Download Clinical Microbiology Reviews

July 2007, Volume 20, Issue 3 ,pp. 391-532
Reviews:
John Turnidge and David L. Paterson
Setting and Revising Antibacterial Susceptibility Breakpoints
Clin. Microbiol. Rev. 2007 20: 391-408.
Elizabeth Foglia, Mary Dawn Meier, and Alexis Elward
Ventilator-Associated Pneumonia in Neonatal and Pediatric Intensive Care
Unit Patients
Clin. Microbiol. Rev. 2007 20: 409-425.
Alexandra Valsamakis
Molecular Testing in the Diagnosis and Management of Chronic Hepatitis B
Clin. Microbiol. Rev. 2007 20: 426-439.
Anne Marie Queenan and Karen Bush
Carbapenemases: the Versatile ß-Lactamases
Clin. Microbiol. Rev. 2007 20: 440-458.
Dale W. Griffin
Atmospheric Movement of Microorganisms in Clouds of Desert Dust and
Implications for Human Health
Clin. Microbiol. Rev. 2007 20: 459-477.
Susan Hariri and Matthew T. McKenna
Epidemiology of Human Immunodeficiency Virus in the United States
Clin. Microbiol. Rev. 2007 20: 478-488.
Els N. T. Meeusen, John Walker, Andrew Peters, Paul-Pierre Pastoret, and Gregers
Jungersen
Current Status of Veterinary Vaccines
Clin. Microbiol. Rev. 2007 20: 489-510.
R. Fotedar, D. Stark, N. Beebe, D. Marriott, J. Ellis, and J. Harkness
Laboratory Diagnostic Techniques for Entamoeba Species
Clin. Microbiol. Rev. 2007 20: 511-532.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 391–408
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00047-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Setting and Revising Antibacterial Susceptibility Breakpoints
John Turnidge1* and David L. Paterson2,3,4
Division of Laboratory Medicine, Women’s and Children’s Hospital, North Adelaide, Australia1; Division of Infectious Diseases,
University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania2; University of Queensland, Brisbane, Australia3;
and Queensland Health Pathology Services, Royal Brisbane and Women’s Hospital, Brisbane, Australia4
INTRODUCTION .......................................................................................................................................................391
DEFINITIONS OF SUSCEPTIBILITY CATEGORIES ........................................................................................392
ORGANIZATIONS THAT SET BREAKPOINTS ..................................................................................................392
THE NATURE OF MICs...........................................................................................................................................392
DATA NEEDS FOR SETTING BREAKPOINTS...................................................................................................394
MIC Distributions and Wild-Type Cutoff Values...............................................................................................395
Phenotypic and Genotypic Resistance Markers .................................................................................................395
PK/PD Considerations ...........................................................................................................................................396
In vitro studies ....................................................................................................................................................396
Animal model studies .........................................................................................................................................397
Clinical studies of PD ........................................................................................................................................398
Estimation of target attainment .......................................................................................................................398
Outcome Data from Clinical Studies...................................................................................................................400
COMBINING CUTOFFS TO SET BREAKPOINTS.............................................................................................400
General Principles ..................................................................................................................................................400
Breakpoints by Infection Site................................................................................................................................401
Urinary tract........................................................................................................................................................401
Cerebrospinal fluid .............................................................................................................................................402
Breakpoint Setting before Resistance Has Emerged .........................................................................................402
Reevaluation of Breakpoints Years after the Commercial Release of an Antibacterial Agent....................402
SETTING ZONE DIAMETER BREAKPOINTS FOR DISK DIFFUSION TESTING.....................................403
UNANSWERED QUESTIONS AND FUTURE NEEDS .......................................................................................404
CONCLUSIONS .........................................................................................................................................................404
REFERENCES ............................................................................................................................................................405
the MIC for any given antibacterial that distinguishes wild-type
populations of bacteria from those with acquired or selected
resistance mechanisms (“wild-type breakpoints;” sometimes
called microbiological breakpoints). Data for deriving this type
of breakpoint are generated from moderate to large numbers
of in vitro MIC tests, sufficient to describe the wild-type population. In this context, the wild-type strain is defined as a
strain of a bacterium which does not harbor any acquired or
selected resistance to the particular antibacterial being examined or to antibacterials with the same mechanism/site of action. The second are so-called clinical breakpoints, which refer
to those concentrations (MICs) that separate strains where
there is a high likelihood of treatment success from those
bacteria where treatment is more likely to fail. In their simplest
form, these breakpoints are derived from prospective human
clinical studies comparing outcomes with the MICs of the
infecting pathogen. The third use of the term “breakpoint”
refers to antibacterial concentrations calculated from knowledge of a PD parameter and the dimension of that parameter
that predicts efficacy in vivo. These are the pharmacokinetic/PD (PK/PD) breakpoints, where data that have been
generated in an animal model are extrapolated to humans by
using mathematical or statistical techniques. Recently, in an
attempt to reduce confusion about the meaning of the term
“breakpoint,” the European Committee on Antimicrobial Susceptibility Testing proposed the use of the term “epidemiolog-
INTRODUCTION
Breakpoints are an integral part of modern microbiology
laboratory practice and are used to define susceptibility and
resistance to antibacterials. Depending on the testing method,
they are expressed as either a concentration (in mg/liter or
␮g/ml) or a zone diameter (in mm). In general, all susceptibility testing methods require breakpoints, also known as interpretive criteria, so that the results of the tests can be interpreted as susceptible, intermediate, or resistant and reported
as such to a broad range of clinicians. It is acknowledged that
sophisticated prescribers may not require (or desire) breakpoints but rather utilize the MIC and knowledge of the pharmacodynamics (PD) of the antibacterial in question to optimize antibacterial selection and dosing. However, given the
volume of specimens that a typical clinical microbiology laboratory receives and the diversity of clinicians that a laboratory
serves, categorical interpretation of antibacterial susceptibility
testing results is a practical necessity and is preferred by most
clinicians.
The term “breakpoint” has been used in a variety of ways
in the literature (141). The first and most obvious one refers to
* Corresponding author. Mailing address: Division of Laboratory
Medicine, Women’s and Children’s Hospital, 72 King William Rd.,
North Adelaide, South Australia, Australia. Phone: 1 8 81616873. Fax:
61 8 81616189. E-mail: [email protected].
391
392
TURNIDGE AND PATERSON
ical (or wild-type) cutoff value” to replace the term “microbiological breakpoint” (82). We propose that the term “cutoff”
be used more widely to describe the three types of “breakpoints” and that the term “breakpoint” be reserved for the
final selected value to be applied in the clinical laboratory.
Hence, we prefer the terms wild-type cutoff, PK/PD cutoff, and
clinical cutoff to describe these entities.
DEFINITIONS OF SUSCEPTIBILITY CATEGORIES
Breakpoints are used to define susceptibility and resistance.
(In this review, the term “susceptibility” is preferred over “sensitivity”). While these terms should be universally understood,
they are frequently used ambiguously because they can refer to
the direct interaction between the antibacterial agent and the
organism or to the likelihood that the patient will respond to
treatment. The first can be measured simply in vitro, while the
second involves in vivo complexities such as the dose and
dosing schedule, the site of infection, PK of the antibacterial in
the individual, and a range of other factors, including the
adequacy of host defenses. In some methods, breakpoints are
set in such a manner as to create a third category, i.e., intermediate (susceptibility). This category has multiple purposes,
including (i) providing a “buffer” between the resistant and
susceptible categories to prevent serious interpretive errors
and (ii) implying that the organism is susceptible if the antibacterial is concentrated at the site of infection (e.g., in urine)
or suggesting that higher doses of antibacterial should be used
where it is safe to do so to achieve efficacy.
Two sets of category definitions are given below to accommodate the two types of meanings. In vitro definitions are as
follows: susceptible, growth of the bacterial strain is inhibited
by an antibacterial agent concentration in the range found for
wild-type strains; resistant, growth of the bacterial strain is
inhibited by an antibacterial agent concentration higher than
the range seen for wild-type strains; and wild type, strains that
harbor no acquired resistance mechanism to the antibacterial
under question, specifically no resistance attributable to (i)
mutation, (ii) acquisition of foreign DNA, (iii) up-regulation of
an efflux pump, (iv) up-regulation of target production, or (v)
any combination of these. PD and clinical definitions, currently
listed in the newly developed international reference method
ISO/DIS 20776-1 (78), are as follows: susceptible, the bacterial
strain is inhibited by a concentration of an antibacterial agent
that is associated with a high likelihood of therapeutic success;
intermediate, the bacterial strain is inhibited by a concentration of an antibacterial agent that is associated with an uncertain therapeutic effect; and resistant, the bacterial strain is
inhibited by a concentration of an antibacterial agent that is
associated with a high likelihood of therapeutic failure.
While intuitively appealing, these definitions do not capture all
of the concepts embedded in susceptibility categories. A more
encompassing set of definitions is provided by the Clinical and
Laboratory Standards Institute (CLSI) (28), as follows. The “susceptible” category implies that isolates are inhibited by the usually
achievable concentrations of antimicrobial agent when the recommended dosage (dosage regimen) is used for that site of infection. The “intermediate” category includes isolates with antimicrobial agent MICs that approach usually attainable blood and
tissue levels and for which response rates may be lower than those
CLIN. MICROBIOL. REV.
for susceptible isolates. The intermediate category implies clinical
efficacy in body sites where the drugs are physiologically concentrated (e.g., quinolones and ␤-lactams in urine) or when a higherthan-normal dosage of a drug can be used (e.g., ␤-lactams). The
category also includes a buffer zone which should prevent small,
uncontrolled technical factors from causing major discrepancies
in interpretations, especially for drugs with narrow pharmacotoxicity margins. The “resistant” category implies that isolates are not
inhibited by the usually achievable concentrations of the agent
with normal dosage schedules and/or demonstrate MICs/zone
diameters that fall in the range where specific microbial resistance
mechanisms (e.g., ␤-lactamases) are likely and that clinical efficacy against the isolate has not been shown reliably in treatment
studies.
ORGANIZATIONS THAT SET BREAKPOINTS
The processes by which breakpoints are determined can vary
widely between susceptibility testing methods. Frequently,
these processes are not made explicit in the documentation of
the method. For those methods that describe breakpoints without explanation of how the breakpoints are derived, it is assumed that the categories of susceptible, intermediate, and
resistant are set using the wild-type cutoff. Methods with recently published breakpoints are outlined in Table 1.
Only two international standard-setting groups, the Clinical
and Laboratory Standards Institute (CLSI; formerly known as
the NCCLS) and the European Union Committee on Antimicrobial Susceptibility Testing (EUCAST), have published
guidelines on which data are required for, and how these data
are applied to, breakpoint setting (24, 81). The U.S. Food and
Drug Administration also sets breakpoints for antibacterials at
the time of their approval for use. Unfortunately, breakpoints
developed by various organizations may differ, creating confusion for clinical microbiologists, antibacterial susceptibility
testing device manufacturers, and clinicians. Harmonization of
breakpoints among these organizations should clearly be the
aim, taking into account possible differences in doses and dosing schedules used in different parts of the world.
THE NATURE OF MICs
MICs, as currently measured, are presently the simplest estimates we have of the antibacterial effect in vitro. They are
only semiquantitative (see below), yet they have significant
utility. There is currently no better measure of antibacterial
effect.
All breakpoints are either MICs or zone diameter values
correlated with MICs. As a consequence, an understanding of
the nature of the MIC is fundamental to breakpoint setting.
The central concept of an MIC is that it is a measurement
of the activity of an antibacterial agent against an individual
strain of an organism. It has become the reference measuring
tool for susceptibility testing. The value of MIC measurement
is frequently criticized because of the “unnatural” conditions
under which it is performed, but that criticism misses the point.
It is unnecessary for it to reflect exactly the conditions at the
site of infection, and of course in most circumstances it cannot.
Hence, the common practice of comparing MICs with levels
measured in various body compartments is qualitative at best.
VOL. 20, 2007
TABLE 1. Susceptibility testing methods with recently published breakpoints
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
Organization or test [method reference(s)]
Arbeidsgruppen for antibiotikaspørsmål
(Norwegian Working Group on Antibiotics
[APA]) (18)
British Society for Antimicrobial Chemotherapy
(BSAC) (1, 11)
Calibrated dichotomous sensitivity test (CDS;
promulgated by a single laboratory in
Sydney, Australia) (16, 17)
Clinical and Laboratory Standards Institute
(CLSI) (25, 26, 27, 28) and the U.S. Food
and Drug Administration
Commissie Richtlijnen Gevoeligheidsbepalingen
(CRG) (30, 138, 139, 140)
Method(s)—principal mediaa
Disk diffusion—Mueller-Hinton or Iso-Sensitest
Agar dilution, broth dilution, broth microdilution, disk
diffusion—IsoSensitest agar and broth
Disk diffusion—Sensitest agar
For aerobic and facultative bacteria, broth dilution, broth
microdilution, disk diffusion—Mueller-Hinton agar and
broth; for anaerobic bacteria, agar dilution, broth
microdilution—supplemented Brucella agar and broth
Disk diffusion—Iso-Sensitest
Comité de l’Antibiogramme de la Société
Française de Microbiologie (CA-SFM) (29)
Deutches Institut für Normung (DIN) (44, 45,
46, 49, 50, 51, 52, 53)
Agar dilution, broth microdilution, disk diffusion—MuellerHinton
Agar dilution, broth microdilution, disk diffusion—MuellerHinton
EUCAST (65, 66, 67)
Agar dilution, broth dilution, broth microdilution—MuellerHinton
Japanese Society for Chemotherapy (JSC)
(79, 80)
Rosco Diagnostica (a commercial company
based in Denmark) (114)
Broth microdilution—Mueller-Hinton
Mesa Española de Normalización de la
Sensibilidad y Resistencia a los
Antimicrobianos (MENSURA [Spain]) (121)
Swedish Reference Group for Antibiotics
(SRGA) (123)
Disk diffusion, broth dilution, agar dilution—Mueller-Hinton
a
PDM, paper disk method.
