Download A Novel SMAD4 Gene Mutation in Seminoma

[CANCER RESEARCH 60, 922–928, February 15, 2000]
A Novel SMAD4 Gene Mutation in Seminoma Germ Cell Tumors1
Mourad Bouras, Eric Tabone, Jacques Bertholon, Pascal Sommer, Raymonde Bouvier, Jean-Pierre Droz, and
Mohamed Benahmed2
Institut National de la Santé et de la Recherche Médicale U407, Faculté de Médecine Lyon-Sud, 69621 Oullins Cédex [M. Bo., J. B., M. Be., R. B.]; Centre Léon Berard [E. T.,
J-P. D.] and Institut de Biologie et de Chimie des Protéines [P. S.], 69007 Lyon Cédex 07; and Hôpital Edouard Herriot, 69373 Lyon Cédex [R. B.], France
ABSTRACT
Transforming growth factor (TGF)-␤ is known as an antiproliferative
factor in the majority of mammalian cells, including stem germ cells. Lack
of TGF-␤-induced growth inhibition has been associated with disruptions
of TGF-␤ receptors and SMADs. In the present study, we performed a
mutational analysis of the TGF-␤ signaling system, including TGF-␤
receptor type I and type II and SMADs (SMAD1–SMAD7), in 20 seminoma germ cell tumors. Using reverse transcription-PCR, single-strand
conformational polymorphism, and sequencing analysis, the COOHterminal domain of SMAD4 was found to be mutated: a single thymine
was inserted between nt 1521 and 1522 in 2 of 20 tumors analyzed. This
addition of a thymine creates a frameshift and a new stop signal at codon
492, which leads to premature termination of the encoded protein. Such a
mutation potentially abrogates signaling from TGF-␤ as well as the other
TGF-␤ family members, including activin and bone morphogenetic protein, which all use the SMAD pathway. Immunohistological analysis confirmed the loss of expression of SMAD4 protein in the seminoma tissues
with the insertional mutation. To our knowledge, this is the first description of a novel SMAD4 insertional mutation in seminoma testicular germ
cell tumors. This mutational inactivation of SMAD4/COOH-terminal domain may cause TGF-␤ unresponsiveness. It could thus provide a basis for
understanding the potential role of the TGF-␤ system in germ cell tumorigenesis.
INTRODUCTION
The TGF-␤3 family of growth factors regulates different biological
processes including proliferation, differentiation, development, and
extracellular matrix production (1). This family represents a large
number of peptides including TGF-␤s, activin/inhibin, AMH, and
BMP (1, 2).
The members of the TGF-␤ superfamily transduce signals through
two different types of serine/threonine protein kinase receptors,
known as type I and type II receptors (2). In the TGF-␤ receptor
system, ligand binds to the T␤R-II, which has a constitutively active
kinase. T␤R-I is then recruited into the TGF-␤/T␤R-II complex and
phosphorylated mainly at the glycine/serine-rich domain, which results in the activation of T␤R-I kinase (3). The T␤R-I kinase transduces intracellular signals by activation of various proteins, including
SMAD proteins. The signal is transferred to the SMAD protein
through the receptor kinase-mediated phosphorylation of pathwayspecific SMADs. For example, SMAD1, SMAD5, and SMAD8 are
phosphorylated by the BMP receptors, whereas SMAD2 and SMAD3
are phosphorylated by activin/TGF-␤ receptors (1). The signal is then
Received 8/12/99; accepted 12/16/99.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported by the Institut National de la Santé et de la Recherche Médicale and by the
Ligue Contre le Cancer, Comité Départemental de l’Ain, du Rhône. M. Bo. is a recipient
of a grant from the Ligue Contre le Cancer, Comité Départementale de l’Ain, France.
2
To whom requests for reprints should be addressed, at the Institut National de la
Santé et de la Recherche Médicale U407, Faculté de Médecine Lyon-Sud, BP 12, 69621
Oullins Cédex, Lyon, France. Phone: 33-4-78-86-31-17; Fax: 33-4-78-86-31-16; E-mail:
[email protected].
3
The abbreviations used are: TGF, transforming growth factor; CTD, COOH-terminal
domain; RT, reverse transcription; SSCP, single-strand conformational polymorphism;
BMP, bone morphogenetic protein; AMH, anti-müllerian hormone; T␤R, TGF-␤ receptor;
MH, Mad homology; dNTP, deoxynucleotide triphosphate; nt, nucleotide(s).
propagated primarily through protein-protein interactions between
SMAD proteins, which are homo-oligomeric, and between SMADs
and transcription factors. Specifically, the phosphorylated SMAD: (a)
hetero-oligomerizes with the ubiquitous SMAD4 [phosphorylation of
pathway-restricted SMADs occurs at the COOH-terminal Ser-Ser-XSer motif (4, 5)]; (b) translocates into the nucleus (6, 7); and (c)
activates the transcription of various target genes. SMAD proteins
have been shown to interact with DNA-binding proteins, such as
winged-helix transcription factors, Xenopus, and human FAST1 and
mouse FAST2 (8, 9), and also to bind directly to specific DNA
sequences (10 –12).
