. Biol., 7: 270 –276, 1997. 17. Liu, F., Pouponnot, C., and Massagué, J. Dual role of the SMAD4/DPC4 tumor suppressor in TGF-inducible transcriptional complexes. Genes Dev., 11: 3157– 3167, 1997. 18. Topper, J. N., Dichiara, M. R., Brown, J. D., Williams, A. J., Falb, D., Collins, T., and Gimbrone, M. A., Jr. CREB binding protein is a required coactivator for SMADdependent, transforming growth factor  transcriptional responses in epithelial cells. Proc. Natl. Acad. Sci. USA, 95: 9506 –9511, 1998. 19. Nishihara, A., Hanai, J., Okamoto, N., Yanagisawa, J., Kato, S., Miyazono, K., and Kawabata, M. Role of p300, a transcriptional coactivator, in signalling of TGF. Genes Cells, 3: 613– 623, 1998. 20. Kretzschmar, M., and Massagué, J. SMADs: mediators and regulators of TGF- signaling. Curr. Opin. Genet. Dev., 8: 103–111, 1998. 21. Song, C-Z., Siok, T. E., and Gelehrter, T. D. SMAD4/DPC4 and SMAD3 mediate transforming growth factor- (TGF-) signaling through direct binding to a novel TGF--responsive element in the human plasminogen activator inhibitor-1 promoter. J. Biol. Chem., 273: 29287–29290, 1998. 22. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T., Rozemblum, E., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern, S. E. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science (Washington DC), 271: 350 –353, 1996. 23. Thiagalingam, S., Lengauer, C., Leach, F. S., Schutte, M., Hahn, S. A., Overhauser, J., Wilson, J. K. V., Markowitz, S., Hamilton, S. R., Kern, S. E., Kinzler, K. W., and Vogelstein, B. Evaluation of candidate tumor suppressor genes on chromosome 18 in colorectal cancers. Nat. Genet., 13: 343–346, 1996. 24. Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart W. M. Genetic characterization and cloning of mothers against dpp, a gene required for decapentaplegic function in Drosophila melanogaster. Genetics, 139: 1347–1358, 1995. 25. Fynan, T. M., and Reiss, M. Resistance to inhibition of cell growth by transforming growth factor  and its role in oncogenesis. Crit. Rev. Oncog., 4: 493–540, 1993. 26. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156 –159, 1987. 27. Chen, T., Carter, D., Garringue-Antar, L., and Reiss, M. Transforming growth factor  type I receptor kinase mutant associated with metastatic breast cancer. Cancer Res., 58: 4805– 4810, 1998. 28. Takenoshita, S., Tani, M., Nagashima, M., Hagiwara, K., Bennett, P. W., Yokota, J., and Harris, C. C. Mutation analysis of coding sequences of the entire transforming growth factor  type II receptor gene in sporadic human colon cancer using genomic DNA and intron primers. Oncogene, 14: 1255–1258, 1997. 29. Josso, N., and di Clemente, N. TGF- family members and gonadal development. Trends Endocrinol. Metab., 10: 216 –222, 1999. 30. Polyak, K. Negative regulation of cell growth by TGF. Biochim. Biophys. Acta, 1242: 185–199, 1996. 31. Atfi, A., Buisine, M., Mazars, A., and Gespach, C. Induction of apoptosis by SMAD4, a transcriptional factor regulated by transforming growth factor- through stressactivated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling pathway. J. Biol. Chem., 272: 24731–24734, 1997. 32. Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C-Y., Baird, S. E., and Padgett, R. W. Caenorhabditis elegans genes Sma-2, Sma-3, and Sma-4 define a conserved family of transforming growth factor  pathway components. Proc. Natl. Acad. Sci. USA, 93: 790 –794, 1996. 33. Shi, Y., Hata, A., Lo, R. S., Massagué, J., and Pavletich, N. P. A structural basis for mutational inactivation of the tumor suppressor SMAD4. Nature (Lond.), 388: 87–93, 1997. 34. Uchida, K., Nagatake, M., Osada, H., Yatabe, Y., Kondo, M., Mitsudomi, T., Masuda, A., Takahashi, T., and Takahashi, T. Somatic in vivo alterations of the JV18-1 gene at 18q21 in human lung cancers. Cancer Res., 56: 5583–5585, 1996. 