Disk (pressed tablet) diffusion—Mueller-Hinton, Iso-Sensitest,
PDM, and Danish blood agar
Agar dilution, disk diffusion, gradient diffusion—Iso-Sensitest
The true value of an MIC is as a measuring tool that generates
values to which other parameters, such as PD end points and
clinical outcomes, can be reliably compared. This requires that
MICs have a reasonable level of reproducibility, a subject that
has not received a great deal of attention over the years. Indeed, it is frequently quoted that the “error” associated with
measuring an MIC is “plus or minus one twofold dilution.”
While this can work as a rule of thumb, results from so-called
“tier 2 studies” described by the CLSI (24) for establishing
quality control ranges show that precision of MIC measurements can be less than or greater than this, depending on the
organism-antibacterial combination (131).
The origins of the MIC can be traced back to the original
Fleming paper on penicillin (strictly, on cultures of a Penicillium strain) (70). Introduced in this paper were the ideas of (i)
serial twofold dilution of an antibacterial agent in broth to
measure its activity against different species and (ii) reading
the end point by “noting the opacity of the broth.” For decades, the conventional method of determining MICs was in
normal test tubes containing 1 to 2 ml of broth, the so-called
“macro method” (27). In the 1960s, the method was adapted to
microtiter trays (23), and this has become the preferred
method for performing MIC tests in broth. MICs can also be
determined by agar dilution, where the antibacterial is incorporated into agar, again in a twofold dilution series, and the
inoculum is spotted onto the agar surface prior to incubation
(10, 27).
The development and adoption of the serial twofold dilution
393
Breakpoint-setting parameters [reference(s)]
Resistance markers, MIC distributions, PK/
PD, clinical and bacteriological outcomes
(13, 14)
PK and protein binding (formula), MIC
distributions (95)
Principally zone diameter distributions (16)
MIC distributions, PK/PD,
clinical/bacteriological outcome
correlations (24)
MIC distributions, PK/PD, clinical and
bacteriological outcome correlates
(31, 104)
MIC distributions, PK, correlation with
clinical and bacteriological outcome (95)
MIC distributions, PK, correlation with
clinical and bacteriological outcome (47,
48, 54)
In vitro drug characteristics, MIC
distributions, PK/PD, clinical outcome
correlations (64)
MIC-clinical outcome correlations (12, 115,
116)
Zone diameters are calibrated against a
range of different national and
international MIC breakpoints as well as
unique breakpoints for tests performed
on Danish blood agar (114)
MIC distributions, PK/PD, clinical and
bacteriological outcomes (15, 98)
“Pharmacological breakpoints” with speciesrelated adjustments
series for MIC measurement, while originally done for convenience in the macro method, have serendipitously turned out
to be valuable from at least one point of view. When the MICs
of a particular antibacterial for a large number of strains of a
single species are plotted on a histogram, it appears that the
wild-type population follows a log-normal distribution (132)
(Fig. 1). This means that wild-type MICs appear to be normally
distributed on a logarithmic scale; the logarithm to base 2 is the
simplest of these scales. Furthermore, strains with the same
type of acquired resistance also have a log-normal distribution
of MICs. For species in which a single resistance mechanism to
an antibacterial predominates, it is therefore usual to see a
bimodal distribution.
Another important feature of the MIC as we currently measure it is that it actually represents a range of MICs. By way of
example, Fig. 1 shows that 51,082 of 71,360 strains of Staphylococcus aureus have a vancomycin MIC of 1 mg/liter. In reality, this represents the individual MICs for those strains, each
of which is ⬎0.5 mg/liter and ⱕ1 mg/liter. In other words, there
are 51,082 strains whose MICs lie in the range of ⬎0.5 to ⱕ1
mg/liter. Indeed, it is quite possible to determine MICs between the two conventional twofold dilution series values by
setting up such concentrations or by using gradient diffusion
products (e.g., Etest [AB Biodisk, Solna, Sweden]).
From the clinical and PD perspective, such a discriminatory
ability may be quite useful. Indeed, in some settings, it would
actually be preferable to have a more finely divided range of
MICs than conventional twofold dilutions. For example,
394
TURNIDGE AND PATERSON
CLIN. MICROBIOL. REV.
FIG. 1. MIC distributions for four organism-antimicrobial pairs. In each case, the wild type appears as the log-normally distributed population
at the lower MICs. COWT, calculated wild-type cutoff value. (Generated using data from http://217.70.33.99/Eucast2/ and reference 132.)
“actual” MICs for amikacin for a Pseudomonas aeruginosa
strain of ⬎4 to ⱕ8 ␮g/ml will be recorded, using serial twofold
dilution series, as 8 ␮g/ml. Yet if the PD parameter that best
predicts amikacin success for P. aeruginosa is a ratio of peak
concentration achieved to MIC (103), a measured amikacin
peak concentration of 40 ␮g/ml and a recorded MIC of 8 ␮g/ml
will result in a ratio of 5. However, the true ratio may actually
be closer to 10 if the “actual” MIC was just over 4 ␮g/ml. No
commercially available antibacterial susceptibility testing products give a more suitable finely divided range of MICs, and
space limitations preventing long ranges of dilutions are an
important reason for this. However, their development for
research purposes is hindered by a misunderstanding of the
precision of current MIC tests, often stated to be “plus or
minus one twofold dilution,” as discussed above.
The values generated by MIC tests will of necessity be influenced by the method employed (90). The results may differ
by choice of technique (broth macrodilution, broth microdilution, agar dilution, or gradient diffusion), medium (MuellerHinton, Iso-Sensitest, or Sensitest medium, lot-to-lot variation,
divalent cation concentrations, and the effects of additives,
such as blood), inoculum size and concentration, incubation
conditions (temperature and duration of incubation), and precision in the preparation of different concentrations of the
antibacterial being used. Thus, an MIC is only meaningful
when the methods and conditions of the test are known.
It is for these reasons that the development of an interna-
tional standard reference method for determining MICs was
recently proposed. The recognition of the effectiveness of international standardization in other areas of scientific measurement has stimulated the development of an International
Organization for Standards reference method for antibacterial
susceptibility testing using broth microdilution and cation-adjusted Mueller-Hinton medium (78). It was published as an
approved standard in late 2006. This is just the beginning, as
the reference method will not work for all bacteria for which
we might want to have MICs. Nevertheless, it is MICs generated
using this reference methodology and its future enhancements
that will become the standards for MICs in future.
DATA NEEDS FOR SETTING BREAKPOINTS
A range of data are used to assist breakpoint-setting organizations in selecting breakpoints, including in vitro microbiological data, animal and human PK/PD data, and clinical/bacteriological outcome data from prospective clinical studies. No
single set of data provides all the information necessary to
make decisions. As pointed out above, some methods concentrate mainly on in vitro data to establish breakpoints. Undoubtedly, human PK is factored into the decision, but how this
occurs is not made explicit. We believe that the following four
main types of data are necessary for the establishment of appropriate breakpoints: (i) MIC distributions and wild-type cutoffs; (ii) in vitro resistance markers, both phenotypic and ge-
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
notypic; (iii) PK/PD data from animal models and human
studies; and (iv) outcome data, both clinical and bacteriological, from appropriate clinical studies and the MICs of the
causative pathogens in those studies. For establishing zone
diameter breakpoints, additional data establishing the relationship between zone diameters and MICs are required.
The most important and difficult challenge in using these
data is ensuring that there is an appropriate balance between
the various forms of data, with consideration being given to the
different pathogens and the types and severity of the infections
associated with those pathogens. At present, there is no formula that can assist in deciding which data are more important
in a particular circumstance. Instead, the final choice of emphasis on the different types of data is made by consensus
among standard-setting committees and groups. Such an approach can be divisive, with individuals weighting different data
types differently according to their training and skill base. It is
essential that the membership of any breakpoint-setting committee include a mix of skills in all four main data areas.
Since infections occur in different body compartments, e.g.,
blood, soft tissues, subarachnoid space, bladder, bone, lungs,
or mucosal surfaces, breakpoints, at least in theory, should be
developed for each infection syndrome, e.g., bloodstream infection, cellulitis, meningitis, lower urinary tract infection, osteomyelitis, pneumonia, or pharyngitis. This would vastly increase the complexity of breakpoint setting, and therefore
almost all methods choose only one set of breakpoints or,
sometimes, other sets of breakpoints adjusted to the type of
infection in cases where drug concentrations are substantially
different, such as urinary tract infection or meningitis. In general, bloodstream infections are considered most generally representative of serious infections, and therefore the PK of the
drug in blood is used to set breakpoints.
MIC Distributions and Wild-Type Cutoff Values
Constructing MIC distributions for organism-antibacterial
combinations is the first step in the development of breakpoints for that antibacterial. Broth and/or agar dilution MICs
are determined for all organisms of interest, and histograms
such as those in Fig. 1 are constructed. Inspection of a histogram gives an immediate picture of whether only wild-type
strains are present or whether strains with abnormally elevated
MICs are also included. Ideally, these histograms should be
constructed on a species-by-species basis because it is unlikely
that even related species will have exactly the same modal MIC
or wild-type range of MICs (or same mean and standard deviation on the log-normal scale). Often, species are combined
for convenience, such as coagulase-negative staphylococci or
Enterobacter species, but in general it is better to avoid this
where possible.
It is also desirable that the full range of the wild-type MIC
distribution is included in the antibacterial dilution series and
that the MICs are not truncated at one or the other end of the
distribution. From the full range of the wild-type MIC distribution, simple inspection will often allow one to estimate
where the upper end of the wild-type distribution ends and
thus to define wild-type cutoff values, with the wild type being
defined as above. EUCAST has released tables and histograms
showing a range of wild-type MIC distributions for many or-
395
ganisms and antibacterials. They are freely available on the
Internet at www.eucast.org. The data are a collation of MICs
collected from a wide array of national and international studies using defined methods.
If the full span of wild-type MICs is available, it is also
amenable to statistical analysis. Using this type of data, statistical techniques that can reliably determine wild-type cutoff
values have recently been developed, thus eliminating the need
to estimate cutoff values by inspection (92, 132). This is particularly useful for distributions where there is apparent overlap between the wild-type distribution and the distribution of
abnormal strains, such as the example of Pseudomonas aeruginosa and gentamicin in Fig. 1. The first of these methods uses
an iterative process to find the optimum fit of the cumulative
distribution MICs and works readily on standard twofold
MICs. The second method uses a reflection of the lower half of
the wild-type distribution about the estimated mean and requires intermediate values between the standard twofold dilution series to be effective. It was adapted from an original
method used to determine zone diameter ranges and interpretive criteria of susceptible strains (92, 91).
In setting breakpoints, it is generally considered inappropriate to select values that fall inside the wild-type range. Placing
breakpoints above or below wild-type distributions creates no
problems with interpretation. However, when breakpoints fall
inside wild-type distributions, it creates the somewhat anomalous splitting of strains into “susceptible” and “resistant”
strains even though the latter do not have an acquired resistance mechanism. In some cases, such a split cannot be
avoided, because the desire is to have as few breakpoints as
possible for a given antibacterial agent and for some species
the wild-type MIC distribution is elevated compared to that for
most other “susceptible” species. A typical example of this type
of splitting is seen with Stenotrophomonas maltophilia and
ceftazidime, where the wild-type distribution ranges from values within reach of those achievable clinically to values well
above those that can be achieved with maximum doses.
Phenotypic and Genotypic Resistance Markers
It is frequently possible to identify the existence of a resistance mechanism in a bacterial isolate by methods other than
measuring the MIC (or zone diameter). These methods can be
phenotypic or genotypic.
Phenotypic methods include (i) direct detection of degrading enzymes (e.g., ␤-lactamase testing); (ii) screening plates by
using a concentration lower than the breakpoint (e.g., extended-spectrum ␤-lactamase screening); (iii) medium modification to enhance resistance expression (e.g., use of brain heart
infusion agar to detect vancomycin-resistant enterococci); (iv)
modification of incubation conditions to enhance resistance
expression (e.g., incubation at ⱕ30 to 35°C to detect methicillin resistance in staphylococci); (v) ␤-lactamase confirmation
by the use of specific inhibitors, such as clavulanate or EDTA;
(vi) induction tests (e.g., macrolide induction of clindamycin
resistance); (vii) direct detection of the protein conferring resistance (e.g., agglutination detection of penicillin-binding protein 2a in Staphylococcus aureus); and (vii) detection of resistance to high levels of an antibacterial (e.g., high-level
aminoglycoside resistance in enterococci) (124).