The SMAD proteins consist of two conserved domains: (a) the
NH2-terminal MH1 domain; and (b) the COOH-terminal MH2 domain. These two domains are linked by a region of variable length and
amino acid sequence. The MH2 domain is a functional domain that
has transactivation activity when fused to the Gal4-DNA binding
domain (13). The MH2 domain also plays critical roles in its interaction with type I receptors (14), homo- and hetero-oligomerization
between SMAD proteins (15, 16), interaction with a transcription
factor, FAST1 (17), and association with transcriptional co-activators,
p300/CREB-binding protein (18, 19). The MH1 domain exhibits
sequence-specific DNA binding activity and negatively regulates the
functions of the MH2 domain (20). However, it has been shown that
the MH1 domain has an intrinsic function in signal transduction, i.e.,
direct binding to specific DNA sequences. SMAD3 and SMAD4 have
also been shown to bind to specific DNA sequences through their
MH1 domains (10 –12, 21).
The SMAD4 gene was discovered by virtue of its mutational inactivation in a large fraction of pancreatic cancers (22) and has been
found to be mutated in a subset of colorectal cancers (23). The
SMAD4 gene is homologous to the Drosophila Mad gene, which is
known to be required for signaling by the TGF-␤ family member
decapentaplegic (dpp; Ref. 24). Based on this homology, it was
suggested that the driving force for SMAD4 inactivation is the abrogation of TGF-␤ signaling (22). This is an attractive hypothesis
because many cancers seem to be unresponsive to TGF-␤, the prototype growth-inhibitory polypeptide (25).
In the present study, we examined 20 seminoma germ cell tumors
for the TGF-␤ transducing system components including TGF␤-RI,
TGF␤-RII, and SMAD (SMAD1–SMAD7) genes. Our data indicate
that two patients (10%) have the same 1-bp insertion between nt 1521
and 1522 of CTD/SMAD4 tumor suppressor gene. No mutation was
detected for the other TGF-␤ components studied.
MATERIALS AND METHODS
Patients and Samples. Twenty seminoma testicular germ cell tumors were
obtained from Dr. R. Bouvier (Department of Pathology, Edouard Herriot
Hospital, Lyon, France). The samples were examined histologically by the
department of pathology for the presence of tumor cells (the proportion of
tumor cells was ⬎70%).
Adjacent normal (nontumoral) testes tissue was also taken from 5 of the 20
patients. The patients included in this study met the following criteria: stage
I-IIC disease for which complete clinical, histological, and biological information was available.
922
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
Total RNA from four nontumoral testicular tissues was also obtained from
Pr. M. Devonec (Department of Urology, Center Hospitalier Lyon-Sud, Lyon,
France). The nontumoral testicular tissues were from patients with prostatic
carcinoma.
RNA Extraction. Total RNA was extracted from samples by using the
acid-phenol guanidinium method (26). The integrity of the RNA samples was
determined by electrophoresis through denaturing agarose gels and by staining
with ethidium bromide. The 18S and 28S RNA bands were visualized under
UV light. The yield of RNA was quantified spectrophotometrically.
cDNA Synthesis. RT was performed in a final volume of 20 ␮l containing
1⫻ reverse transcriptase buffer [1 mM each dNTP, 5 mM MgCl2, 50 mM KCl,
and 10 mM Tris-HCl (pH 8.3)], 20 units of RNase inhibitor, 50 units of
Moloney murine leukemia virus RT kit (Life Technologies, Inc.), 2.5 ␮M
random hexamers, and 0.5 ␮g of total RNA. The samples were incubated at
37°C for 1 h, and RT was inactivated by heating at 99°C for 5 min and cooling
at 4°C for 5 min.
Primers and RT-PCR Conditions. Details of the oligonucleotide primer
sets, sizes of the PCR products, and PCR annealing temperatures for all seven
SMAD genes used in the present study are summarized in Table 1. Primers
were chosen with the aid of the DNA Star (Lasergene, London, United
Kingdom) computer program. SMAD1, SMAD5, and SMAD6 were amplified
as one fragment, whereas SMAD2, SMAD3, SMAD4, and SMAD7 were split
into two fragments (A and B) for amplification.
T␤R-I and T␤R-II details of the primer sets were available, respectively
(27, 28).
The PCR reaction was carried out in a final volume of 25 ␮l containing 1
␮l of the RT reaction mix, composed of 10 ␮M each primer, 200 ␮M each
dNTP, 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1 unit of
AmpliTaq DNA polymerase (Promega, Madison, WI).
The PCR procedure comprised the following: (a) initial denaturation at
95°C for 5 min; (b) 40 cycles of 0.5 min at 95°C, 1 min at 50 –55°C, and 1.5
min at 72°C; and (c) a final extension step of 10 min at 72°C. Aliquots of the
reaction were analyzed by electrophoresis on 1.5% agarose gels.
RT-PCR-SSCP Analysis. PCR was performed in a 10-␮l final volume
including 0.5 ␮l of the RT reaction mix, composed of 10 ␮M each of the
primers, 200 ␮M dNTP, 1.5 mM MgCl2, 1.5 ␮Ci of [␣-33P]dATP (2.500
Ci/mmol; Amersham, Buckinghamshire, United Kingdom), 10 mM Tris-HCl
(pH 8.3), 50 mM KCl, 0.1% Triton X-100, and 2 units of Taq DNA polymerase
(Promega). The 33P-labeled PCR products were heated for 3 min at 95°C with
20 ␮l of formamide denaturing dye mixture (95% formamide, 20 mM EDTA,
0.05% xylene cyanol, and 0.05% bromphenol blue) and then applied (3–5 ␮l)
to 6% polyacrylamide gel (Acrylamide for Mutation Detection; Sigma-Aldrich, St. Louis, MO) containing 45 mM Tris-borate (pH 8.3) and 4 mM EDTA.
