Download The Thr to Met substitution of amino acid 118 in hepatitis B virus

Journal of General Virology (2016), 97, 1210–1217
DOI 10.1099/jgv.0.000427
The Thr to Met substitution of amino acid 118 in
hepatitis B virus surface antigen escapes from
immune-assay-based screening of blood donors
Yonglin Yang,1 Yuchen Nan,2 Jie Cai,1 Jiling Xu,1 Zuhu Huang3
and Xubing Cai1
Correspondence
Yonglin Yang
[email protected]
Received 30 July 2015
Accepted 11 February 2016
1
Nanjing Red Cross Blood Center, Nanjing 210003, PR China
2
College of Veterinary Medicine, Northwest A&F University, Yangling 712100, PR China
3
Department of Infectious Disease, the First Affiliated Hospital of Nanjing medical University,
Nanjing 210009, PR China
Hepatitis B surface antigen (HBsAg) is the main diagnosis marker for hepatitis B virus (HBV)
infection. In this study, a novel HBV mutant from an HBV-positive blood donor with falsenegative results during HBsAg screening was identified. DNA sequencing discovered two
mutations at nt 353 (A to T) and nt 349 (T to A), leading to Thr to Met and Ser to Thr
substitutions at aa 118 and 117 of HBsAg, respectively. Further analysis showed that eight of
ten HBsAg ELISA kits failed to detect this HBsAg mutant. A mutagenesis assay indicated that
the Thr to Met substitution at aa 118 was the determinant for escape from HBsAg ELISA
detection. A small-scale screening of blood donors identified two individuals infected by this
unique HBV mutant, suggesting a certain level of prevalence among the general population.
In conclusion, our study identified the aa 118 mutation in HBV surface antigen and provided
information for improvement of HBV diagnosis products.
INTRODUCTION
The hepatitis B virus (HBV) is a worldwide public health
concern, which is responsible for at least one million
deaths annually due to HBV-related cirrhosis, liver failure
and hepatocellular carcinoma (Dienstag, 2008; WHO,
2015). A seroprevalence study indicated that China is a
highly endemic area of HBV across the world (Ott et al.,
2012). It has been reported that the prevalence of HBV
infection is up to 7 % in the adult population (age 19–49)
in China (Ott et al., 2012). Moreover, HBV is also a
threat for blood products due to blood-transfusionmediated transmissions, especially when blood collection
has been conducted during the undetectable window
period of HBV infected donors (Candotti & Allain,
2009). HBV surface antigens are the main clinical markers
indicating acute or chronic infection, as well as occult HBV
infection if no HBV DNA screening is done (Shepard et al.,
2006). Currently, ELISA-based hepatitis B surface antigen
testing is the primary way to identify persons with chronic
HBV infection (Shepard et al., 2006).
The HBV surface antigens are able to induce protection
against HBV and therefore can be used as a vaccine (Szmuness et al., 1981). There are three surface antigens, large,
The GenBank/EMBL/DDBJ accession number for the HBsAg
sequence of HBV is FJ905226.
1210
middle and small, which share 226 common C-terminal
residues (Tian et al., 2007). The small hepatitis B virus
(HBV) surface antigen (HBsAg), which is 226 aa in
length, is considered to be the major part of the viral envelope (Tian et al., 2007). The major hydrophilic region
(MHR) between aa 99 and 169 in HBsAg harbours conformational epitopes and is the major target of neutralizing
antibodies (Seddigh-Tonekaboni et al., 2000; Tian et al.,
2007). Within this region, the area around aa 124 and
149, containing five cysteine residues, is essential to the
immunogenicity of HBsAg (Mangold & Streeck, 1993).
In many cases, amino acid variations were found in this
region of HBsAg and they were associated with immune
escape or diagnostic failure, due to the impaired ability
to bind anti-HBV antibodies (Carman, 1997; Carman
et al., 1990; Tian et al., 2007).
In this study, we identified a new mutation site of nt 353
(A to T), which led to a Thr to Met substitution in aa
118, of HBsAg in an HBV-positive blood donor (GenBank
accession number FJ905226). Analysis of this variation
indicated that the Thr to Met substitution changes the antigenicity of HBsAg and evades detection by most of the
commercial ELISA kits used for HBV diagnosis in China.