396
TURNIDGE AND PATERSON
Genotypic tests are usually reserved for confirmation of phenotypic resistance (112). The one common exception is the
detection of mecA in staphylococci by PCR methods. This gene
encodes the altered penicillin-binding protein 2a and is associated with methicillin “resistance.” This association holds
strongly for S. aureus, where the detection of mecA correlates
strongly with MICs that are greater than the wild-type cutoff
value (oxacillin MIC, 2 mg/liter [CLSI]). Problems with the
correlation in coagulase-negative staphylococci led to the significant lowering of the oxacillin breakpoint to 0.5 mg/liter by
the CLSI to achieve greater correlation with the presence of
mecA (28). This was precautionary, as there are no clinical data
available to confirm or refute whether strains of coagulasenegative staphylococci with a MIC of 1 or 2 mg/liter will respond to treatment.
If simple special phenotypic (i.e., other than the MIC itself)
or genotypic methods can be developed to detect acquired
resistance, then ideally these should be used to validate the
choice of wild-type cutoff values. Strains with MICs at and to
either side of the wild-type cutoff should be subjected to those
special phenotypic and/or genotypic tests to ensure correlation.
If necessary, the wild-type cutoff should be adjusted to that
defined by the presence of the resistance mechanism.
Most methods that recommend the use of special phenotypic and/or genotypic tests also recommend that the isolate be
reported as resistant regardless of the conventional MIC-based
susceptibility result. Put another way, the recommendation is
that the isolate should be interpreted as resistant, the usual
breakpoint does not apply, and the MIC result should be ignored. The validity of this approach has rarely been tested and
would be difficult to test except in animal models. Instead, the
conservative view is taken that in vitro detection of resistance
to an antibacterial by additional special phenotypic and/or
genotypic tests should preclude the use of that antibacterial
(see the example above with mecA and coagulase-negative
staphylococci). Fortunately, for many organism-antibacterial
combinations, the relationship between special phenotypic
and/or genotypic tests, elevated MICs, and poor treatment
outcomes appears convincing. There are some notable exceptions, such as Streptococcus pneumoniae and penicillin, where
the resistance phenotype and genotype, that is, the presence of
altered penicillin-binding proteins and/or the genes encoding
them, do not appear to correlate well with outcomes (68, 108,
142), except in cases of meningitis.
This situation provides a conundrum when breakpoints have
already been set for a particular organism-antibacterial combination. New resistance mechanisms are frequently detected
only after an antibacterial has been in clinical use for some
time. These may represent examples of “hidden resistance”
whereby resistance mechanisms are detected genotypically in
organisms that have MICs within the “susceptible” range. Examples of “hidden resistance” which have not been addressed
completely by organizations which set breakpoints include
quinolone target mutations in gram-negative bacilli (42) and
Streptococcus pneumoniae (43), extended-spectrum beta-lactamases in organisms that also constitutively produce AmpC
(125), and metallo-beta-lactamase production by gram-negative bacilli (73). At the local level, clinical laboratories may be
faced with a dilemma whereby resistance mechanisms are confirmed to be occurring by genotypic methods yet no review of
CLIN. MICROBIOL. REV.
breakpoints has been made by CLSI or EUCAST. In some
circumstances, phenotypic methods may have been described
to assist in detection of these resistance mechanisms. However,
we caution that such methods are often based on organisms
from a limited geographic area and may not be universally
applicable. Their greatest use may be for epidemiologic purposes rather than for communication to prescribers.
PK/PD Considerations
With the development of our understanding in the PD of
antibacterials, one of the major benefits has been its application to the setting of breakpoints (4, 60, 105). PD is the study
of drug effects over time and is therefore intimately linked with
the changes in drug concentrations over time, namely, PK. The
terms are usually linked to create the term PK/PD. For antibacterials, PK/PD is the study of the relationship between PK
variables and microbial inhibition or killing in vivo and, by
extension, clinical outcome (41, 58). Extensive studies in animal and in vitro PK models over the last 20 years have led to
a clear understanding of PK/PD relationships of many classes
of antibacterials, including the ␤-lactams, aminoglycosides,
quinolones, macrolides, lincosamides, tetracyclines, and glycopeptides. Clinical studies supporting the evidence generated in
animal models have been conducted for ␤-lactams, aminoglycosides, and fluoroquinolones (2).
In vitro studies. The PD properties of an antibacterial agent
are initially explored in vitro. Bacterial inhibition and killing
are initially examined by exposing species of interest to a range
of fixed drug concentrations, e.g., different multiples of the
MIC, and measuring viable counts over a number of hours
(33). The following two major patterns are found: concentration-dependent killing, where killing becomes more rapid and
profound with increasing drug concentrations; and concentration-independent or time-dependent killing, where no further
increase in the rate of killing is seen for concentrations much
above the MIC (33). The second in vitro phenomenon of
importance is the so-called postantibiotic effect (PAE). This is
a period of delayed regrowth, following drug removal, after
brief periods of exposure to an antibacterial in vitro. Again,
two major patterns emerge, as follows: a moderate to long
delay in regrowth (prolonged PAE) and immediate regrowth
or only a short delay (minimal PAE) (40). Other persistent
antibacterial effects have been described, such as postantibiotic
leukocyte enhancement (97) and postantibiotic sub-MIC effects (106). None of these other effects have added greatly to
our understanding of the action of antibacterials in vivo or
provided information that would be predictive of clinical efficacy. Demonstration of in vitro PAE requires validation in an
animal model, because the persistent effect observed in vitro
may occasionally be absent in vivo (1, 134). However, in most
circumstances, a combination of the bacterial killing and PAE
patterns is sufficient to describe in vitro PD properties and to
make predictions about in vivo PK/PD properties, as summarized in Table 2.
In vitro studies can be extended to sophisticated PD models,
where the PK of drugs in humans are simulated and the effects
on bacterial killing measured (96). Most studies using this
technique have focused on addressing specific questions rather
than defining the fundamental PD properties of drugs. In other
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
397
TABLE 2. PD properties of various antibacterial classes
Killing/inhibition pattern
Time dependent
Concentration dependent
a
PAE
In vivo PK/PD parameter predicting efficacy
Antibiotic class(es)a
Minimal
Minimal
Prolonged
Prolonged
Minimal
Prolonged
%T⬎MIC
AUC/MIC ratio
AUC/MIC ratio
Cmax/MIC ratio
AUC/MIC ratio
AUC/MIC ratio and/or Cmax/MIC ratio
␤-Lactams
Linezolid*
Macrolides, lincosamides, tetracyclines
Glycopeptides*
Polymyxins
Aminoglycosides, quinolones,
streptogramins, ketolides,
daptomycin
*, the PK/PD parameter predicting efficacy varies with the organism under study and the type of animal model (1, 88, 89).
cases, they have confirmed earlier findings from animal models. In vitro PD model studies have been helpful in one area,
namely, defining the importance of a regimen in preventing the
emergence of resistant subpopulations (19, 69). For a small
number of bacterium-drug interactions, selection of resistant
subpopulations present in the original bacterial population is a
problem. The most notable of these is aminoglycosides and
Pseudomonas aeruginosa (76).
Animal model studies. Studies with animal models have
been critical to our understanding of PK/PD relationships. The
earliest work, by Eagle and colleagues, showed the importance
of the dosing interval in determining the efficacy of penicillin
(61). It took another 35 years before progress was made in this
area, when the neutropenic mouse thigh and pneumonia models were employed for the first time to define possible PD
parameters predicting efficacy (94, 135). These studies were
the first to clearly define the relationship between PK parameters and bacterial killing in tissues by using PD principles.
They successfully showed that different classes of antibacterials
could have different predictors of efficacy. The principal value
of these two models has been to assist in defining PK/PD
parameters for the different drug classes, as they were not
designed to directly reflect the clinical picture in humans.
The three PK/PD predictors of efficacy for which relationships have been shown are (i) time above the MIC (T⬎MIC),
usually expressed as a percentage of the dosing interval; (ii) the
ratio of the area under the curve over 24 h to the MIC (AUC24/
MIC); and (iii) the peak level-to-MIC ratio (Cmax/MIC). In
this context, the AUC is the area found under the plasma
concentration-time profile, and the Cmax is the maximum
plasma concentration after each dose. The choice of the three
PK components T⬎MIC, AUC, and Cmax rather than other PK
components relates to the fact that these components have
relatively low interdependence, i.e., they can vary significantly
without greatly affecting each other. Thus, dosing regimens can
be varied in animal model studies so widely that it is possible
to minimize the effect of interdependence and thereby maximize the chance that only one of the components will be highly
statistically correlated. An example of this is shown in Fig. 2,
showing significant scatter and poor correlation between
AUC24/MIC or Cmax/MIC and killing but excellent correlation
to T⬎MIC for one organism-antibacterial pair in the mouse
pneumonia model.
Note that “MIC” appears in each of the PK/PD parameters.
For the utility of PK/PD data in setting breakpoints, this was a
pivotal finding. When the PK/PD parameters are “controlled
for” by using MIC in the denominator, it is possible to show
that similar agents have similar parameter magnitudes for the
same degree of killing when MIC differences between these
agents are factored into the analysis (36, 37, 137).
Another important feature of the PK/PD parameters is that
correspondences between drugs are best when protein binding
is taken into account (1, 37). For instance, the T⬎MIC percentages for maximum killing of Staphylococcus aureus in the
mouse thigh model are identical for cefotaxime and ceftriaxone, but only when free drug concentrations are used in the
analysis (37). This is strong evidence that protein binding must
be taken into account when applying PK/PD findings to the
setting of breakpoints.
Questions arise regarding the applicability of PK/PD parameter data generated in animal models such as the mouse thigh
model, where the end point is bacteriostasis or bacterial killing
after 24 h. Some confidence about the parameters and their
FIG. 2. Relationship between PK/PD parameters and killing of Klebsiella pneumoniae by cefotaxime in the mouse pneumonia model. (Reprinted from reference 37 with permission from Elsevier.)
398
TURNIDGE AND PATERSON
CLIN. MICROBIOL. REV.
TABLE 3. Prospective clinical studies of PK/PD parameters
Agent
␤-Lactams
Cefmenoxime
Cefepime
Penicillins and
cephalosporinsb
Fluoroquinolones
Ciprofloxacin
Levofloxacin
Gatifloxacin and
levofloxacin
Grepafloxacin
Garenoxacin
Levofloxacin
Ciprofloxacin
Other agents
Gentamicin
Gentamicin and
tobramycin
Vancomycin
PK/PD parameter
selected
Magnitude of parameter
for maximum efficacy
(clinical cure rate)f
Nosocomial pneumonia
Hospitalized, various
Otitis media caused by Streptococcus
pneumoniae or Haemophilus influenzae
Time above DRCa
Time above 4.3⫻ MIC
Time above MIC
70–100%
100%
60%
118
126
38
Mainly nosocomial pneumonia
Serious community-acquired infection
Streptococcus pneumoniae communityacquired pneumonia and AECB
AECB
Community-acquired pneumonia, AECB, and
sinusitis
Nosocomial pneumonia
Pseudomonas aeruginosa bacteremia
AUC24/MIC ratio
Cmax/MIC ratio
fuAUC24/MIC ratiod
ⱖ125
ⱖ12.2
ⱖ33.7
71
111
1
AUC24/MIC ratio
Nonee
ⱖ175
72
133
AUC24/MIC ratio
Cmax/MIC ratio
ⱖ87
ⱖ8
59
143
Nosocomial pneumonia
Pseudomonas aeruginosa bacteremia
Cmax/MIC ratio
Cmax/MIC ratio
ⱖ10
ⱖ8
85
143
Staphylococcus aureus lower respiratory tract
infection
AUC24/MIC ratio
Infection(s)c
ⱖ350
Reference(s)
101, 102
a
DRC was used as a surrogate of the MIC per reference 128.
This was an analysis of data from multiple clinical studies.
c
AECB, acute exacerbations of chronic bronchitis.
d
fu, fraction unbound.
e
Due to the very high activity of the agent, fuAUC24/MIC ratios were ⬎200 in more than 90% of patients.
f
Magnitudes are expressed in terms of total drug, rather than unbound drug, unless stated otherwise.
b
magnitudes can be taken from analyses that have compared
them with mortality in a range of animal models (39) and
across different organisms (41).
The magnitudes of the relevant parameters predicting efficacy are thought to vary depending on a range of factors, with
the most important being the class of drug and the infection
compartment. T⬎MIC percentages to achieve bacteriostasis
(no net growth or killing at the site of infection in the animal
model) vary between ␤-lactam classes, with cephalosporins
requiring the highest percentage and carbapenems the lowest.
Variation between bacterial species is sometimes seen.