35. Satoshi, T., Aikou, O., Misato, S., Takaomi, Y., Hideo, S., Seiji, I., Tomoaki, Y., Yasuyuki, O., Kazunori, O., and Tadao, T. Allelic imbalance in chromosome band 927 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. SMAD4 GENE MUTATION IN SEMINOMA 36. 37. 38. 39. 40. 18q21 and SMAD4 mutations in ovarian cancers. Genes Chromosomes Cancer, 24: 264 –271, 1999. MacGrogan, D., Pegram, M., Slamon, D., and Bookstein, R. Comparative mutational analysis of DPC4 (SMAD4) in prostatic and colorectal carcinoma. Oncogene, 15: 1111–1114, 1997. Schutte, M., Hruban, R. H., Hedrick, L., Cho, K. R., Nadasdy, G. M., Weinstein, C. L., Bosa, G. S., Isaacs, W. B., Cairns, P., Nawroz, H., Sidransky, D., Casero, R. A., Jr., Meltzer, P. S., Hahn, S. A., and Kern, S. E. DPC4 gene in various tumor types. Cancer Res., 56: 2527–2530, 1996. Kim, S. K., Fan, Y., Papadimitrakopoulo, V., Clayman, G., Hittelman, W. N., Hong, W. K., Lotan, R., and Mao, L. DPC4, a candidate tumor suppressor gene is altered infrequently in head and neck squamous cell carcinoma. Cancer Res., 56: 2519 –2521, 1996. Lei, J. Y., Zou, T. T., Shi, Y. Q., Zhou, X. L., Smolinski, K. N., Yin, J., Souza, R., Appel, R., Wang, S., Cynes, K., Chan, O., Abraham, J. M., and Meltzer S. J. Infrequent DPC4 gene mutation in esophageal cancer, gastric cancer, and ulcerative colitis-associated neoplasms. Oncogene, 13: 2459 –2462, 1996. Takaku, K., Oshima, M., Miyoshi, H., Matsui, M., Seldin, M. F., and Taketo, M. M. Intestinal tumorigenesis in compound mutant mice of both DPC4 (SMAD4) and Apc genes. Cell, 92: 645– 656, 1998. 41. Vincent, F., Hagiwara, K., Ke, Y., Stoner, G. D., Demetrick, D. J., and Benett, W. P. Mutation analyses of the transforming growth factor- type II receptor in sporadic human cancers of the pancreas, liver, and breast. Biochem. Biophys. Res. Commun., 223: 561–564, 1996. 42. Riggins, G. J., Thiagalingam, S., Rozenblum, E., Weinstein, C. L., Kern, S. E., Hamilton, S. R., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B. Mad related genes in the human. Nat. Genet., 13: 347–349, 1996. 43. Ikezoe, T., Takeuchi, S., Kamioka, M., Daibata, M., Kubonishi, I., Taguchi, H., and Miyoshi, I. Analysis of the SMAD2 gene in haematological malignancies. Leukemia, 12: 94 –95, 1998. 44. Waldrip, W. R., Bikoff, E. K., Hoodless, P. A., Wrana, J. L., and Robertson, R. J. SMAD2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell, 92: 797– 808, 1998. 45. Parrington, J. M., West, L. F., and Heyderman, E. Chromosome analysis of parallel short-term cultures from four testicular germ-cell tumors. Cancer Genet. Cytogenet., 75: 90 –102, 1994. 46. Ottesen, A. M., Kirchhoff, M., De-Meyts, E. R., Maahr, J., Gerdes, T., Rose, H., Lundsteen, C., Petersen, P. M., Philip, J., and Skakkebaek, N. E. Detection of chromosomal aberrations in seminomatous germ cell tumors using comparative genomic hybridization. Genes Chromosomes Cancer, 20: 412– 418, 1997. 928 Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research. A Novel SMAD4 Gene Mutation in Seminoma Germ Cell Tumors Mourad Bouras, Eric Tabone, Jacques Bertholon, et al. Cancer Res 2000;60:922-928. Updated version Cited articles Citing articles E-mail alerts Reprints and Subscriptions Permissions Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/60/4/922 This article cites 46 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/60/4/922.full.html#ref-list-1 This article has been cited by 7 HighWire-hosted articles. Access the articles at: /content/60/4/922.full.html#related-urls Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected]. Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer Research.