In a screen of a total of 39 blood samples from HBV-positive blood donors, two individuals infected by this novel
HBV mutant were identified, indicating that this HBV
Downloaded from www.microbiologyresearch.org by
000427 G 2016 The Authors
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
Printed in Great Britain
Thr to Met mutation escapes from HBV screening
mutant had some level of prevalence and more attention
should be paid for this novel mutant. In summary, our
study provided useful information for the future development of HBV diagnosis products and vaccine development.
RESULTS
blood donor was a 28-year-old male. He was a first time
blood donor and blood screening indicated he was negative
for anti-human immunodeficiency virus, anti-hepatitis
C virus and anti-treponema pallidum antibodies
(a) 70
Identification of a novel HBsAg mutant and
expression of this mutated HBsAg in HEK293T cells
S/N
50
40
30
20
*
*
*
10
0
2
1
3
4
5
6
Kit number
7
8
9
10
(b) 70
60
Kit no. 6
Kit no. 10
50
S/N
During our routine HBV screening of samples from blood
donors, two ELISA kits from different companies were
used for HBsAg screening for every sample. When inconsistent results were shown, more tests were conducted to
further confirm the inconsistent ELISA results. During
our screening, ELISA results for one donor’s serum
demonstrated inconsistent results in two ELISA kits targeting HBsAg. For safety concerns relating to blood transfusion and for determining the true HBV status of this
donor, we conducted ELISA tests for other HBV antigens
and antibodies, as well as PCR detection and DNA sequencing for HBV DNA. Eventually, this donor was confirmed
to be HBV-positive but some HBsAg-based ELISA kits
demonstrated a false-negative result for this donor’s
sample. A follow-up visit to this donor indicated this
*
HBsAg-M+serum
HBsAg QC
rHBsAg-M
NC
60
40
30
20
(a)
nt 353
A to T
10
nt 366
nt 340
0
1
10
100
1000
10 000
Dilution folds
(c) 20
18
Kit no. 6
Kit no. 10
16
14
S/N
12
(b)
10
pIRES-Neo3-HBsAg-M
–
+
+
8
pIRES-Neo3 EV
+
–
–
6
4
Anti-tubulin
2
0
Anti-HBsAg
1
10
100
1000
10 000
Dilution folds
27 kDa
24 kDa
Fig. 1. Detection of HBsAg mutation that is able to escape from
HBsAg ELISA tests and expression of the mutated HBsAg in
HEK293T cells. (a) DNA sequencing of HBV HBsAg mutant.
Arrows in the chromatogram indicate T to A and A to T mutations
at nt 349 and 353, respectively. (b) Expression of HBsAg-M in
HEK293T cells. HEK293T cells were transfected with pIRESNeo3 vector or pIRES-Neo3 HBsAg-M for 48 h, and harvested
for SDS-PAGE and Western blotting with anti-HBsAg antibody.
http://jgv.microbiologyresearch.org
Fig. 2. Test results from different HBsAg ELISA kits for the HBV
mutant. (a) Ten commercial ELISA kits (assigned as nos 1 to 10) for
HBsAg were used to test HBsAg-M and serum samples from the
blood donor. The 0.5 ng ml21 Quality Control (QC) sample and a
negative control (NC) from each ELISA kit were included as positive
and negative controls, respectively. (b) Gradient dilution assay for
the HBsAg-M serum sample. (c) Gradient dilution assay for the
recombinant HBsAg-M (rHBsAg-M) expressed from HEK293T
cells. The error bars represent the SD for each group. Significant
differences between groups are shown by an asterisk, which
indicates P,0.05.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
1211
Y. Yang and others
(data not shown). According to his personal statement, he
had no history of hepatitis or HBV-related symptoms.