Clinical studies of PD. There are few clinical studies that
have been conducted deliberately to confirm the findings of in
vitro and animal model PD. This is understandable because in
order to confirm the choice of PK/PD parameters, it is necessary to have both clinical and microbiological failures, as well
as sufficient variation in dosing regimens, to separate out the
correct PK/PD parameter. Planning for failures in studies is
generally considered unethical, and wide variation in dosing
regimens is impractical. Hence, most studies in this area have
been retrospective, although a few key ones have analyzed
outcomes prospectively based on PK/PD parameters (2).
Those that have been conducted prospectively have confirmed
the analyses made in vitro and with animal PK/PD models.
A number of clinical studies have shown a relationship between MIC and treatment outcome. Conditions and agents
studied include suspected gram-negative bacteremia and
cefoperazone (56), multiple different infections and cefoperazone (36) or cefotaxime (55), acute otitis media and cefu-
roxime axetil (75), Bacteroides fragilis and cefoxitin (120),
methicillin-resistant Staphylococcus aureus bacteremia and
vancomycin (117), and extended-spectrum ␤-lactamase-producing gram-negative bacteremia and third-generation cephalosporins (83). By itself, this relationship is informative about
the importance of the MIC but otherwise unhelpful because it
is not possible to know which of the three PK/PD parameters
is relevant. This comes about because dosage regimens in these
studies are usually fixed or vary little, making it impossible to
control for the level of interdependence of the PK/PD variables. Furthermore, the MIC of the infecting pathogen and
the dosing schedule of the antibacterial agent are not the
only determinants of efficacy, and the host response can be
important or even dominant in the resolution of infection.
Most importantly, we cannot determine from such studies
whether the dosing schedules used were optimal. If the
PK/PD parameters are known, the effects of changes in the
dosing schedule can be predicted and dosing schedules
optimized.
Fortunately, there are some studies that have been able to
examine which of the PK/PD parameters are important. These
are listed in Table 3. In each case, the selected parameter and
its magnitude correlate reasonably well with those found in
animal models. These data strengthen the case for using
PK/PD parameters and their magnitudes for estimation of
breakpoints that have clinical meaning.
Estimation of target attainment. Initial attempts at using
PK/PD data to estimate breakpoints used average PK values
(129). This is unsatisfactory because of significant intersubject
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
399
FIG. 3. (A) Fractional probability of target attainment (expressed as a percentage) of intravenous levofloxacin at 500 mg daily, based on PK
in healthy volunteers. (Generated using data from reference 22.) (B) Fractional probability of target attainment of intravenous levofloxacin at 750
mg daily, based on PK in a clinical efficacy study, compared to MIC distributions of two major nosocomial pneumonia pathogens. (Reprinted from
reference 59 with permission. © 2004 by the Infectious Diseases Society of America. All rights reserved.)
variability in PK, even in young healthy subjects (58). PK values can vary even more during illness and as a consequence of
underlying diseases. Both kinds of variation need to be included in any estimation of breakpoints based on PK/PD data.
The method for factoring in variation is known as Monte Carlo
simulation and was first successfully employed in antibacterial
PD by Drusano et al. (57, 58).
Monte Carlo simulation is a statistical technique whereby
a population of values of interest is simulated using existing
data, such as the mean and standard deviation from a standard (small) PK/PD study, and then randomly generating a
large number of patient values according to an underlying
statistical distribution, such as the normal (Gaussian) or,
sometimes, log-normal distribution. In this way, the variation in time above a certain value, the AUC24, and Cmax, as
found for patients given a defined dosage regimen, can be
“created” and used to estimate the probabilities of reaching
certain values when large numbers of patients are treated
with that regimen. In the context of antibacterials, these
“certain values” will be determined by the magnitude of the
PK/PD parameter predicting maximum efficacy, for example, 50% for %T⬎MIC of a ␤-lactam, 100 for an AUC24/
MIC ratio of a fluoroquinolone, or 10 for a Cmax/MIC ratio
of an aminoglycoside. With these values, it is possible to find
the probability that these magnitudes will be reached at different
MICs. This whole process is called target attainment analysis.
When target attainment rates fall below 90%, the probability of
that dosing regimen being effective is significantly diminished, and
the PK/PD cutoff becomes the highest MIC for which the target
attainment exceeds 90%. The figure of 90% has been chosen
arbitrarily and has not been validated clinically but is widely used
in target attainment analysis.
By way of example, using healthy volunteer PK/PD data for
intravenous levofloxacin at a dose of 500 mg daily (22), the
400
TURNIDGE AND PATERSON
CLIN. MICROBIOL. REV.
fractional probabilities of achieving an AUC24/MIC ratio of at
least 100 for different MICs are shown in Fig. 3A. Improvements on this basic process can be made when (i) PK data from
prospective clinical studies are used, rather than conventional
PK data from volunteer studies (58); and (ii) MIC distributions, as described above, are factored into the analysis (59).
These improvements are shown in Fig. 3B, from a study of
intravenous levofloxacin (750 mg once daily) for treatment of
nosocomial pneumonia (59).
Monte Carlo simulation is being used increasingly to assist in
developing clinical breakpoints (5, 105). It is now recognized
that including between-patient variation in PK and betweenorganism variation in MICs is an essential component that
must be taken into account when setting breakpoints. It is no
longer appropriate to use average PK/PD values or susceptibility measures such as the MIC90 (1).
Results of Monte Carlo simulation may vary according to
the input variables and underlying assumptions used. The input variables, as mentioned above, include a variety of PK
parameters and the extent of protein binding of the antibacterial. Clearly, such variables may differ from source study to
study. The adequacy of these studies may influence the outcome of the Monte Carlo simulation. Even the use of apparently equivalent parameters, such as half-life versus clearance,
in different models may greatly alter the results. The number of
patient simulations is also of relevance; typically, 5,000 to
10,000 such simulations are used. A number of different programs are used to conduct Monte Carlo simulation (such as
Adapt, Crystal Ball, etc.), but it is unlikely that the use of
different programs will substantially alter the results of target
attainment analysis. We believe that standard, predefined
methodologies for Monte Carlo simulation should be used by
organizations setting breakpoints and that these methods
should be internationally harmonized.
pathogens likely to be involved in the infection under study. (ii)
As a consequence of point i and the nature of MIC distributions, it is likely that for some species, there will be few infections included in the study caused by strains at the top end of
the distribution, especially because sample sizes for an individual species are likely to be small. This greatly enhances the
chance of error in estimating a clinical breakpoint. (iii) There
is little consensus on which rates of cure and/or eradication are
acceptable. From a regulatory standpoint, such studies typically test noninferiority compared to a drug that has previously
received regulatory approval. It is not clear whether this is
always the appropriate end point for assessment of breakpoints. Indeed, regulators have recently recognized the limitations of comparative noninferiority studies and in some cases
are now requesting studies designed to show superiority or to
be placebo controlled. (iv) No numerical account is taken of
natural response rates, which can be quite high for some common bacterial infections. (v) Not all species of interest in a
particular infection necessarily get included in prospective
studies. Thus, breakpoints may be extrapolated inappropriately
from commoner species.
Ideally, clinical studies would recruit significant numbers of
cases where the infecting pathogen has an MIC on either side
of the wild-type and PK/PD cutoff values to assist in the clinical
validation of final breakpoints. However, this is unlikely to
happen for a range of reasons, including point ii above and the
fact that the only studies with sufficient recruitment are those
conducted on new, potent antibacterial agents for regulatory
registration purposes. Of interest, the use of clinical outcome
data to define breakpoints has been popular in the past in
Japan. Examination of outcomes by MIC has led to the selection of a breakpoint estimated to be the lowest MIC where
maximum or near-maximum efficacy has been achieved
(115,116).
Outcome Data from Clinical Studies
COMBINING CUTOFFS TO SET BREAKPOINTS
Some organizations give the greatest weight to prospective
clinical studies to define breakpoints, especially those trials
done for regulatory purposes. Such trials are typically randomized controlled trials with predefined dosage regimens, clinical
end points, and bacteriologic end points. An advantage of such
studies is that concomitant antibacterial use is typically minimal so that the effects of the antibacterial under study can be
studied independently. Most often, the appropriate correlation
in such studies is clinical and/or bacteriological outcome versus
the MIC for the infecting pathogens. Clinical studies may have
their greatest value in providing a “reality check” for cutoffs
derived from microbiologic and PK/PD studies. Clinical failure
rates in excess of those predicted by microbiological and
PK/PD data should trigger a reassessment of breakpoints prior
to an antibacterial’s commercial introduction.
It is important to note that there is a range of problems with
regulatory clinical studies that limit our ability to always correctly interpret these data for breakpoint setting. These limitations are as follows. (i) The great majority of studies predefine “resistance” and exclude/withdraw patients with
“resistant” strains. The way “resistance” is predefined is often
not clear to the investigators but often appears to be based, at
least in part, on MIC distributions, i.e., the wild-type cutoff for
General Principles
The most comprehensive process for setting MIC breakpoints involves a comparison between PK/PD cutoffs, clinical
cutoffs, and wild-type cutoffs. Ideally, it is based on a full set of
data, as outlined in Table 4. Combining cutoffs into a single
breakpoint is still largely a matter of judgment. The process,
unfortunately, can be swayed by the composition of skills and
biases of the group making the breakpoint decisions. It is
largely a question of how to merge the three cutoffs in such a
way as to ensure that (i) strains that are likely to respond to
treatment with the chosen dosage schedule at the likely site of
infection are classified as susceptible and (ii) strains that are
unlikely to respond to treatment with the chosen dosage schedule at the likely site of infection are classified as resistant.
It is our opinion that the initial step in breakpoint determination should be an assessment of the MIC distribution for a
contemporary collection of isolates obtained from global
sources. The PK/PD cutoff should be applied to this collection.
We believe that the PK/PD cutoff provides the greatest amount
of “value” in this situation because it includes much of the
relevant data in its construction, including (i) the MIC as it is
measured in vitro; (ii) the relevant PD parameter and its mag-
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
401
TABLE 4. Preferred data sets for establishing breakpoints of an antibacterial
Area of investigation
Data item
In vitro activity .........................................Construct MIC distributions of bacterial species of interest
Determine wild-type cutoffs for individual species or closely related species
If possible, determine resistance mechanisms if there is evidence of acquired resistance in any species
and correlate them with wild-type cutoffs
In vitro PD................................................Determine if killing in vitro is concentration or time dependent
Determine duration of the PAE
Measure protein binding in animals used in the animal model for PK/PD and in humans
Animal model PD ....................................Determine PK in animal model
Determine PD parameter that best predicts efficacy (bacterial killing) in animal model (e.g., mouse
thigh), i.e., either %T⬎MIC, AUC24/MIC, or Cmax/MIC
Estimate the magnitude of the PD parameter based on unbound drug (target) that produces
bacteriostasis or near-maximum killing
Human PD................................................Determine PK in humans (usually with volunteer studies), including nature of population kinetic model
(normal or log-normal) and means and standard deviations of volumes of distribution, elimination
half-lives, AUCs, and Cmax values (depending on the relevant PD parameter)
Using Monte Carlo simulation, calculate target attainment rates for unbound drug at different MICs
for bacteriostasis and near-maximum killing
Set PD cutoff at the highest MIC where target attainment exceeds 90%
Clinical outcome studies .........................Collect outcome data from prospective clinical studies by infection type and by bacterial species
(clinical efficacy and bacteriological efficacy)
Perform PK studies with at least a subset of patients and compare results with those of previous
volunteer studies (as described for human PD studies)
Tabulate both types of outcomes by infection type, by bacterial species, and by MIC
Select clinical cutoff (by species and infection type if necessary) as the highest MIC giving maximum
efficacy
Disk diffusion zone diameters ................Construct scattergrams of zone diameters versus MICs of closely related species by species
nitude, which predicts in vivo efficacy; (iii) human PK and its
intersubject variation; and (iv) the dosing regimen. PK/PD
breakpoints are sometimes criticized on the basis that they are
established using PK/PD data from plasma/serum, which do
not necessarily reflect what is happening to the drug in tissues
where infections are located. This criticism misses the point.
When the PD parameter that predicts efficacy is determined
with an animal model, it is by using the plasma levels as a
surrogate for what is happening at the site of infection. If a
robust relationship can be found between bacterial inhibition
and killing and plasma PK/PD (which is almost always true),
then that is all that is needed to validate the model. This is true
for both bactericidal and bacteriostatic agents.
Clinical cutoffs should be considered a validation tool for
PK/PD cutoffs and, because of the limitations stated above,
should not necessarily receive greater weighting. Clinical cutoffs are most important when they fall below PK/PD cutoffs. If
this is the case, it suggests that further PK/PD work is required
to understand the relationship between PD and outcomes.
Different results arising from application of clinical versus
PK/PD cutoffs may arise when differing dosage regimens of the
drug are licensed or used in clinical practice. PK/PD cutoffs
apply to specific dosage regimens. The most conservative approach is to generate PK/PD cutoffs based on the lowest approved dosage regimen for the drug. It would be logical to
apply different breakpoints to different dosage regimens—unfortunately, communication of such information by clinical microbiology laboratories to prescribers may be difficult. Ideally,
authorities setting breakpoints for susceptibility testing should
specify the dosage regimen on which their breakpoints are
based.