Electrophoresis was performed at 6 W for 14 h. The gel was dried on 3 MM
paper and exposed to X-ray film for 1 day. Samples exhibiting band shifts were
reassayed using separate PCR products to verify that the shifts were not due to
a Taq-induced error.
Direct Sequencing. For sequencing of PCR products, a small piece of the
gel corresponding to the abnormal band detected by SSCP analysis was cut out,
immersed in 100 ␮l of water, and heated at 100°C for 15 min. The centrifuged
water was extracted, subjected to 35 cycles of PCR, and purified with Wizard
PCR Preps DNA Purification System (Promega). The purified DNA fragments
were sequenced using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branchburg, NJ). The same 5⬘ and 3⬘ side primers used for RT-PCR-SSCP were
applied. The products were electrophoresed on a 6% polyacrylamide gel
containing 8 M urea. All mutations were checked by sequencing two different
PCR products in separate experiments.
Immunohistochemistry. Paraffin sections of Bouin-fixed tumors were cut
onto silanized slides. The samples were deparaffinized, rehydrated, incubated
in antigen retrieval solution (pH 6 citrate buffer), and heated in a microwave
oven for 15 min. They remained in the hot solution for more than 20 min.
Slides were washed in PBS, endogenous peroxidases were quenched in 3%
H2O2 for 15 min, and nonspecific binding was blocked with a protein solution
(CSA system; DAKO, Copenhagen, Denmark) for 15 min. The SMAD4
primary antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA), which
have been validated previously in an antibody supershift electrophoretic mobility shift assay (28), were diluted in the antibody diluent [(DAKO); 1:600
H-552 rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc., catalogue
number sc-7154), 1:600 N-16 goat polyclonal antibody (Santa Cruz Biotechnology, Inc., catalogue number sc-1908) and 1:800 C-20 goat polyclonal
antibody (Santa Cruz Biotechnology, Inc., catalogue number sc-1909)] and
incubated for 2 h at room temperature. After washing, secondary antibodies
were applied according to the specificity of the primary antibody:
LSAB ⫹ prediluted secondary antibody (DAKO) for H-552 antibody and
1:800 rabbit antigoat immunoglobulins (DAKO) for N-16 and C-20 antibodies.
A catalyzed amplification of the signal (CSA system; DAKO) was performed
as recommended by the manufacturer for the rest of the procedure with the
following modification: 3-amino-9-ethylcarbazole (Biomeda, Foster City, CA)
that gives a red signal was used as peroxidase chromogen. Sections were
briefly counterstained with Harris hematoxylin and mounted in aqueous
mounting medium (Biomeda).
RESULTS
Presence of Abnormal cDNA in SMAD4/CTD Revealed by
RT-PCR-SSCP. Twenty seminoma testicular germ cell tumor
samples were assessed for mutations in TGF-␤ receptors and
SMAD (SMAD1–SMAD7) genes. Primers flanking the SMADs CTD
were used to generate PCR products of different sizes (Table 1). To
detect the presence of mutations, electrophoresis was performed
under optimal running conditions that yielded the most dramatic
mobility shift for mutants when compared to the wild-type cDNA
both in T␤R-I and -II and in SMAD genes. To compare the
mutational status between normal (nontumoral) and seminoma
samples, total RNA was isolated from both normal (nontumoral)
and tumor surgical tissues and then reverse-transcribed to generate
first-strand cDNAs. From each tumor sample, two overlapping
RT-PCR fragments covering all exons of T␤R-I and -II and the
Table 1 Oligonucleotide primers used to amplify SMAD gene segments analyzed by RT-PCR-SSCP and sequencing
Sequence
Oligonucleotide
namea
SMAD1
SMAD2
SMAD2
SMAD3
SMAD3
SMAD4
SMAD4
SMAD5
SMAD6
SMAD7
SMAD7
(A)
(B)
(A)
(B)
(A)
(B)
(A)
(B)
Sense
Antisensec
Product
size (bp)d
Annealing
temperature (°C)e
GAGGGGGCCGTGCAGATGTAT
CGTCTGCCTTCGGTATTCTG
ATAGGGGGACCACAACACCAATG
GGGGAGGGTGCCGGTGGTGTAATA
CTCCCTCCCTCCCCATCCCAAGTC
GAGCTATTCCACCTACTGAT
TAAGGGCCCCAACGGTAAA
TAGGCAGGAGGAGGCGTATCAGC
GTCCGTGGGGGCTGTGTCTCTGG
GTCGAAAGCCTTGATGGAGAAACC
GGCTACCGGCTGTTGAA
353
269
235
283
286
264
274
395
297
294
283
53
53
53
59
50
53
53
50
55
55
55
b
GGCGGCATATTGGAAAAGGAGTT
TAGGTGGGGAAGTTTTTGCTGATG
GTGAAAGGGTGGGGAGCAGAATAC
GGAGGGCAGGCTTGGGGAAAATG
TAAGTGAGCAGAACAGGTAGTATT
AAGGTGAAGGTGATGTTTG
TGGCCCAGGATCAGTAGGTG
TGGCCGGATTTGCAGAGTCAT
CCCCCGGCTACTCCATCAAGGTGT
GTGGGGAGGCTCTACTGTGTC
ACCGCAGCAGTTACCCCATCTT
a
Name of primer sequences for amplification of each SMAD. SMAD2, SMAD3, SMAD4, and SMAD7 were split into two fragments (A and B) for amplification.