No HBV-infected individual was identified in his family
who had close contact with him. He also denied being a
drug user, having history of high-risk sex or receiving a
blood transfusion in the past. Screening for other HBV
antigens and antibodies demonstrated he was positive for
anti-HBcAg antibody and HBeAg, but negative for antiHBeAg. Moreover, the transaminase ALT level of this
(a)
blood donor was normal (data not shown). Sequencing
of HBV DNA from this donor indicated this HBV
mutation belonged to HBV subgenotype C.
By analysis of the DNA sequence for the HBsAg region of
this HBV mutant (GenBank accession number FJ905226),
two novel mutation sites, nt 349 and 353, were identified
(Fig. 1a). These two mutations led to Ser to Thr and Thr
to Met substitutions in aa 117 and 118 of HBsAg, respectively. Notably, as Ser and Thr are hydrophilic amino acids
70
60
Serum sample
Serum neutralized
QC sample
QC neutralized
50
S/N
40
30
20
10
*
0
*
*
Kit no. 6
Kit no. 10
Kit no. 6
Kit no. 10
*
(b)
105
100
Serum
QC
Neutralization rate (%)
95
90
85
80
75
70
65
60
Fig. 3. HBsAg neutralization assay ELISA kits for the HBV mutant. (a) ELISAs for HBsAg-M serum sample, with or without
adding the anti-HBV Ig. A Quality Control (QC) sample was included as a positive control. Only ELISA kits no. 6 and 10,
which were able to detect HBsAg-M from serum, were used for ELISA. Asterisks (*) indicate an S/N value below the cut off
ratio. (b) Calculation of the relative neutralization rate for ELISA kits no. 6 and 10. The error bars represent the SD for each
group. Significant differences between groups are shown by an asterisk, which indicates P,0.05.
1212
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
Journal of General Virology 97
Thr to Met mutation escapes from HBV screening
but Met is a hydrophobic amino acid, the substitution of
Thr to Met in aa 118 could significantly affect the protein
structure and antigenicity of HBsAg, which may contribute
the false-negative results during routine HBV screening.
Therefore, to test this speculation, we expressed the
HBsAg from a plasmid in HEK293T cells, introducing
mutations to both aa 117 and 118. The HBsAg sequence containing both aa 117 and 118 mutations (hereafter referred to
as HBsAg-M) was cloned into the pIRES-Neo3 vector for
transient expression in HEK293T cells and successful
expression of the recombinant protein was confirmed by
immunoblotting using anti-HBsAg antibody (Fig. 1b).
HBsAg ELISA kits collected from different manufacturers
were used. Among all 10 ELISA kits, only kits no. 6 and
10 were able to detect HBsAg-M in the serum sample or
recombinant HBsAg-M (rHBsAg-M) from the supernatant
of HEK293T cells transfected with pIRES-Neo3-HBsAg-M
(Fig. 2). For kits no. 6 and 10, although the S/N ratios
for the donor’s serum were higher than for rHBsAg-M,
these two kits did demonstrate a positive result for
rHBsAg-M. However, all the other kits failed to detect
HBsAg-M, although these kits maintained reactivity to
the quantity control (QC) sample obtained from the Centers for Disease Control and Prevention (CDC) of China
(Fig. 2a). To further confirm our results, gradient dilution
assays using both ELISA kits no. 6 and 10 were conducted
for HBsAg-M from serum and HEK293T-expressed
rHBsAg-M. As demonstrated in Fig. 2(b, c), as the dilution
fold increased, the S/N ratio decreased, which suggested a
dose-dependent effect on the detectability by both kits
Mutated HBsAg from blood sample and HBsAg-M
expressed from HEK293T cells could evade
detection by many ELISA kits
To test if HBsAg-M expressed in HEK293T cells could
mimic the HBsAg from the blood donor, 10 commercial
(a)
pIRES-Neo3-HBsAg117S118M
+
–
–
pIRES-Neo3-HBsAg117T118T
–
+
–
pIRES-Neo3-HBsAg117S118T
–
–
+
Anti-tubulin
27 kD
Anti-HBsAg
24 kD
(b) 45
HBsAg117S118M
40
HBsAg117T118T
HBsAg117S118T
35
NC
S/N
30
HBVsAg QC
25
20
*
15
10
*
5
0
1
2
3
4
5
6
7
8
9
10
Kit number
Fig. 4. Thr to Met mutation (A to T in nt 353) in aa 118 of HBsAg caused false-negative screening results of HBsAg ELISA
kits. (a) Expression of three HBsAg constructs (117S118M, 117T118T and 117S118T) in HEK293T cells tested by Western
blot analysis. (b) ELISA screening for recombinant HBsAgs. The three HBsAg mutants were tested by 10 ELISA kits along
with proper controls. The error bars represent the SD for each group. Significant differences between groups are shown by
an asterisk, which indicates P,0.05.