The principal application of wild-type cutoff values is to
examine whether the PK/PD and clinical cutoffs fall below
them and inside the wild-type MIC distribution. If this does
occur, then problems will be encountered in testing and interpretation, as some wild-type strains will be “susceptible” and
others “intermediate” or “resistant,” and because of day-today variations in testing results, some strains could readily end
up in any of the three categories. A general solution to the
possible breakpoint splitting of wild-type distributions has not
been agreed upon yet. In practice, if the split is at the high end
of the distribution, then the breakpoint is not modified and it
is accepted that a small number of strains with wild-type MICs
will test as “intermediate” or “resistant.” If the split occurs in
the center or lower end of the MIC distribution, the conservative approach is to nominate that species as intermediate or
resistant.
Breakpoints by Infection Site
Breakpoints are usually established on the basis that they are
relevant at all sites of infection. However, there are body compartments where antibacterials can be concentrated or have
restricted penetration.
Urinary tract. Many antibacterials are excreted primarily in
urine and achieve concentrations substantially higher than
those seen in plasma. In many methods, it is conventional not
to adjust breakpoints for urinary tract infections for the ma-
402
TURNIDGE AND PATERSON
jority of agents in this category in order to reduce the complexity of multiple interpretative criteria. Whether this is warranted is unclear. Conversely, for those methods that do supply
different breakpoints for urinary tract isolates causing lower
urinary tract infection, it is usually not possible for the laboratory to distinguish isolates associated with lower versus upper urinary tract infection. Previously, it was believed that
urinary concentrations predicted the outcome better than did
serum concentrations, at least for lower urinary tract infection
(122). Prospective clinical data on the outcome of treating
urinary tract infections caused by organisms with various levels
of susceptibility and resistance are scarce. Those studies that
do examine this have found that the current CLSI breakpoints
for trimethoprim-sulfamethoxazole, which are based on systemic PK, effectively separate clinical and microbiological successes and failures or relapse (20, 77, 113) and that failure rates
with strains defined as resistant using systemic PK are the same
as those seen with placebo (100).
Recent attempts to examine the PD of urinary tract infection
treatment have shown a modest relationship between the total
time that aminopenicillins exceed the MIC in plasma and treatment outcomes in clinical studies (74). Maximum efficacy is
achieved when the total time is ⱖ30 h. Further studies with a
mouse model of ascending urinary tract infection have been
able to show a correlation between the MIC and bacterial
killing for sulfamethizole but not amdinocillin (87). Despite all
the uncertainties, some methods, such as that of the British
Society for Antimicrobial Chemotherapy, do provide higher
breakpoints for more than 10 drugs used for urinary tract
infection (95). Other authorities, such as the CLSI and Comité
de l’Antibiogramme de la Société Française de Microbiologie,
provide “urinary” breakpoints for agents whose primary role is
the treatment of urinary tract infection, for instance, nitrofurantoin, sulfonamides, trimethoprim, norfloxacin and some
other quinolones, fosfomycin, and amdinocillin (28). More
work will be required in the area of urinary tract levels, PD,
and outcomes.
Cerebrospinal fluid. Although the penetration of many
drugs into cerebrospinal fluid is known to be restricted, even in
the presence of inflammation, breakpoints are not usually adjusted to take the specialized PK of antibacterials in the subarachnoid space into account, principally because it is standard
practice to use much higher doses for bacterial meningitis to
compensate for restricted penetration. Almost all of the information relevant to breakpoint setting has been generated by
observing treatment failures, mostly to expanded-spectrum
cephalosporins, of pneumococcal meningitis (84, 86, 107). A
number of organizations have adjusted their breakpoints for
pneumococci when they are associated with meningitis, but
mainly for expanded-spectrum cephalosporins. Most methods
already had low breakpoints for penicillin, and these did not
require adjustment when strains with reduced susceptibility
emerged.
Breakpoint Setting before Resistance Has Emerged
When antibacterial agents with novel mechanisms of action
are developed, it is usual for there to be no resistance among
the bacteria within their spectrum. It is therefore not possible
to be confident of a correlation between susceptibility and
CLIN. MICROBIOL. REV.
treatment outcome from clinical studies, as no patients will
have been infected with “resistant” strains. Under these circumstances, in vitro data, animal PD data, and human PK data
(with Monte Carlo simulation) are used to define breakpoints.
If the calculated PK/PD cutoff is substantially greater than the
wild-type cutoff for any species, the conservative decision is
usually to set the MIC breakpoint only one or two doubling
dilutions above the wild-type cutoff value. Some authorities,
such as the CLSI, will choose to set only a single breakpoint,
with that being “susceptible.” When resistance has emerged, it
is then possible to reexamine the tentative breakpoint and to
establish a resistance breakpoint and, if necessary, an intermediate range.
Reevaluation of Breakpoints Years after the Commercial
Release of an Antibacterial Agent
A difficult situation arises when new mechanisms of bacterial
antibacterial resistance are detected a significant time after
breakpoints were initially determined. Such a situation has
occurred with the discovery of ␤-lactamase types such as extended-spectrum ␤-lactamases (109) and metallo-␤-lactamases
(136). When these new mechanisms of resistance are found in
organisms susceptible to an antibacterial potentially subject to
these resistance mechanisms, a case may be made for reevaluating breakpoints. Such a signal to reevaluate breakpoints is
often hastened by clinical case reports describing failure of the
antibacterial in question when used in treatment of an organism harboring the new mechanism of resistance. In other circumstances, a renewed understanding of the PK/PD of an
antibacterial may serve as the trigger for breakpoint reevaluation (7).
Breakpoint organizations in the United States, in particular
CLSI, do reevaluate breakpoints when it is deemed necessary.
However, their implementation is more difficult because of the
role of the regulatory authority in setting and altering breakpoints. Additionally, there may be commercial reluctance to
invest funds in the provision of new clinical data assessing the
need to reevaluate breakpoints. In particular, it is highly unlikely that prospective clinical studies will be performed in an
environment similar to that in which regulatory studies are
conducted. Finally, antibacterials undergoing reevaluation may
be generically available; in this situation, there is unlikely to be
any commercial support for provision of new clinical data.
It is our opinion that the discovery of new antibacterial
resistance mechanisms occurring in organisms which are “susceptible” to an antibacterial using previously established
breakpoints should be the prompt that necessitates reevaluation of antibacterial breakpoints. It is our belief that the regulatory authorities should mandate that the manufacturer of
the drug undergo collection of PK/PD and clinical data relevant to the breakpoint reevaluation. The PK/PD data should
be of the standard we have previously defined. It is impractical
to suggest that the clinical data should come from new prospective randomized trials. Rather, such clinical data should
come from large data sets for consecutive patients treated with
the relevant antibacterial. In general and where relevant,
bloodstream infection is the most useful infection type in such
a reevaluation since there can be little debate as to the clinical
relevance of such an infection. Clinical and bacteriologic end
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
403
FIG. 4. “Scattergram” of MICs versus zone diameters. Numbers represent the number of isolates at each MIC/zone diameter pair (e.g., there
were 17 isolates whose MICs were ⱖ256 mg/liter and whose zone diameters were ⱕ6 mm). (Reprinted from reference 130 with permission of the
publisher.)
points (i.e., rates of cure, improvement and failure, or eradication and persistence) should be predefined rather than determined after preliminary exploration of the data. Potential
confounders to an association with clinical outcome include
the dosing regimen, organism type, portal of entry of the organism, comorbid illnesses, severity of illness, presence of immunosuppression, and concomitant antibacterial therapy. The
clinical data set should be of sufficient size that the assessment
is adequately powered to determine statistically significant differences in outcome from infections due to organisms with
different MICs. A further layer of substantiation of clinical
outcome may come from comparison of outcomes from infections with the target organism/MIC but with different antibacterials used for treatment.
An example is provided in order to illustrate such an
approach. A variety of ␤-lactamases which can hydrolyze
cefepime yet occur in organisms with cefepime MICs within
the susceptible range have been detected (110). PK/PD analysis suggests that target attainment may be suboptimal using
regulator-approved doses of cefepime for some MICs previously regarded as susceptible (127). A data set of consecutive
patients with gram-negative bacteremia treated with cefepime
would be collected, including the acquisition of data on confounding variables. The outcomes for patients infected with
organisms of different MICs would be compared and analyzed
using logistic regression or other multivariate analysis. If statistically significant differences in outcomes at different MICs
occur, this would provide strong support for a change in breakpoint.
Case reports or small case series (particularly of nonconsecutive patients) may be a “signal” to reevaluate breakpoints but
should not themselves be regarded as satisfactory evidence
when breakpoints are being reevaluated. If inadequate clinical
data are present to support or refute breakpoint revisions
based on PK/PD analysis, either the breakpoints based on
PK/PD analysis should be accepted or phenotypic screening
and confirmatory tests for the resistance mechanism might be
developed. It is appreciated that the latter approach is more
“conservative,” but many involved in breakpoint setting may
prefer to “play it safe” and avoid risking patient safety by
properly categorizing a potentially compromised antibacterial
agent. In many cases, development of screening and confirmatory tests for new resistance mechanisms can be undertaken
prior to acquisition of solid clinical data relevant to breakpoint
assessment. The downside of this approach is that broaderspectrum agents are often inadvertently “promoted” by the
testing laboratory.
SETTING ZONE DIAMETER BREAKPOINTS FOR DISK
DIFFUSION TESTING
Susceptibility testing by the disk diffusion method rather
than the MIC-based method is still very widely used. Although
there have been attempts to establish disk diffusion interpretive criteria, usually by defining resistance as zone diameters
smaller than those of the wild type (91), the only valid method
is to correlate zone diameters with MICs as described below.
Hence, once MIC breakpoints have been set, zone diameter
breakpoints can be developed. The simplest approach is to plot
a “scattergram” of zone diameters versus MICs for strains
tested by both methods (130) (Fig. 4). Scattergrams allow visual inspection of the correlation between zone diameters and
MICs. Originally, it was considered appropriate to combine
similar species on a single scattergram and fit a regression line
through the data points (63). However, this does not readily
lead to the setting of criteria to discriminate between susceptible and resistant strains. Furthermore, MIC and zone diameter data are not evenly distributed along a continuum for a
species or related species, but tend to cluster. Hence, the
validity of applying regression is questionable.
The first effective statistical method for setting zone diameter interpretive criteria based on scattergram data was developed by Metzler and DeHaan (99). They developed the
so-called error-rate-bounded method, which involves the selection of zone diameter values defining resistance and susceptibility from predefined acceptable rates of error. Tolerance of
“very major” errors, where strains known to be resistant on
MIC testing but whose zone diameter criterion would define
them as susceptible, was set very low, at ⱕ1% of all MIC-zone
diameter pairs (Fig. 4). This was justified because calling resistant strains susceptible in a laboratory test could cause serious adverse consequences for the patient. Tolerance of “ma-
404
TURNIDGE AND PATERSON
jor” errors, i.e., susceptible by MIC data but resistant by zone
diameter data, was accepted at a level of ⱕ5%. These authors
did not comment on acceptable rates of “minor” errors. Their
analysis was also based on the use of a single MIC breakpoint
defining susceptibility and resistance only on the basis of MICs,
an infrequent situation for most susceptibility testing methods.
The error-rate-bounded method has been enhanced through
the work of Brunden et al. (21). They adapted the method to
two MIC breakpoints defining intermediate susceptibility as
well as susceptibility and resistance and introduced an accepted “minor” error rate of ⱕ5%. Minor errors are zone
diameter results that categorize either resistant or susceptible
MIC results as intermediate or intermediate MIC results as
resistant or susceptible (Fig. 4). They also introduced the concept of iteration to find the best fit of zone diameters that
would minimize errors overall. This was achieved through the
development of an index (index ⫽ [possible susceptible zone
diameter ⫺ possible proposed resistant zone diameter]/percentage error). By trying different possible zone diameter pairs
to define susceptible and resistant, the aim is to maximize the
value of the index. While their accommodation of an intermediate range of MICs is now widely accepted, the iterative
method of fitting has yet to be widely adopted.
An alternative method, again based on the concept of error
rate bounding, has been proposed by the CLSI (24). In this
system, discrepancy rates for very major, major, and minor
errors are established for three different bands within the MIC
range, whose widths vary according to the range of the intermediate MIC category. For example, in Fig. 4, the bands are
ⱕ2 mg/liter, 4 to 16 mg/liter, and ⱖ32 mg/liter. Adjustments to
discrepancy rates are made if there is only a single MIC breakpoint with no intermediate range. Readers are referred to the
CLSI M23 document for further explanation about the method
and its application (24). The method offers greater flexibility in
establishing zone diameter interpretive criteria, but possibly at
the cost of reduced correlation with MICs.
Kronvall et al. proposed a different approach altogether in
setting zone diameter breakpoints (91, 92). They noted the
resemblance of zone diameter distributions of the wild-type
population to a normal distribution and developed a proprietary method for defining the distribution and setting a single
zone diameter breakpoint. The method takes advantage of the
fact that the upper end of the normal distribution is easily
recognized graphically, and the data can be used statistically to
define the lower end of the wild-type distribution by, in a sense,
“reflecting” the upper end. MICs or breakpoints are not used
in the analysis, and it cannot be used to determine intermediate zone diameter breakpoints.