Sense primer sequence (5⬘–3⬘).
Antisense primer sequence (5⬘–3⬘).
d
Size of PCR product obtained.
e
Annealing temperature optimized for each SMAD sequence.
b
c
923
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
DISCUSSION
Fig. 1. SSCP analysis of the SMAD4 gene segment. SSCP analysis was performed on
reverse-transcribed RNAs from seminoma testicular germ cell tumors using primers
flanking the COOH-terminal SMAD4 gene (primer sense position, nt 1303–1321; primer
antisense position, nt 1547–1566). Altered mobility in PCR-amplified single-stranded
DNAs corresponding to nt insertion (nt 1521 Ins T) is indicated by arrows. Lanes 4 and
5 correspond to the normal (nontumoral) testis tissue, and Lanes 6 –9 correspond to
seminoma testicular germ cell tumors.
CTD region of each SMAD were analyzed, and SSCP analysis was
performed. A typical analysis is shown in Fig. 1. The characteristic
double-band representing the two complementary cDNA strands of
SMAD4 was observed in each of the tumors examined with the
exception of that from patient 7, where there was a marked mobility shift of the PCR products. It is worth noting that the PCR
signal of the remaining wild-type allele in patient 7 was detectable,
suggesting the presence of the normal allele; consequently, this
patient is heterozygous for SMAD4 mutation.
Under comparable experimental conditions, we detected no mutation for the other SMADs and T␤R-I and -II genes in the 20 seminomas studied.
Sequencing Analysis and Identification of the Insertional Mutation at SMAD4/CTD. To investigate the genetic alteration responsible for the allelic shift in the SMAD4/CTD gene, a PCR-amplified
fragment encompassing this region was examined for all tumor samples including that from patient 7 (positive case for SSCP analysis)
and subjected to sequence analysis. Of the 20 cDNAs examined, two
displayed the same disparity from the wild-type nt sequence: cDNA
from patients 6 and 7 was positive for the insertional mutation. As
shown in Fig. 2, the modification in SMAD4/CTD sequence involves
the insertion of 1 bp between nt 1521 and 1522, resulting in the
modification of the protein reading frame from codon 465 and the
truncation of the protein at codon 492, which causes the loss of the
L3-loop region (Fig. 3).
The sequence analysis of T␤R-I, T␤R-II, and SMADs (SMAD1,
SMAD2, SMAD3, SMAD5, SMAD6, and SMAD7) detected no mutations in any of the sequences studied.
Expression of SMAD4 Protein by Immunohistochemistry. The
SMAD4 gene product was examined immunohistochemically in
seminoma testicular germ cell tumors that appeared to be negative
or positive for the insertional mutation. Nonmutated testicular
tissues showed strong positive staining for the whole molecule
(H-552) as well as for the NH2- and COOH-terminal regions of
SMAD4 protein (positive controls). They were strongly stained by
either the antibody directed against the NH2 terminus (N-16) or the
antibody directed against the whole molecule (H-552) or by the
antibody directed against the COOH terminus (examples are shown
in Fig. 4, A–C).
The N-16 antibody directed against the NH2 terminus of SMAD4
protein as well as the H-552 directed against the whole molecule also
strongly stained tumor cells with mutated SMAD4, whereas tumor
cells with mutated SMAD4 (patients 6 and 7), were mostly negative
with the antibody directed against COOH-terminus of SMAD4 protein. Only very rare cells were positive with the C-20 antibody (Fig.
4, D–F).
Several members of TGF-␤ family are involved in gonadal development: (a) TGF-␤s; (b) inhibins; (c) activins; (d) AMH; and (e)
BMP-8b. These proteins play either a stimulatory role or an inhibitory
role in the division, differentiation, and apoptosis of gonadal cells. In
addition, work with transgenic mice has demonstrated that two TGF-␤
family members, inhibin and AMH, act as gonadal tumor suppressors
(1, 2, 29).
TGF-␤ is well known for its antiproliferative activity in the majority of mammalian cells, and loss of TGF-␤ responsiveness has been
documented to be associated with aggressive neoplasms (30). It has
therefore been suggested that loss of the activity of a TGF-␤ signaling
pathway component, such as SMAD4, would be selected for the
clonal evolution of neoplasms. Furthermore, a recent report (31) has
linked SMAD4 to other pathways including the stress-activated protein kinase/c-Jun NH2-terminal kinase cascade, implicating SMAD4
in both the control of cell cycle arrest and apoptosis. This suggests that
a SMAD4-dependent malignancy may also arise after disruption of
these key regulatory mechanisms.