http://jgv.microbiologyresearch.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
1213
Y. Yang and others
for this mutated HBsAg. Moreover, neutralization assays
were conducted using kits no. 6 and 10 as well.
By incubating the serum sample along with anti-HBV Ig,
the S/N ratio of the ELISA tests fell below the positive
cut off value (2.1) for both kits (Fig. 3a), which suggested
that this mutated HBsAg could be neutralized by anti-HBV
Ig to evade ELISA detection. However, no significant
difference in the neutralization ratio was observed between
the serum sample and QC sample for both kits (Fig. 3b).
Taken together, these results suggested that HBsAg bearing
aa 117 Thr and 118 Met mutations could escape detection
by most of the available HBsAg ELISA kits. Moreover, it
also suggested that recombinant HBsAg-M expressed
from HEK293T cells maintained similar antigen reactivity
to the donor’s serum.
The 118 Thr to Met substitution is responsible for
changing the reactivity of HBsAg in ELISA tests
As this unique HBsAg contained two mutation sites, determination of the exact mutation site causing the falsenegative result was necessary. Therefore, we generated
different HBsAg-M constructs by introducing point
mutations at nt 349 and 353. In addition to the HBsAg-M
Fig. 5. Identification of HBV mutants with 118 Met in HBsAg from samples of blood donors. Serum samples (134) from
HBV-positive blood donors were subjected to DNA extraction and sequencing. Sequencing data of 39 samples (donors
no. 1 to 39) were compared. Donor no. 5 demonstrated 118 Met in HBsAg.
1214
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
Journal of General Virology 97
Thr to Met mutation escapes from HBV screening
described above, two more constructs were generated:
HBsAg117S118T (the same amino acid residues as the
reference sequence) and HBsAg117T118T (the same
amino acid as the reference sequence at residue 118).
Expression of these two constructs in HEK293T cells was
also confirmed by Western blotting (Fig. 4a).
After generation of these constructs, we examined the reactivity of these recombinant HBsAgs with same ELISA
kits used above. As shown in Fig. 4(b), the HBsAg117S118T
(the same amino acid residues as the reference in both aa
117 and 118) demonstrated similar results to the QC control
and could be detected by all ELISA kits. A mutation at residue 117 from Ser to Thr in HBsAg117T118T did not change
the test results, as it could also be detected by all ELISA kits.
The results indicated that the 118 Met mutation was responsible for the false-negative results observed with all the
ELISA kits except kits no. 6 and 10 (Fig. 4b). Moreover,
all ELISA kits showed the same positive results for both
HBsAg117T118T and HBsAg117S118T as the QC sample,
which suggested that mutation of 117 Thr did not affect
the antigenicity of HBsAg. Taken together, these data indicated the 118 Thr to Met mutation significantly changed the
antigenicity of HBsAg and was responsible for the evasion of
detection by most of the ELISA kits used in this study.
Detection of 118 Met HBV mutant from blood
donors
Since the false-negative result observed during the routine
HBV screening of blood donors could be a significant
safety concern, it was important to determine the prevalence
of the HBV mutant bearing 118 Met (HBV118M) in the
normal population. A total of 134 HBsAg positive serum
samples from our routine blood screening for blood
donors were collected. ELISA screening was conducted
using ELISA kits no. 6 and 10 to avoid false-negative results.
DNA extraction and sequencing were also conducted for all
the positive samples to examine the DNA sequence of
HBsAg. As the serum HBV DNA level was variable among
infected individuals, DNA sequencing data were only readable for 39 samples, including the one we used in this study.