An entirely different alternative to establishing zone diameter interpretive criteria has been proposed by Craig (32). The
method is based on detailed statistical modeling of the spread
and error of MICs and zone diameters and was designed to
reduce the sometimes arbitrary choice of zone diameter breakpoints which can still occur when error-rate-bounded methods
are used. Although this is the most sophisticated of the methods developed so far, it has yet to become adopted by any
standard-setting body.
In summary, there is no current consensus on the optimum
method for determining zone diameter breakpoints. While the
method of Craig is the most robust statistically, it is not in a
CLIN. MICROBIOL. REV.
form, such as a computer program, that can be used readily by
those charged with determining these breakpoints. One or
another error-rate-bounded method will continue to be the
standard for the immediate future. That recommended by
Brunden et al. would serve the breakpoint setting community
well for the foreseeable future.
UNANSWERED QUESTIONS AND FUTURE NEEDS
In spite of significant progress being made in recent years,
breakpoint setting is still not an exact science. There are quite
a few questions whose answers will improve the decision-making process and increase the interpretive value of breakpoints,
including the following. (i) Should strains possessing an acquired resistance mechanism but having MICs below the
PK/PD breakpoint be considered resistant and reported as
such, regardless of the MIC? (ii) What are the best magnitudes
to choose for the various PK/PD parameters? (iii) Do the
magnitudes of the PK/PD parameters apply to all infection
sites, or do they vary by site? (iv) Do the magnitudes of the
PK/PD parameters apply to all bacteria, or do they vary by
species? (v) Should breakpoints be linked to a specific dosage
regimen? (vi) Is there utility in considering the MIC in conjunction with the breakpoint (e.g., the “breakpoint quotient,”
or the MIC of the infecting pathogen divided by the breakpoint
MIC), similar to the method proposed long ago for comparing
blood or tissue levels with the MIC of the infecting pathogen
(62)? (vii) If not all data are available, which data would be
considered a minimum for setting a breakpoint? (viii) What
systems need to be established to ensure the timely review of
breakpoints as resistance emerges? (ix) Can MIC measurements be improved to give greater precision and reproducibility?
We look forward to the work of our colleagues to provide
answers to these and other questions so that the art and science
of breakpoint setting might converge in the not too distant
future.
CONCLUSIONS
Breakpoints can be used in several ways. They allow communication from the clinical laboratory to the prescriber
regarding the likelihood that a particular antibacterial regimen will be clinically useful in the treatment of patients
with infections. They also allow the epidemiologic study of
changing resistance patterns in a defined institution or geographic area. Breakpoints should be set prior to an antibacterial being used clinically and must be reviewed when
mechanisms of resistance to the antibacterial become apparent. Breakpoint setting is not an exact science. It requires knowledge of the wild-type distribution of MICs,
assessment of the PK/PD of the antibacterial, and study of
the clinical outcome of infections when the antibacterial is
used. Our current state of knowledge about each of these
facets of breakpoint setting is imperfect. Breakpoint-setting
organizations must utilize experts in microbiology, PD, and
clinical infectious diseases in order to come to a consensus
regarding the most appropriate breakpoint to be utilized. If
appropriately developed and revised, breakpoints have
greater relevance to the prescriber than does phenotypic
VOL. 20, 2007
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
detection of resistance mechanisms. However, breakpointsetting organizations may also play a role in developing
phenotypic tests for detection of resistance mechanisms, as
this information may have epidemiologic and clinical importance that complements use of the breakpoint.
REFERENCES
1. Ambrose, P. G., and R. Quintiliani. 2000. Limitations of single point pharmacodynamic analysis. Pediatr. Infect. Dis. J. 19:769.
2. Ambrose, P. G., S. M. Bhavnani, C. M. Rubino, A. Louie, T. Gumbo, A.
Forrest, and G. Drusano. 2007. Pharmacokinetics-pharmacodynamics of
antimicrobial therapy: it’s not just for mice anymore. Clin. Infect. Dis.
44:79–86.
3. Ambrose, P. G., D. M. Grasela, T. H. Grasela, J. Passarell, H. B. Mayer,
and P. F. Pierce. 2001. Pharmacodynamics of fluoroquinolones against
Streptococcus pneumoniae in patients with community-acquired respiratory
tract infections. Antimicrob. Agents Chemother. 45:2793–2797.
4. Ambrose, P. G. 2005. Antimicrobial susceptibility breakpoints: PK-PD and
susceptibility breakpoints. Treat. Respir. Med. 4(Suppl. 1):5–11.
5. Ambrose, P. G. 2006. Monte Carlo simulation in the evaluation of susceptibility breakpoints: predicting the future: insights from the Society of Infectious Diseases Pharmacists. Pharmacotherapy 26:129–134.
6. Amsterdam, D. 2005. Susceptibility testing of antimicrobials in liquid media, p. 61–143. In V. Lorian (ed.), Antibiotics in laboratory medicine, 5th
ed. Lippincott Williams & Wilkins, Philadelphia, PA.
7. Andes, D., and W. A. Craig. 2005. Treatment of infections with ESBLproducing organisms: pharmacokinetic and pharmacodynamic considerations. Clin. Microbiol. Infect. 11(Suppl. 6):10–17.
8. Andes, D., R. Walker, S. Ebert, and W. Craig. 1994. Increasing protein
binding of cefonicid enhances its in vivo activity in an animal model of
infection, abstr. A93. Abstr. 34th Intersci. Conf. Antimicrob. Agents Chemother. American Society for Microbiology, Washington, DC.
9. Andes, D., M. L. van Ogtrop, J. Peng, and W. A. Craig. 2002. In vivo
pharmacodynamics of a new oxazolidinone (linezolid). Antimicrob. Agents
Chemother. 46:3484–3489.
10. Andrews, J. 2001. Determination of minimum inhibitory concentrations. J.
Antimicrob. Chemother. 48(Suppl. S1):5–16.
11. Andrews, J. January 2005, posting date. BSAC disc diffusion method for
antimicrobial susceptibility testing, version 4, January 2005. British Society
for Antimicrobial Chemotherapy, Birmingham, United Kingdom. www
.bsac.org.uk. Accessed 5 February 2006.
12. Arakawa, S., T. Matsui, S. Kamidono, Y. Kawada, H. Kumon, K. Hirai, T.
Hirose, T. Matsumoto, K. Yamaguchi, T. Yoshida, K. Watanabe, K. Ueno,
A. Saito, and T. Teranishi. 1998. Derivation of a calculation formula for
breakpoints of antimicrobial agents in urinary tract infections J. Infect.
Chemother. 4:97–106.
13. Arbeidsgruppen for Antibiotikaspørsmål. 2006. AFAs brytningspunkter for
bakteriers antibiotikafølsomhet, versjon 1.9. Arbeidsgruppen for Antibiotikaspørsmål, Tromso, Norway. www.unn.no/category10274. Accessed 1
November 2006.
14. Arbeidsgruppen for Antibiotikaspørsmål. 29 May 2005, posting date. Nødvendig bakgrunnsmateriale og prosedyrer for etablering og justering av
mm-brytningssoner. Arbeidsgruppen for Antibiotikaspørsmål, Tromso,
Norway. www.unn.no/article19775-927.html.
15. Baquero, F., J. Martı́nez-Beltrán, R. Cánton, and the remaining members
of the Mesa Española de Normalización de la Sensibilidad y Resistencia a
los Antimicrobianos (MENSURA). 1997. Criterios del grupo MENSURA
para la definiciónde los puntos crı́ticos de sensibilidad a los antibióticos.
Rev. Esp. Quimioter. 10:103–313.
16. Bell, S. M. 1975. The CDS disc method of antibiotic sensitivity testing
(calibrated dichotomous sensitivity test). Pathology 7(Suppl.):1–48.
17. Bell, S. M., B. J. Gatus, J. N. Pham, and D. L. Rafferty. Accessed 1
November 2006. Antibiotic susceptibility testing by the CDS method.
The CDS Users Group, Randwick, Australia. www.med.unsw.edu.au
/pathology-cds. 2004.
18. Bergan, T., J. N. Bruun, A. Digranes, E. Lingaas, K. K. Melby, and J.
Sander. 1997. Susceptibility testing of bacteria and fungi. Scand. J. Infect.
Dis. 103(Suppl.):1–36.
19. Blaser, J., B. B. Stone, M. C. Groner, and S. H. Zinner. 1985. Impact of
netilmicin regimens on the activities of ceftazidime-netilmicin combinations
against Pseudomonas aeruginosa in an in vitro pharmacokinetic model.
Antimicrob. Agents Chemother. 28:64–68.
20. Brown, P. D., A. Freeman, and B. Foxman. 2002. Prevalence and predictors
of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli isolates in Michigan. Clin. Infect. Dis. 34:1061–1066.
21. Brunden, M. N., G. E. Zurenko, and B. Kapik. 1992. Modification of the
error-rate bounded classification scheme for use with two MIC break
points. Diagn. Microbiol. Infect. Dis. 15:135–140.
22. Chien, S.-C., M. C. Rogge, L. G. Gibson, C. Curtin, F. Wong, J. Natarajan,
R. R. Williams, C. L. Fowler, W. K. Cheung, and A. Chow. 1997. Pharma-
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
405
cokinetic profile of levofloxacin following once-daily 500-milligram oral and
intravenous doses. Antimicrob. Agents Chemother. 41:2256–2260.
Chitwood, L. A. 1969. Tube dilution antimicrobial susceptibility testing:
efficacy of a microtechnique applicable to diagnostic laboratories. Appl.
Microbiol. 17:707–709.
Clinical and Laboratory Standards Institute. 2001. Development of in vitro
susceptibility testing criteria and quality control parameters; approved
guideline—2nd ed. CLSI document M23-A2. CLSI, Wayne, PA.
Clinical and Laboratory Standards Institute. 2004. Methods for antimicrobial susceptibility testing of anaerobic bacteria; approved standard—6th ed.
CLSI document M11-A6. CLSI, Wayne, PA.
Clinical and Laboratory Standards Institute. 2006. Performance standards
for antimicrobial disk susceptibility tests; approved standard—9th ed. CLSI
document M2-A9. CLSI, Wayne, PA.
Clinical and Laboratory Standards Institute. 2006. Methods for dilution
antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard—7th ed. CLSI document M7-A7. CLSI, Wayne, PA.
Clinical and Laboratory Standards Institute. 2007. Performance standards
for antimicrobial susceptibility testing; 16th informational supplement.
CLSI document M100-S17. CLSI, Wayne, PA.
Comité de l’Antibiogramme de la Société Française de Microbiologie. February 2006, accession date.Communiqué 005. Société Française de Microbiologie, Paris, France. www.sfm.asso.fr.
Commissie Richtlijnen Gevoelighheidsbepalingen. 1996. Standaadisatie
van gevoelighheidsbepalingen. Ned. Tijschr. Med. Microbiol. 4:104–106.
Commissie Richtlijnen Gevoelighheidsbepalingen. 2000. Interpretie van
gevoelighheidsonderzoek en gevoelighheidscriteria voor antibacteriële
middelen in Nederland. Ned. Tijdschr. Med. Microbiol. 8:79–81.
Craig, B. A. 2000. Modeling approach to diameter breakpoint determination. Diagn. Microbiol. Infect. Dis. 36:193–202.
Craig, W. A., and S. C. Ebert. 1991. Killing and regrowth of bacteria in
vitro: a review. Scand. J. Infect. Dis. 74(Suppl.):63–70.
Craig, W. A., Y. Watanabe, and S. Ebert. 1992. AUC/MIC ratio is the
unifying parameter for comparison of the in vivo activity among aminoglycosides, abstr. 49. Abstr. 32nd Intersci. Conf. Antimicrob. Agents Chemother. American Society for Microbiology, Washington, DC.
Craig, W. A., S. Ebert, and Y. Watanabe. 1993. Differences in time above
MIC required for efficacy of beta-lactams in animal infection models, abstr.
86. Abstr. 33rd Intersci. Conf. Antimicrob. Agents Chemother. American
Society for Microbiology, Washington, DC.
Craig, W. A. 1993. Qualitative susceptibility tests versus quantitative MIC
tests. Diagn. Microbiol. Infect. Dis. 16:231–236.
Craig, W. A. 1995. Interrelationship between pharmacokinetics and pharmacodynamics in determining dosage regimens for broad-spectrum cephalosporins. Diagn. Microbiol. Infect. Dis. 22:89–96.
Craig, W. A., and D. Andes. 1996. Pharmacokinetics and pharmacodynamics of antibiotics in otitis media. Pediatr. Infect. Dis. J. 15:255–259.
Craig, W. A. 1996. Antimicrobial resistance issues of the future. Diagn.
Microbiol. Infect. Dis. 25:213–217.
Craig. W. A., and S. Gudmundsson. 1996. Postantibiotic effect, p. 296–329.