The screening of SMAD genes in seminoma testicular germ cell
tumors by RT-PCR-SSCP analysis revealed a SMAD4 insertional
mutation in one patient. We performed direct sequencing of SMAD4
in the remaining 19 samples from patients with normal SSCP band
patterns. All normal (nontumoral) and seminoma patient samples were
sequenced for SMAD4 mutations to test the reliability of the SSCP
analysis. The data obtained showed the presence, in another sample,
of a mutation similar to that detected by the SSCP approach. Both of
these cases were found to carry an insertional mutation (T insertion
between nt 1521 and 1522) in a highly conserved residue at codon 465
within the MH2 region of the SMAD4 protein. This insertion causes
a frameshift that creates a new stop codon, producing a truncated
protein at codon 492 (nt 1785–1787 of the wild-type sequence), with
loss of critical regions for normal function, such as the L3-loop
region. All of the other tumors analyzed showed the sequence of
wild-type CTD-SMAD4 gene. In support of the functional significance
of the loop/helix region, mutations in Drosophila and Caenorhabditis
elegans in this region produce null or severe developmental phenotypes (32). These mutations map to Gly508 (Drosophila Mad, C.
elegans sma-2), Gly510 (sma-3), and Glu520 (Mad) of the L3-loop in
the loop/helix region. Thus, the location of conserved, solventexposed residues and the location of mutations derived from tumors or
from Drosophila and C. elegans genetic screens together indicate that
the loop/helix region and the three-helix bundle are critical for mediating SMAD activity. All four of the tumorigenic mutations that are
important at the trimer interface (Asp351, Arg361, Val370, and Asp537)
disrupt homo-oligomerization of the SMAD4/CTD and the full-length
SMAD4 (33). G508S had no effect on homo-oligomerization. This
Fig. 2. Characterization of the mutant CTD/SMAD4 gene. nt sequence analysis flanking codon 465 showing wild-type and mutant SMAD4 (Cases 6 and 7) sequences. The
insertion of 1 bp at codon 465 in the mutant strand of SMAD4 is indicated by arrows.
924
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
Fig. 3. Segment of the human wild-type and mutated forms of the
COOH-terminal SMAD4 gene structure. A, schematic representation
of a segment of wild-type COOH-terminal SMAD4; the L3-loop
sequence is underlined. B, schematic representation of a segment of
the COOH-terminal SMAD4 sequence after insertional mutation.
The nt inserted is indicated by the arrow at codon 465.
mutation maps to the L3-loop, which is the only portion of the
loop/helix region that is not involved in the trimer interface. Both the
tumor-derived trimer interface and the L3-loop mutants abolished
hetero-oligomerization between the CTDs of SMAD4 and SMAD2.
Because the L3-loop developmental mutation, which does not
significantly affect homo-oligomerization, disrupts hetero-oligomer
formation, the L3-loop may participate in hetero-oligomerization. In
addition, mutations preventing homo-oligomerization also disrupt
hetero-oligomerization, indicating that the former is a prerequisite for
the latter. Although several models of hetero-oligomerization could
explain our results, the one that appears to be most relevant from a
structural perspective is the formation of a heterohexamer between
SMAD4 and SMAD2 trimers. The trimer structure resembles a disc,
with the L3-loops forming undulations on the face of the disc. Two
discs could fit together face to face through their L3 loops, which
could explain why L3-loop mutations disrupt hetero-oligomerization.
Heterohexamer formation would depend on homotrimer formation
and would thus explain how tumorigenic mutations that disrupt homooligomerization can prevent the formation of a functional heterooligomeric complex and interfere with signal transduction.
SSCP analysis has been used successfully to detect single-base
changes in diverse previous studies (34, 35), and we readily detected
the same single-base insertion in one patient in the present study.
Accordingly, the efficiency of the SSCP approach in detecting the
SMAD4 gene mutation was limited to only one of the two patients
with the mutation. However, it remains possible that RT-PCR-SSCP
analysis using RNAs from microdissected tumor specimen rather than
from the macroscopic specimen used in our study might yield higher
mutation frequencies of SMAD genes. It may also be worth examining
noncodon regions of SMAD4 and the methylation status of this gene.
With regard to our present finding, to our knowledge, this is the first
report that associates the SMAD4 gene mutation with the seminoma
testicular germ cell tumor. Considering the mutation rates of other
tumor suppressor genes, this result suggests that the SMAD4 gene
plays an important role in the development of testicular tumors. Such
a mutation of SMAD4 may affect not only the activity of TGF-␤ but
also that of the other members of the peptide family, including activin
and BMP. Indeed, the signaling pathway analysis of activin, BMP,
and TGF-␤ signaling in different systems (Xenopus embryos and
mammalian cells) in diverse studies showed that all of the responses
tested depend on interactions between SMAD4 and one of the other
SMADs.
The TGF-␤ signaling network is disrupted in other tumors by
mutations in SMAD4 and also in SMAD2. SMAD4 was originally
identified as a candidate tumor suppressor gene in chromosome 18q21
that was somatically deleted or mutated in half of all human pancre-
925
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
Fig. 4. Immunohistochemistry of SMAD4 protein in samples 6 and 7 (mutated SMAD4) and in two nonmutated samples (positive controls). As observed in all tested seminoma,
nonmutated tumor cells were strongly stained with C-20 antibody, but the surrounding inflammatory cells were not (A). On the contrary, tumors sharing insertional mutation of SMAD4
were almost negative for staining with the C-20 antibody (D). Higher magnifications show that only rare, isolated cells were stained by the C-20 antibody (E and F) in tumors sharing
insertional mutation, whereas nonmutated tumor cells were strongly positive for C-20 staining (B and C). A and D, ⫻130; B, C, E, and F, ⫻530).