By analysis of all the HBsAg sequences we collected in this
study, we observed a sample from donor no. 5 bearing a
single 118 Met mutation, while its residue 117 was still
Ser (Fig. 5). Moreover, a single 117 Thr mutation was
also detected in donors no. 4 and 10 (Fig. 5). Therefore,
the HBV118M mutation has a certain prevalence among
HBV-positive individuals.
DISCUSSION
Although HBV is a DNA virus, it needs reverse transcriptase to replicate. HBV polymerases are composed of four
domains, including a reverse transcriptase (RT) domain,
which shows significant homology to retroviral RTs
(Bartholomeusz et al., 2004; Radziwill et al., 1990). As a
http://jgv.microbiologyresearch.org
result, there is a high mutation rate of HBV reverse transcriptase due to the lacking of proofreading activity,
which is the main cause of HBV mutation (Deng &
Tang, 2011). HBV is a very compact virus with highly efficient usage of its genome. The small S gene of HBV is fully
embedded in the polymerase gene. HBV mutations that
occur in the S gene not only result in false-negative results
for some diagnostic kits due to the mutations of HBsAg but
also probably link with drug resistance (Deng & Tang,
2011; Mizuochi et al., 2006). Antivirus therapy was extensively accepted in clinics in the past two decades, and more
and more mutants with drug resistance have been reported.
On the other hand, large-scale vaccination and application
of hyper-immune antibodies to HBV have also led to HBV
escape mutants (Zuckerman, 2000).
In this study, we identified a novel Thr to Met mutation in
aa 118 of the HBsAg, which has never to our knowledge been
reported before. It is still unclear what caused this mutation,
because the donor denied an HBV vaccination history or any
contact with other HBV carriers. At the same time, we
noticed the aa 117 Thr mutation as well. However, restoration of aa 117 to Ser did not improve the diagnosis result
for all the kits used in this study (data not shown). However,
reconstitution of Thr at aa 118 caused a significant improvement in all the diagnosis results. These data suggest that the
Thr to Met mutation at aa 118 is the contributing factor for
the false-negative results during diagnosis.
The major neutralizing targets in HBsAg are conformational
epitopes locating two MHRs between aa 99 and 169
(Seddigh-Tonekaboni et al., 2000; Tian et al., 2007). The
reconstitution of amino acid sequence will affect the threedimensional conformation or the hydrophilicity of this
region, which changes the antigenicity of HBsAg. Although
the majority of the ELISA kits used in this study failed to
detect the HBsAg118M mutant, two kits were still capable of
recognizing it. This may be due to the different antibodies
used to coat the ELISA plates. However, even those two kits
demonstrated reduced sensitivity for the 118M mutant.
After reconstitution of aa 118 from Met to Thr, the S/C
value demonstrated a significant improvement, indicating
these two kits only partially recognized the 118M mutant.
During our small-scale screening for normal blood donors with
an HBsAg positive result, only 39 serum samples were DNA
positive, which was consistent with our previous experience
that less than 30 % of the HBsAg positive samples were HBV
DNA positive and could be sequenced (unpublished data).
An earlier report demonstrated that there was a lack of correlation between HBsAg and HBV DNA levels in blood donors
who tested positive for HBsAg and anti-HBcAg, and HBV
DNA levels in HBsAg-positive, anti-HBc-reactive blood
donations can be extremely low (Kuhns et al., 2004). In our
centre, the PCR-detection-based nucleic acid amplification
testing (NAT) could detect 100 copies of viral genome, which
was confirmed by using an HBV standard sample (unpublished
data). One possible explanation is that HBV-positive blood
donors generally come from a clinically healthy population
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
1215
Y. Yang and others
without HBV-related symptoms, which may bear lower HBV
DNA levels than individuals with demonstrated HBV-related
symptoms.
It is undeniable that the 118M mutation has a significant
impact on the sensitivity of these commercial HBsAg ELISA
kits. However, since the HBsAg gene overlaps with HBV Pol
gene, the mutation of aa 118 in HBsAg also led to a Gln to
His mutation in aa 471 of Pol. It is still unclear if this mutation
in HBV Pol could affect the replication of HBV. However, analysis of a blood sample from this donor indicated the viral DNA
copies were 2.16|106 copies ml21 (data not shown), and a 1year follow-up for this donor showed that the HBV load in the
blood did not change much, which implied this mutant could
replicate effectively and maintain a sustained infection status.