In V. Lorian (ed.), Antibiotics in laboratory medicine, 4th ed. Williams and
Wilkins, Baltimore, MD.
Craig, W. A. 1998. Pharmacokinetic/pharmacodynamic parameters: rationale for antibacterial dosing of mice and men. Clin. Infect. Dis. 26:1–12.
Crump, J. A., T. J. Barrett, J. T. Nelson, and F. J. Angulo. 2003. Reevaluating fluoroquinolone breakpoints for Salmonella enterica serotype Typhi
and for non-Typhi salmonellae. Clin. Infect. Dis. 37:75–81.
Davies, T. A., A. Evangelista, S. Pfleger, K. Bush, D. F. Sahm, and R.
Goldschmidt. 2002. Prevalence of single mutations in topoisomerase II
genes among levofloxacin-susceptible clinical strains of Streptococcus pneumoniae isolated in the United States in 1992 to 1996 and 1999 to 2000.
Antimicrob. Agents Chemother. 46:119–124.
Deutches Institut für Normung. 2002. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 3. Agar diffusion test. DIN
document 58940-. Beuth Verlag GmbH, Berlin, Germany.
Deutches Institut für Normung. 2000. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 3. Agar diffusion test—data for
the interpretation of inhibition zone diameters. DIN document 58940supplement 1. Beuth Verlag GmbH, Berlin, Germany.
Deutches Institut für Normung. 1989. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 3. Agar diffusion test—zone
diameters with control strains. DIN document 58940-supplement 2. Beuth
Verlag GmbH, Berlin, Germany.
Deutches Institut für Normung. 2002. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 4. Evaluation classes of the
minimum inhibitory concentration. DIN document 58940-. Beuth Verlag
GmbH, Berlin, Germany.
Deutches Institut für Normung. 2004. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 4. Evaluation classes of the
minimum inhibitory concentration—MIC breakpoints of antibacterial
agents. DIN document 58940-supplement 1. Beuth Verlag GmbH, Berlin,
Germany.
406
TURNIDGE AND PATERSON
49. Deutches Institut für Normung. 2003. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 6. Determination of the minimum inhibitory concentration (MIC) with the agar dilution method. DIN
document 58940-. Beuth Verlag GmbH, Berlin, Germany.
50. Deutches Institut für Normung. 1989. Medical microbiology—susceptibility testing of pathogens to antimicrobial agents. 6. Determination of
the minimum inhibitory concentration (MIC) with the agar dilution
method—MICs of agents with control strains for the agar dilution
method. DIN document 58940-supplement 1. Beuth Verlag GmbH, Berlin, Germany.
51. Deutches Institut für Normung. 2002. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 81. Microdilution—special
requirements for testing non-fastidious bacteria. DIN document 58940-1 1.
Beuth Verlag GmbH, Berlin, Germany.
52. Deutches Institut für Normung. 2002. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 82. Microdilution—special
requirements for testing fastidious bacteria. DIN document 58940-1. Beuth
Verlag GmbH, Berlin, Germany.
53. Deutches Institut für Normung. 2002. Medical microbiology—susceptibility
testing of pathogens to antimicrobial agents. 83. Microdilution—special
requirements for testing strictly anaerobic bacteria. DIN document
58940-3. Beuth Verlag GmbH, Berlin, Germany.
54. Deutches Institut für Normung. 2002. Medical microbiology—susceptibility testing of pathogens to antimicrobial agents. 10. Criteria for the
evaluation of the in vitro efficacy and the admission of new antimicrobial
agents. DIN document 58940-10. Beuth Verlag GmbH, Berlin, Germany.
55. Doern, G. V. 1995. The in vitro activity of cefotaxime versus bacteria
involved in selected infections of hospitalized patients outside the intensive
care unit. Diagn. Microbiol. Infect. Dis. 22:13–17.
56. Drusano, G. L. 1988. Role of pharmacokinetics in the outcome of infections. Antimicrob. Agents Chemother. 32:289–297.
57. Drusano, G. L., S. L. Preston, C. Hardalo, R. Hare, C. Banfield, D. Andes,
O. Vesga, and W. A. Craig. 2001. Use of preclinical data for selection of a
phase II/III dose for evernimicin and identification of a preclinical MIC
breakpoint. Antimicrob. Agents Chemother. 45:13–22.
58. Drusano, G. L. 2004. Antimicrobial pharmacodynamics: critical interactions
of ‘bug and drug’. Nat. Rev. Microbiol. 2:289–300.
59. Drusano, G. L., S. L. Preston, C. Fowler, M. Corrado, B. Weisenger, and J.
Kahn. 2004. Relationship between fluoroquinolone area under the curve:
minimum inhibitory concentration ratio and the probability of eradication
of the infecting pathogen, in eradication of the infecting pathogen, in
patients with nosocomial pneumonia. J. Infect. Dis. 189:1590–1597.
60. Dudley, M. N., and P. G. Ambrose. 2000. Pharmacodynamics in the study of
drug resistance and establishing in vitro susceptibility breakpoints: ready for
prime time. Curr. Opin. Microbiol. 3:515–521.
61. Eagle, H., R. Fleischman, and M. Levy. 1953. Continuous versus discontinuous therapy with penicillin: the effect of interval between injections on
therapeutic efficacy. N. Engl. J. Med. 248:481–488.
62. Ellner, P. D., and H. C. Neu. 1981. The inhibitory quotient. A method for
interpreting minimum inhibitory concentration data. JAMA 246:1575–1578.
63. Ericsson, H., and J. C. Sherris. 1971. Antibiotic sensitivity testing. Report
of an international collaborative study. Acta Pathol. Microbiol. Scand.
217(Suppl. B):1–90.
64. European Committee for Antimicrobial Susceptibility Testing (EUCAST)
of the European Society of Clinical Microbiology and Infectious Diseases
(ESCMID). 2000. Determination of antimicrobial susceptibility test breakpoints. Clin. Microbiol. Infect. 6:570–572.
65. European Committee for Antimicrobial Susceptibility Testing (EUCAST)
of the European Society of Clinical Microbiology and Infectious Diseases
(ESCMID). 2000. Determination of minimum inhibitory concentrations
(MICs) of antibacterial agents by agar dilution. Clin. Microbiol. Infect.
6:509–515.
66. European Committee for Antimicrobial Susceptibility Testing (EUCAST)
of the European Society of Clinical Microbiology and Infectious Diseases
(ESCMID). 2000. Terminology relating to methods for the determination
of susceptibility of bacteria to antimicrobial agents. Clin. Microbiol. Infect.
6:503–508.
67. European Committee for Antimicrobial Susceptibility Testing (EUCAST)
of the European Society of Clinical Microbiology and Infectious Diseases
(ESCMID). 2000. Determination of minimum inhibitory concentrations
(MICs) of antibacterial agents by broth dilution. Clin. Microbiol. Infect.
9:1–7.
68. Falcó, V., B. Almirante, Q. Jordano, L. Calonge, O. del Valle, C. Pigrau,
A. M. Planes, J. Gavaldà, and A. Pahissa. 2004. Influence of penicillin
resistance on outcome in adult patients with invasive pneumococcal pneumonia: is penicillin useful against intermediately resistant strains? J. Antimicrob. Chemother. 54:481–488.
69. Firsov, A. A., S. N. Vostrov, I. Y. Lubenko, K. Drlica, Y. A. Portnoy, and
S. H. Zinner. 2003. In vitro pharmacodynamic evaluation of the mutant
selection window hypothesis using four fluoroquinolones against Staphylococcus aureus. Antimicrob. Agents Chemother. 47:1604–1613.
CLIN. MICROBIOL. REV.
70. Fleming, A. 1929. On the antibacterial action of cultures of a penicillium,
with special reference to their use in the isolation of B. influenzae. Br. J.
Exp. Pathol. 10:226–236.
71. Forrest, A., D. E. Nix, C. H. Ballow, T. F. Goss, M. C. Birmingham, and J. J.
Schentag. 1993. Pharmacodynamics of intravenous ciprofloxacin in seriously ill patients. Antimicrob. Agents Chemother. 37:1073–1081.
72. Forrest, A., S. Chodosh, M. A. Amantea, D. A. Collins, and J. J. Schentag.
1997. Pharmacokinetics and pharmacodynamics of oral grepafloxacin in
patients with acute bacterial exacerbations of chronic bronchitis. J. Antimicrob. Chemother. 40(Suppl. A):45–57.
73. Franklin, C., L. Liolios, and A. Y. Peleg. 2006. Phenotypic detection of
carbapenem-susceptible metallo-␤-lactamase-producing gram-negative bacilli in the clinical laboratory. J. Clin. Microbiol. 44:3139–3144.
74. Frimodt-Møller, N. 2002. Correlation between pharmacokinetic/pharmacodynamic parameters and efficacy for antibiotics in the treatment of urinary
tract infection. Int. J. Antimicrob. Agents 19:546–553.
75. Gehanno, P., G. Lenoir, and P. Berche. 1995. In vivo correlates for Streptococcus pneumoniae penicillin resistance in acute otitis media. Antimicrob.
Agents Chemother. 39:271–272.
76. Gerber, A. U., A. P. Vastola, J. Brandel, and W. A. Craig. 1982. Selection of
aminoglycoside-resistant variants of Pseudomonas aeruginosa in an in vivo
model. J. Infect. Dis. 146:691–697.
77. Gupta, K., T. M. Hooton, and W. E. Stamm. 2001. Increasing antimicrobial
resistance and the management of uncomplicated community-acquired urinary tract infections. Ann. Int. Med. 135:41–50.
78. International Organization for Standards. 15 November 2006, posting
date. Susceptibility testing of infectious agents and evaluation of performance of antimicrobial susceptibility testing devices. 1. Reference method
for testing the in vitro activity of antimicrobial agents against rapidly growing anaerobic bacteria involved in infectious diseases. ISO 20776-1. International Organization for Standards, Geneva, Switzerland. http://www.iso
.org/iso/en/CatalogueDetailPage.CatalogueDetail?CSNUMBER⫽41630.
79. Japanese Society for Chemotherapy. 1990. Method for the determination of
minimum inhibitory concentration (MIC) of aerobic bacteria by microdilution method. Chemotherapy (Tokyo) 38:102–105.
80. Japanese Society for Chemotherapy. 1993. Method for the determination of
minimum inhibitory concentration (MIC) of fastidious bacteria and anaerobic bacteria by microdilution method. Chemotherapy (Tokyo) 41:183–189.
81. Kahlmeter, G. 16 October 2006, accession date. EUCAST procedure for
harmonising and defining breakpoints. EUCAST, Basel, Switzerland. http:
//www.srga.org/EUCAST/bpsetting.htm.
82. Kahlmeter, G., D. F. J. Brown, F. W. Goldstein, A. P. MacGowan, J. W.
Mouton, A. Österland, A. Rodloff, M. Steinbakk, P. Urbaskova, and A.
Vatopoulos. 2003. European harmonisation of MIC breakpoints for antimicrobial susceptibility testing of bacteria. J. Antimicrob. Chemother. 52:
145–148.
83. Kang, C.-I., S.-H. Kim, W. B. Park, K.-D. Lee, H.-B. Kim, E.-C. Kim,
M.-Y.Oh, and K.-W. Choe. 2004. Bloodstream infections due to extendedspectrum ␤-lactamase-producing Escherichia coli and Klebsiella pneumoniae: risk factors for mortality and treatment outcome, with special
emphasis on antimicrobial therapy. Antimicrob. Agents Chemother. 48:
4574–4581.
84. Kaplan, S. L. 2002. Management of pneumococcal meningitis. Pediatr.
Infect. Dis. J. 21:589–592.
85. Kashuba, A. D. M., A. N. Nafziger, G. L. Drusano, and J. S. Bertino. 1999.
Optimizing aminoglycoside therapy for nosocomial pneumonia. Antimicrob. Agents Chemother. 43:623–629.
86. Kellner, J. D., D. W. Scheifele, S. A. Halperin, M. C. Lebel, D. Moore, N. Le
Saux, E. L. Ford-Jones, B. Law, W. Vaudry, and Other Members of the
Canadian Paediatric Society/Centre for Infectious Disease Prevention and
Control, Immunization Monitoring Program. 2002. Outcome of penicillinnonsusceptible Streptococcus pneumoniae meningitis: a nested case-control
study. Pediatr. Infect. Dis. J. 21:903–909.
87. Kerrn, M. B., N. Frimodt-Møller, and F. Espersen. 2003. Effects of sulfamethizole and amdinocillin against Escherichia coli strains (with various
susceptibilities) in an ascending urinary tract infection mouse model. Antimicrob. Agents Chemother. 47:1002–1009.
88. Knudsen, J. D., K. Fuursted, F. Espersen, and N. Frimodt-Møller. 1997.
Activities of vancomycin and teicoplanin against penicillin-resistant
pneumococci in vitro and in vivo and correlation to pharmacokinetics
parameters in the mouse peritonitis model. Antimicrob. Agents Chemother. 41:1910–1915.