atic carcinomas examined (21). Biallelic SMAD4 inactivation also
occurs in a significant proportion of colorectal tumors (36). SMAD4 is
rarely mutated in breast (37), ovarian (37), head and neck (38),
prostatic (36), esophageal and gastric cancers (39). In the mouse,
SMAD4 inactivation causes intestinal tumors in accordance with inactivation of another tumor suppressor gene, adenomatosis polyposis
coli (40). The loss of TGF-␤ responsiveness in colon cancer may
therefore be due to mutations in T␤R-II, SMAD2, or SMAD4. Interestingly, the predominance of SMAD4 mutations in pancreatic cancer,
together with the low frequency of mutations in T␤R-II in these
tumors (41), raises the possibility that loss of SMAD4 function might
be selected during tumorigenesis for resistance to an endogenous
926
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
factor other than TGF-␤ itself. It is therefore significant that a number
of mutations have been identified within the SMAD4 gene itself,
strongly supporting a causal link between loss of function and the
occurrence of malignancy. These findings raise the possibility that
SMAD4 acts as a global tumor suppressor gene. However, SMAD4
loss has been found to be relatively rare in a range of other tumor
types.
SMAD2 is also located at 18q21 and is also the target for inactivating mutations in colon cancer (42). The prevalence of SMAD2
mutations in other neoplasms is not well characterized to date, although there is evidence to suggest that SMAD2 may be mutated in a
subset of leukemias and lymphomas (43) and also in lung carcinomas
(approximately 4%; Ref. 34). Disruption of the SMAD2 gene during
development results in a complete loss of embryonic germ layer
tissues (44), confirming that SMAD2, like SMAD4, plays an essential
role in development. However, based on our data, SMAD2 alterations
do not appear to be associated with seminomas. Interestingly, there
are at least two reports indicating an alteration in chromosome 18: (a)
by using comparative genomic hybridization, losses within the entire
genome represented 43% of the total number of alterations often
affecting chromosomes and chromosome arm 4, 5, 11, 13q, and
particularly 18q (where the SMAD4 gene is located; Ref. 45); and (b)
by using cytogenetic analysis in a series of four testicular tumors, it
has been shown that chromosome 18 was underrepresented in all these
tumors (46).
In summary, a technical approach comprising RT-PCR-SSCP, sequencing, and immunohistochemistry was used to perform mutational
analysis of the TGF-␤ signaling components TGF␤-RI, TGF␤-RII,
and SMAD1–SMAD7. The only component of the TGF-␤ signaling
system that was found to be affected in seminomas is SMAD4. Indeed,
a novel mutation (insertional mutation) in the SMAD4 gene was
detected in 10% of the 20 seminomas examined. No mutation was
found in the other SMADs or in the T␤R-I and -II genes. The size of
the subject cohort used in this study was too small to permit any
meaningful analysis of the relationship between the SMAD4 gene
mutation, protein expression, patient survival, and clinical characteristics.
ACKNOWLEDGMENTS
We thank Dr. J. L. Requin (Ligue Contre le Cancer, Comité Départemental
de l’Ain, France) for constant support during the course of this study. We thank
Drs. G. Quach (INSERM U329, Lyon, France) and S. Krantic (INSERM
U407, Lyon, France) for critical reading of the manuscript.
REFERENCES
1. Massagué, J. TGF-␤ signal transduction. Annu. Rev. Biochem., 67: 753–791, 1998.
2. Derynck, R., and Feng, X-H. TGF-␤ receptor signaling. Biochim. Biophys. Acta,
1333: F105–F150, 1997.
3. Wrana, J-L., Attisano, L., Wieser, R., Ventura, F., and Massagué, J. Mechanism of
activation of the TGF-␤ receptor. Nature (Lond.), 370: 341–347, 1994.
4. Souchelnytskyi, S., Tamaki, K., Engstrom, U., Wernstedt, C., ten Dijke, P., and
Heldin, C. H. Phosphorylation of Ser465 and Ser467 in the C-terminus of SMAD2
mediates interaction with SMAD4 and is required for transforming growth factor-␤
signaling. J. Biol. Chem., 272: 28107–28115, 1997.
5. Abdollah, S., Macias-Silva, M., Tsukazaki T, Hayashi, H., Attisano, L., and Wrana
J. L. T␤RI phosphorylation of SMAD2 on Ser465 and Ser467 is required for SMAD2SMAD4 complex formation and signaling. J. Biol. Chem., 272: 27678 –27685, 1997.
6. Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O’Connor, M. B., Attisano,
L., and Wrana, J. L. MADR1, a MAD-related protein that functions in BMP2
signaling pathways. Cell, 85: 489 –500, 1996.
7. Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and Massagué,
J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature
(Lond.), 381: 620 – 623, 1996.
8. Zhou, S., Zawel, L., Lengauer, C., Kinzler, K. W., and Vogelstein, B. Characterization of human FAST-1, a TGF-␤ and activin signal transducer. Mol. Cell, 2: 121–127,
1998.
9. Labbe, E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L. SMAD2 and
SMAD3 positively and negatively regulate TGF␤-dependent transcription through the
forkhead DNA-binding protein FAST-2. Mol. Cell, 2: 109 –120, 1998.
10. Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., and
Kern, S. E. Human SMAD3 and SMAD4 are sequence specific transcription activators.