It is still unclear what led to this unique mutation. In China,
many HBV mutation studies have been conducted by the
CDC or hospitals, and their subjects are limited to HBV
patients demonstrating clinical symptoms. Little attention is
paid to HBV-positive blood donors that are clinically healthy.
Whether this mutation was caused by immunization or administration of anti-HBV immunoglobulin still needs further
investigation.
The false-negative results of HBV-infected blood donors due to
mutation had been documented (Echevarria & Avellón, 2008;
Weber, 2006). In accordance, manufacturers of HBV diagnosis
products have made efforts to improve their ELISA kits to avoid
false-negative results. However, as the virus is capable of mutating frequently due to the unique replication process, HBV
always generates new mutations to evade the host immune
system, as well as current surveillance methods. On the other
hand, the large-scale immunization with HBV vaccine or
administration of anti-HBV sera has caused pressure for
HBV to mutate. China has been considered a highly endemic
area for HBV. Although epidemiology investigation suggests
that 7 % of the total population have been chronically infected
by HBV, our knowledge about the infection caused by HBV
mutants in the population is limited. Our research subjects
were blood donors from a clinically healthy population, and
were all interviewed for potential HBV infection history or
risk before blood collection. In this specific population, the
HBV infection ratio was much lower than the 7 % in normal
population; these 134 HBsAg positive samples were identified
from more than 20 000 blood donors (HBV-positive ratio
less than 1 %). Therefore, it is very hard for us to conduct
larger scale screening for this specific HBV mutant. Since
demand for blood transfusion during surgery is extremely
high due to the large population in China, the existence of
HBV mutants evading current detection methods will be a
high risk for blood transfusion recipients. A brief screening of
the samples available in our centre demonstrated this new
HBsAg 118M has limited prevalence. To assess the exact prevalence rate of HBV118M, large-scale screening will be needed.
Although the prevalence of this mutant in large populations
is unclear, improvement of current detection methods is
needed.
METHODS
General information and ethics statement. All participating
subjects were formally informed for the purpose of this study and a
letter of consent was signed by every subject involved. To minimize
the effect of the general information on the final result, a systematic
analysis was conducted of the gender and age of those HBV-positive
patients. However, no significant difference was observed.
Primers, serum DNA extraction, enzymes, plasmids, bacteria,
cells and chemicals. Primers were designed according the HBV
genotype B and C for cloning of HBsAg, introducing mutations to nt
349 and nt 353 and sequencing of MHR. All primers were synthesized
by Invitrogen. The sequence of primers used in this study are listed in
Table 1.
Blood donors’ serum samples were used for HBV DNA extraction.
The DNA extraction was conducted using QIAamp DNA Mini kit
(Qiagen) following the manufacturer’s instruction.
Table 1. Primers used in this study
Primer
Sequence (59 to 39)
Target genes
TTAGCTAGCGCCGCCACCATGGAGAACCCATCAGG Cloning of HBsAg isolated
from mutated HBV
isolated from blood donor
Clone_R
CTCGGATCCTTA AATGTATACCCAAAGAC
HBV isolated from blood
donor
117(Ser)_F
ACATCAACTACCTCCATGGGACCATGCAAG
Introducing A to T
mutation in nt 349
(Thr to Ser for aa 117)
117(Ser)_R
CTTGCATGGTCCCATGGAGGTAGTTGATGT
118(Thr)_F
ACATCAACTACCACCACGGGACCATGCAAG
Introducing T to A
mutation in nt 353
(Met to Thr in aa 118)
118(Thr)_R
CTTGCATGGTCCCGTGGTGGTAGTTGATGT
117–118(Ser-Thr)_F ACAATCAACTACCTCCACGGGACCATGCAAG
Introducing the mutation
of nt 349 and nt 353
117–118(Ser-Thr)_R CTTGCATGGTCCCGTGGAGGTAGTTGATGT
Plasmid construct
Clone_F
1216
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
pIRES-Neo3-HBsAg-M
pIRES-Neo3-HBsAg117S118M
pIRES-Neo3-HBsAg117T118T
pIRES-Neo3-HBsAg117S118T
Journal of General Virology 97
Thr to Met mutation escapes from HBV screening
Cloning of target DNA fragments was conducted using Phusion high
fidelity DNA polymerase (New England Biolabs). PCR products were
purified using Gel purification kit (Takara) and digested with Bam HI
(Takara), HindIII (Takara) and Nhe I (Takara), before being ligated
into pIRES-Neo3 vector (Takara). The insertions were confirmed by
DNA sequencing.
Candotti, D. & Allain, J. P. (2009). Transfusion-transmitted hepatitis B
HEK293T cells were maintained in Dulbecco’s minimal essential
medium supplemented with 10 % FBS (Life Technology). The transfection reagent polyfection (Qiagen) was used for plasmid transfection
according the manufacturer’s instructions. At 48 h after the transfection, the cell culture supernatant containing recombinant protein
expressed from the plasmids was collected and used for ELISAs.
escape mutant of hepatitis B virus. Lancet 336, 325–329.
HBsAg diagnosis ELISA kits and standard samples (quality
control). A total of 10 commercial ELISA kits from different companies
were used in this study for HBsAg diagnosis. The full names of these
companies are not listed here due to conflict of interest between these
manufacturers. The HBsAg standard samples (quality control) were
purchased from the Clinical Testing Center, China Ministry of Health.
ELISA tests were conducted according to the manufacturers’ instructions
for individual kits. All tests were repeated at least four times.
HBsAg neutralization assay. For the HBsAg neutralization assay,
5 ml anti-HBV immune globulin (SichuanYuanda Shuyang Pharmaceutical) was added to 50 ml serum sample and incubated at 37 uC for
1 h. The mixture was then examined by the indicated ELISA kits
according to manufacturers’ instructions. Serum samples with PBS
added were used as blank controls. The neutralization ratio was
defined as the S/N value difference between the immune globulin
group and blank control divided by the S/N value of blank control.
Western blot analysis. HEK293T cells transfected with different
plasmids were lysed using the Laemmli sample buffer, as previously
described (Nan et al., 2012; Patel et al., 2010). SDS-PAGE and
Western blots were conducted for these cell lysate as previously
described (Nan et al., 2012). Briefly, proteins were separated by SDSPAGE, transferred onto PVDF membrane and probed with mouse
mAbs against HBsAg (Jingtiancheng Biotech) and tubulin (Sigma).
Specific reactions were detected using goat anti-mouse IgG conjugated to HRP (Sigma) and revealed by a chemiluminescence substrate. The chemiluminescence signal was digitally recorded using the
ChemiDoc XRS imaging system (Bio-Rad).
DNA sequencing of MHR from HBV-positive blood donors.
A total of 134 blood samples from HBV-positive donors collected from
2008 to 2009 were used for DNA extraction. The MHR region from all
samples was cloned by PCR and subjected to DNA sequencing.
Statistical analysis. Difference in indicators between samples was
assessed by Student’s t-test. A two-tailed P value of less than 0.05 was
considered significant.
virus infection. J Hepatol 51, 798–809.
Carman, W. F. (1997). The clinical significance of surface antigen
variants of hepatitis B virus. J Viral Hepat 4 (Suppl. 1), 11–20.
Carman, W. F., Karayiannis, P., Waters, J., Thomas, H. C., Zanetti,
A. R., Manzillo, E. & Zuckerman, A. J. (1990). Vaccine-induced
Deng, L. & Tang, H. (2011). Hepatitis B virus drug resistance to
current nucleos(t)ide analogs: mechanisms and mutation sites.
Hepatol Res 41, 1017–1024.
Dienstag, J. L. (2008). Hepatitis B virus infection. N Engl J Med 359,
1486–1500.