Mol. Cell, 1: 611– 617, 1998.
11 Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. M. Direct
binding of SMAD3 and SMAD4 to critical TGF␤-inducible elements in the promoter
of human plasminogen activator inhibitor-type1 gene. EMBO J., 17: 3091–3100,
1998.
12. Jonk, L. J. C., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. Identification and
functional characterization of a SMAD binding element (SBE) in the Jun B promoter
that acts as a transforming growth factor-␤, activin, and bone morphogenetic proteininducible enhancer. J. Biol. Chem., 273: 21145–21152, 1998.
13. Meersseman, G., Verschueren, K., Nelles, L., Blumenstock, C., Kraft, H., Wuytens,
G., Remacle, J., Kozak, C. A., Tylzanowski, P., Niehrs, C., and Huylebroeck, D. The
C-terminal domain of Mad-like signal transducers is sufficient for biological activity
in the Xenopus embryo and transcriptional activation. Mech. Dev., 61: 127–140,
1997.
14. Lo, R. S., Chen, Y-G., Shi, Y., Pavletich, N. P., and Massagué, J. The L3 loop: a
structural motif determining specific interactions between SMAD proteins and TGF␤
receptors. EMBO J., 17: 996 –1005, 1998.
15. Wu, R-Y., Zhang, Y., Feng, X-H., and Derynck, R. Heteromeric and homomeric
interactions correlate with signaling activity and functional cooperativity of SMAD3
and SMAD4/DPC4. Mol. Cell. Biol., 17: 2521–2528, 1997.
16. Zhang, Y., Musci, T., and Derynck, R. The tumor suppressor SMAD4/DPC4 as a
central mediator of SMAD function. Curr. Biol., 7: 270 –276, 1997.
17. Liu, F., Pouponnot, C., and Massagué, J. Dual role of the SMAD4/DPC4 tumor
suppressor in TGF␤-inducible transcriptional complexes. Genes Dev., 11: 3157–
3167, 1997.
18. Topper, J. N., Dichiara, M. R., Brown, J. D., Williams, A. J., Falb, D., Collins, T., and
Gimbrone, M. A., Jr. CREB binding protein is a required coactivator for SMADdependent, transforming growth factor ␤ transcriptional responses in epithelial cells.
Proc. Natl. Acad. Sci. USA, 95: 9506 –9511, 1998.
19. Nishihara, A., Hanai, J., Okamoto, N., Yanagisawa, J., Kato, S., Miyazono, K., and
Kawabata, M. Role of p300, a transcriptional coactivator, in signalling of TGF␤.
Genes Cells, 3: 613– 623, 1998.
20. Kretzschmar, M., and Massagué, J. SMADs: mediators and regulators of TGF-␤
signaling. Curr. Opin. Genet. Dev., 8: 103–111, 1998.
21. Song, C-Z., Siok, T. E., and Gelehrter, T. D. SMAD4/DPC4 and SMAD3 mediate
transforming growth factor-␤ (TGF-␤) signaling through direct binding to a novel
TGF-␤-responsive element in the human plasminogen activator inhibitor-1 promoter.
J. Biol. Chem., 273: 29287–29290, 1998.
22. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T.,
Rozemblum, E., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern,
S. E. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1.
Science (Washington DC), 271: 350 –353, 1996.
23. Thiagalingam, S., Lengauer, C., Leach, F. S., Schutte, M., Hahn, S. A., Overhauser,
J., Wilson, J. K. V., Markowitz, S., Hamilton, S. R., Kern, S. E., Kinzler, K. W., and
Vogelstein, B. Evaluation of candidate tumor suppressor genes on chromosome 18 in
colorectal cancers. Nat. Genet., 13: 343–346, 1996.
24. Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart W. M.
Genetic characterization and cloning of mothers against dpp, a gene required for
decapentaplegic function in Drosophila melanogaster. Genetics, 139: 1347–1358,
1995.
25. Fynan, T. M., and Reiss, M. Resistance to inhibition of cell growth by transforming
growth factor ␤ and its role in oncogenesis. Crit. Rev. Oncog., 4: 493–540, 1993.
26. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by guanidinium
thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156 –159, 1987.
27. Chen, T., Carter, D., Garringue-Antar, L., and Reiss, M. Transforming growth factor
␤ type I receptor kinase mutant associated with metastatic breast cancer. Cancer Res.,
58: 4805– 4810, 1998.
28. Takenoshita, S., Tani, M., Nagashima, M., Hagiwara, K., Bennett, P. W., Yokota, J.,
and Harris, C. C. Mutation analysis of coding sequences of the entire transforming
growth factor ␤ type II receptor gene in sporadic human colon cancer using genomic
DNA and intron primers. Oncogene, 14: 1255–1258, 1997.
29. Josso, N., and di Clemente, N. TGF-␤ family members and gonadal development.
Trends Endocrinol. Metab., 10: 216 –222, 1999.
30. Polyak, K. Negative regulation of cell growth by TGF␤. Biochim. Biophys. Acta,
1242: 185–199, 1996.
31. Atfi, A., Buisine, M., Mazars, A., and Gespach, C. Induction of apoptosis by SMAD4,
a transcriptional factor regulated by transforming growth factor-␤ through stressactivated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling pathway.