Echevarrı́a, J. M. & Avellón, A. (2008). Improved detection of natural
hepatitis B virus surface antigen (HBsAg) mutants by a new version of
the VITROS HBsAg assay. J Med Virol 80, 598–602.
Kuhns, M. C., Kleinman, S. H., McNamara, A. L., Rawal, B., Glynn, S.,
Busch, M. P. & REDS Study Group (2004). Lack of correlation
between HBsAg and HBV DNA levels in blood donors who test
positive for HBsAg and anti-HBc: implications for future HBV
screening policy. Transfusion 44, 1332–1339.
Mangold, C. M. & Streeck, R. E. (1993). Mutational analysis of the
cysteine residues in the hepatitis B virus small envelope protein.
J Virol 67, 4588–4597.
Mizuochi, T., Okada, Y., Umemori, K., Mizusawa, S. & Yamaguchi, K.
(2006). Evaluation of 10 commercial diagnostic kits for in vitro
expressed hepatitis B virus (HBV) surface antigens encoded by
HBV of genotypes A to H. J Virol Methods 136, 254–256.
Nan, Y., Wang, R., Shen, M., Faaberg, K. S., Samal, S. K. & Zhang, Y. J.
(2012). Induction of type I interferons by a novel porcine reproductive
and respiratory syndrome virus isolate. Virology 432, 261–270.
Ott, J. J., Stevens, G. A., Groeger, J. & Wiersma, S. T. (2012).
Global epidemiology of hepatitis B virus infection: new estimates
of age-specific HBsAg seroprevalence and endemicity. Vaccine 30,
2212–2219.
Patel, D., Nan, Y., Shen, M., Ritthipichai, K., Zhu, X. & Zhang, Y. J.
(2010). Porcine reproductive and respiratory syndrome virus
inhibits type I interferon signaling by blocking STAT1/STAT2
nuclear translocation. J Virol 84, 11045–11055.
Radziwill, G., Tucker, W. & Schaller, H. (1990). Mutational analysis of
the hepatitis B virus P gene product: domain structure and RNase H
activity. J Virol 64, 613–620.
Seddigh-Tonekaboni, S., Waters, J. A., Jeffers, S., Gehrke, R.,
Ofenloch, B., Horsch, A., Hess, G., Thomas, H. C. & Karayiannis, P.
(2000). Effect of variation in the common a determinant
on the antigenicity of hepatitis B surface antigen. J Med Virol 60,
113–121.
Shepard, C. W., Simard, E. P., Finelli, L., Fiore, A. E. & Bell, B. P.
(2006). Hepatitis B virus infection: epidemiology and vaccination.
Epidemiol Rev 28, 112–125.
Szmuness, W., Stevens, C. E., Zang, E. A., Harley, E. J. & Kellner, A.
(1981). A controlled clinical trial of the efficacy of the hepatitis B
ACKNOWLEDGEMENTS
This study was sponsored by a grant from Young Physicians Overseas
Training Project from Nanjing Medical Science and Technique
Development Foundation of Jiangsu Province (grant no. QRX11240),
which was awarded to Y. Y. The authors declare no conflict of interest.
vaccine (Heptavax B): a final report. Hepatology 1, 377–385.
Tian, Y., Xu, Y., Zhang, Z., Meng, Z., Qin, L., Lu, M. & Yang, D. (2007).
The amino acid residues at positions 120 to 123 are crucial for
the antigenicity of hepatitis B surface antigen. J Clin Microbiol 45,
2971–2978.
Weber, B. (2006). Diagnostic impact of the genetic variability of the
REFERENCES
hepatitis B virus surface antigen gene. J Med Virol 78 (Suppl. 1), S59–S65.
Bartholomeusz, A., Tehan, B. G. & Chalmers, D. K. (2004).
WHO (2015). Hepatitis B; fact sheet no. 204. Geneva: WHO.
Comparisons of the HBV and HIV polymerase, and antiviral
resistance mutations. Antivir Ther 9, 149–160.
Zuckerman, A. J. (2000). Effect of hepatitis B virus mutants on
http://jgv.microbiologyresearch.org
efficacy of vaccination. Lancet 355, 1382–1384.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 04:07:21
1217