J. Biol. Chem., 272: 24731–24734, 1997.
32. Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C-Y., Baird, S. E., and
Padgett, R. W. Caenorhabditis elegans genes Sma-2, Sma-3, and Sma-4 define a
conserved family of transforming growth factor ␤ pathway components. Proc. Natl.
Acad. Sci. USA, 93: 790 –794, 1996.
33. Shi, Y., Hata, A., Lo, R. S., Massagué, J., and Pavletich, N. P. A structural basis for
mutational inactivation of the tumor suppressor SMAD4. Nature (Lond.), 388: 87–93,
1997.
34. Uchida, K., Nagatake, M., Osada, H., Yatabe, Y., Kondo, M., Mitsudomi, T., Masuda,
A., Takahashi, T., and Takahashi, T. Somatic in vivo alterations of the JV18-1 gene
at 18q21 in human lung cancers. Cancer Res., 56: 5583–5585, 1996.
35. Satoshi, T., Aikou, O., Misato, S., Takaomi, Y., Hideo, S., Seiji, I., Tomoaki, Y.,
Yasuyuki, O., Kazunori, O., and Tadao, T. Allelic imbalance in chromosome band
927
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
SMAD4 GENE MUTATION IN SEMINOMA
36.
37.
38.
39.
40.
18q21 and SMAD4 mutations in ovarian cancers. Genes Chromosomes Cancer, 24:
264 –271, 1999.
MacGrogan, D., Pegram, M., Slamon, D., and Bookstein, R. Comparative mutational
analysis of DPC4 (SMAD4) in prostatic and colorectal carcinoma. Oncogene, 15:
1111–1114, 1997.
Schutte, M., Hruban, R. H., Hedrick, L., Cho, K. R., Nadasdy, G. M., Weinstein,
C. L., Bosa, G. S., Isaacs, W. B., Cairns, P., Nawroz, H., Sidransky, D., Casero, R. A.,
Jr., Meltzer, P. S., Hahn, S. A., and Kern, S. E. DPC4 gene in various tumor types.
Cancer Res., 56: 2527–2530, 1996.
Kim, S. K., Fan, Y., Papadimitrakopoulo, V., Clayman, G., Hittelman, W. N., Hong,
W. K., Lotan, R., and Mao, L. DPC4, a candidate tumor suppressor gene is altered
infrequently in head and neck squamous cell carcinoma. Cancer Res., 56: 2519 –2521,
1996.
Lei, J. Y., Zou, T. T., Shi, Y. Q., Zhou, X. L., Smolinski, K. N., Yin, J., Souza, R.,
Appel, R., Wang, S., Cynes, K., Chan, O., Abraham, J. M., and Meltzer S. J.
Infrequent DPC4 gene mutation in esophageal cancer, gastric cancer, and ulcerative
colitis-associated neoplasms. Oncogene, 13: 2459 –2462, 1996.
Takaku, K., Oshima, M., Miyoshi, H., Matsui, M., Seldin, M. F., and Taketo, M. M.
Intestinal tumorigenesis in compound mutant mice of both DPC4 (SMAD4) and Apc
genes. Cell, 92: 645– 656, 1998.
41. Vincent, F., Hagiwara, K., Ke, Y., Stoner, G. D., Demetrick, D. J., and Benett, W. P.
Mutation analyses of the transforming growth factor-␤ type II receptor in sporadic
human cancers of the pancreas, liver, and breast. Biochem. Biophys. Res. Commun.,
223: 561–564, 1996.
42. Riggins, G. J., Thiagalingam, S., Rozenblum, E., Weinstein, C. L., Kern, S. E.,
Hamilton, S. R., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B.
Mad related genes in the human. Nat. Genet., 13: 347–349, 1996.
43. Ikezoe, T., Takeuchi, S., Kamioka, M., Daibata, M., Kubonishi, I., Taguchi, H., and
Miyoshi, I. Analysis of the SMAD2 gene in haematological malignancies. Leukemia,
12: 94 –95, 1998.
44. Waldrip, W. R., Bikoff, E. K., Hoodless, P. A., Wrana, J. L., and Robertson, R. J.
SMAD2 signaling in extraembryonic tissues determines anterior-posterior polarity of
the early mouse embryo. Cell, 92: 797– 808, 1998.
45. Parrington, J. M., West, L. F., and Heyderman, E. Chromosome analysis of parallel
short-term cultures from four testicular germ-cell tumors. Cancer Genet. Cytogenet.,
75: 90 –102, 1994.
46. Ottesen, A. M., Kirchhoff, M., De-Meyts, E. R., Maahr, J., Gerdes, T., Rose, H.,
Lundsteen, C., Petersen, P. M., Philip, J., and Skakkebaek, N. E. Detection of
chromosomal aberrations in seminomatous germ cell tumors using comparative
genomic hybridization. Genes Chromosomes Cancer, 20: 412– 418, 1997.
928
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.
A Novel SMAD4 Gene Mutation in Seminoma Germ Cell
Tumors
Mourad Bouras, Eric Tabone, Jacques Bertholon, et al.
Cancer Res 2000;60:922-928.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/60/4/922
This article cites 46 articles, 17 of which you can access for free at:
http://cancerres.aacrjournals.org/content/60/4/922.full.html#ref-list-1
This article has been cited by 7 HighWire-hosted articles. Access the articles at:
/content/60/4/922.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 14, 2017. © 2000 American Association for Cancer
Research.