89. Knudsen, J. D., K. Fuursted, S. Raber, F. Espersen, and N. FrimodtMøller. 2000. Pharmacodynamics of glycopeptides in the mouse peritonitis
model of Streptococcus pneumoniae or Staphylococcus aureus infection.
Antimicrob. Agents Chemother. 44:1247–1254.
90. Koeth, L. M., A. King, H. Knight, J. May, L. A. Miller, I. Phillips, and J. A.
Poupard. 2000. Comparison of cation-adjusted Mueller-Hinton broth with
Iso-Sensitest broth for the NCCLS broth microdilution method. J. Antimicrob. Chemother. 46:369–376.
91. Kronvall, G., G. Kahlmeter, E. Myrne, and M. F. Galas. 2003. A new
VOL. 20, 2007
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
SETTING ANTIBACTERIAL SUSCEPTIBILITY BREAKPOINTS
method for normalized interpretation of antimicrobial resistance from disk
test results for comparative purposes. Clin. Microbiol.Infect.9:120–132.
Kronvall, G. 2003. Determination of the real standard distribution of susceptible strains in zone histograms. Int. J. Antimicrob. Agents 22:7–13.
Kronvall, G., I. Karlsson, M. Walder, M. Sörberg, and L. E. Nisson. 2006.
Epidemiological MIC cut-off values for tigecycline calculated from Etest
values using normalized resistance interpretation. J. Antimicrob. Chemother. 57:498–505.
Leggett, J. E., B. Fantin, S. Ebert, K. Totsuka, B. Vogelman, W. Calame, H.
Mattie, and W. A. Craig. 1989. Comparative antibiotic dose-effect relations
at several dosing intervals in murine pneumonitis and thigh-infection models. J. Infect. Dis. 159:281–282.
MacGowan, A., and R. Wise. 2001. Establishing MIC breakpoints and the
interpretation of in vitro susceptibility tests. J. Antimicrob. Chemother.
48(Suppl. S1):17–28.
MacGowan, A., C. Rogers, and K. Bowker. 2003. In vitro models, in vivo
models, and pharmacokinetics: what can we learn from in vitro models?
Clin. Infect. Dis. 33(Suppl. 3):S214–S220.
McDonald, P. J., B. H. Wetherall, and H. Pruul. 1981. Postantibiotic leukocyte enhancement: increased susceptibility of bacteria pretreated with
antibiotics to activity of leukocytes. Rev. Infect. Dis. 3:38–44.
Mesa Española de Normalización de la Sensibilidad y Resistencia a
los Antimicrobianos (MENSURA). 2000. Recommedaciones del grupo
MENSURA para la selecciónde antimicrobianos en el studio de la sensibilidad y criterios para la interpretacióndel antibiograma. Rev. Esp. Quimioter. 13:73–86.
Metzler, C. M., and R. M. DeHaan. 1974. Susceptibility tests of anaerobic
bacteria: statistical and clinical considerations. J. Infect. Dis. 30:88–594.
Miller, L. G., and A. W. Tang. 2004. Treatment of uncomplicated urinary
tract infections in an era of increasing antimicrobial resistance. Mayo Clin.
Proc. 79:1048–1054.
Moise, P. A., A. Forrest, S. M. Bhavnani, M. C. Birmingham, and J. J.
Schentag. 2000. Area under the inhibitory curve and a pneumonia scoring
system for predicting outcomes of vancomycin therapy for respiratory infections by Staphylococcus aureus. Am. J. Hosp. Pharm. 57(Suppl. 2):S4–S9.
Moise-Broder, P. A., A. Forrest, M. C. Birmingham, and J. J. Schentag.
2004. Pharmacodynamics of vancomycin and other antimicrobials in patients with Staphylococcus aureus lower respiratory tract infections. Clin.
Pharmacokinet. 43:925–942.
Moore, R. D., P. S. Lietman, and C. R. Smith. 1987. Clinical response to
aminoglycoside therapy: importance of the ratio of peak concentration to
minimum inhibitory concentration. J. Infect. Dis. 155:93–99.
Mouton, J. W., J. E. Degener, B. van Klingeren, A. J. de Neeling, and
Commissie Richtlijnen Gevoelighheidsbepalingen. 2000. Het vastellen van
gevoelighehidscriteria voor antibcateriële middelen in Nederland: verleden,
heden en toekomst. Ned. Tijdschr. Med. Microbiol.8:73–78.
Mouton, J. W. 2003. Impact of pharmacodynamics on breakpoint selection
for susceptibility testing. Infect. Dis. Clin. N. Am. 17:579–598.
Odenholt Tornqvist, I., S. E. Holm, and O. Cars. 1991. Pharmacodynamic
effects of subinhibitory antibiotic concentrations. Scand. J. Infect. Dis.
74(Suppl.):94–101.
Olivier, C., R. Cohen, P. Begué, and D. Floret. 2000. Bacteriologic outcome
of children with cefotaxime- or ceftriaxone-susceptible and -nonsusceptible
Streptococcus pneumoniae meningitis. Pediatr. Infect. Dis. J. 19:1015–1017.
Pallares, R., J. Liñares, M. Vadillo, C. Cabellos, F. Manresa, P. F.
Viladrich, R. Martin, and F. Gudiol. 1995. Resistance to penicillin and
cephalosporin and mortality from severe pneumococcal pneumonia in Barcelona, Spain. N. Engl. J. Med. 333:474–480.
Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev. 18:657–686.
Paterson, D. L., W.-C. Ko, A. Von Gottberg, J. M. Casellas, L. Mulazimoglu, K. P. Klugman, R. A. Bonomo, L. B. Rice, J. G. McCormack, and V. L.
Yu. 2001. Outcome of cephalosporin treatment for serious infections due to
apparently susceptible organisms producing extended-spectrum beta-lactamases: implications for the clinical laboratory. J. Clin. Microbiol. 39:2206–
2212.
Preston, S. L., G. L. Drusano, A. L. Berman, C. L. Fowler, A. T. Chow, B.
Dornseif, V. Reichl, J. Natarajan, and M. Corrado. 1998. Pharmacodynamics of levofloxacin: a new paradigm for early clinical trials. JAMA 279:125–
129.
Rasheed, J. K., and F. C. Tenover. 2003. Detection and characterization of
antimicrobial resistance genes in bacteria, p. 1196–1212. In P. R. Murray,
E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.), Manual
of clinical microbiology, 8th ed., vol. 1. ASM Press, Washington, DC.
Raz, R., B. Chazan, Y. Kennes, R. Colodner, E. Rottensterrich, M. Dan, W.
Stamm, and the Israeli Urinary Tract Infection Group. 2002. Empiric use
of trimethoprim-sulfamethoxazole (TMP-SMX) in the treatment of women
with uncomplicated urinary tract infections, in a geographical area with a
high prevalence of TMP-SMX-resistant uropathogens. Clin. Infect. Dis.
24:1165–1169.
Rosco Diagnostica. 2005–2006. User’s guide. Neo-Sensitabs susceptibility
testing, 17th ed. Rosco Diagnostica A/C, Taastrup, Denmark.
407
115. Saito, A. 1995. Clinical breakpoints for antimicrobial agents in pulmonary
infections and sepsis: report of the Committee for Japanese Standards for
Antimicrobial Susceptibility Testing of Bacteria. J. Infect. Chemother.
1:83–88.
116. Saito, A., T. Inamatsu, J. Okada, T. Oguri, H. Kanno, N. Kusano, H.
Kumon, K. Yamaguchi, A. Watanabe, and K. Watanabe. 1999. Clinical
breakpoints in pulmonary infections and sepsis: new antimicrobial agents
and supplemental information for some agents already released. J. Infect.
Chemother. 5:223–226.
117. Sakoulas, G., P. A. Moise-Broder, J. Schentag, A. Forrest, R. C. Moellering,
Jr., and G. M. Eliopoulos. 2004. Relationship of MIC and bactericidal
activity to efficacy of vancomycin for treatment of methicillin-resistant
Staphylococcus aureus bacteremia. Antimicrob. Agents Chemother.
42:2398–2402.
118. Schentag, J. J., I. L. Smith, D. J. Swanson, C. DeAngelis, J. E. Fracasso, A.
Vari, and J. W. Vance. 1984. Role of dual individualization with cefmenoxime. Am. J. Med. 77:43–50.
119. Sirot, J., P. Courvalin, and C.-J. Soussy. 1996. Definition and determination of in vitro antibiotic susceptibility breakpoints for bacteria. Clin.
Microbiol. Infect. 2(Suppl. 1):S5–S10.
120. Snydman, D. R., G. J. Cuchural, L. McDermott, and M. Gill. 1992. Correlation of various in vitro testing methods with clinical outcomes in patients with Bacteroides fragilis group infections treated with cefoxitin: a
retrospective study. Antimicrob. Agents Chemother. 36:540–544.
121. Sociedad Españolade Enfermedades Infecciosas y Microbiologı́a Clı́nica.
2000. Procedimientos en microbiologı́a clı́nica: métados básicos para el
estudio de la sensibilidad a los antimicrobianos. Sociedad Españolade Enfermedades Infecciosas y Microbiologı́a Clı́nica, Madrid, Spain. http://www
.seimc.org/protocolos/microbiologia/.
122. Stamey, T. A., W. R. Fair, M. M. Timothy, M. A. Millar, G. Mihara, and
Y. C. Lowery. 1974. Serum versus urinary antimicrobial concentrations in
cure of urinary-tract infections. N. Engl. J. Med. 291:1159–1163.
123. Swedish Reference Group on Antibiotics. 11 February 2004, revision date.
The principles behind SRGA breakpoints. Swedish Reference Group on
Antibiotics, Vaxjo, Sweden. www.srga.org. Accessed 5 February 2006.
124. Swenson, J. M., J. F. Hindler, and J. H. Jorgensen. 2003. Special phenotypic methods for detecting antibacterial resistance, p. 1178–1195. In P. R.
Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.),
Manual of clinical microbiology, 8th ed., vol. 1. ASM Press, Washington,
DC.
125. Szabó, D., R. A. Bonomo, F. Silveira, A. W. Pasculle, C. Baxter, P. K.
Linden, A. M. Hujer, K. M. Hujer, K. Deeley, and D. L. Paterson. 2005.
SHV-type extended-spectrum beta-lactamase production is associated with
reduced cefepime susceptibility in Enterobacter cloacae. J. Clin. Microbiol.
43:5058–5064.
126. Tam, V. H., P. S. McKinnon, R. L. Akins, M. L. Ryback, and G. L. Drusano.
2002. Pharmacodynamics of cefepime in patients with gram-negative infections. J. Antimicrob. Chemother. 50:425–428.
127. Tam, V. H., P. S. McKinnon, R. L. Akins, G. L. Drusano, and M. L. Ryback.
2003. Pharmacokinetics and pharmacodynamics of cefepime in patients
with various degrees of renal function. Antimicrob. Agents Chemother.
47:1853–1861.
128. Turnidge, J. D. 1998. The pharmacodynamics of ␤-lactams. Clin. Infect.
Dis. 27:10–22.
129. Turnidge, J. 1999. Pharmacokinetics and pharmacodynamics of fluoroquinolones. Drugs 58(Suppl. 2):29–36.
130. Turnidge, J. D., and J. M. Bell. 2005. Antimicrobial susceptibility on solid
media, p. 8–60. In V. Lorian (ed.), Antibiotics in laboratory medicine, 5th
ed. Lippincott Williams & Wilkins, Philadelphia, PA.
131. Turnidge, J., and G. Bordash. 2007. Statistical methods for establishing
quality control ranges for antibacterial agents in Clinical and Laboratory
Standards Institute susceptibility testing. Antimicrob. Agents Chemother.
51:2483–2488.
132. Turnidge, J., G. Kahlmeter, and G. Kronvall. 2006. Statistical characterisation of bacterial wild-type MIC value distributions and the determination
of epidemiological cut-off values. Clin. Microbiol. Infect. 12:418–425.
133. Van Wart, S., L. Phillips, E. A. Ludwig, R. Russo, D. A. Gajjar, A. Bello,
P. G. Ambrose, C. Costanzo, T. H. Grasela, R. Echols, and D. M. Grasela.
2004. Population pharmacokinetics of garenoxacin in patients with community-acquired respiratory tract infections. Antimicrob. Agents Chemother.
48:4766–4777.
134. Vogelman, B., S. Gudmundsson, J. Turnidge, J. Leggett, and W. A. Craig.
1988. In vivo postantibiotic effect in a thigh infection in neutropenic mice.
J. Infect. Dis. 157:287–298.
135. Vogelman, B., S. Gudmundsson, J. Leggett, J. Turnidge, S. Ebert, and W. A.
Craig. 1988. Correlation of antimicrobial pharmacokinetic parameters with
therapeutic efficacy in an animal model. J. Infect. Dis. 158:831–847.
136. Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo␤-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306–325.
137. Watanabe, Y., S. Ebert, and W. Craig. 1992. AUC/MIC ratio is the unifying
parameter for comparison of the in-vivo activity among fluoroquinolones,
408
138.
139.
140.
141.
TURNIDGE AND PATERSON
abstr. 42. Abstr. 32nd Intersci. Conf. Antimicrob. Agents Chemother.
American Society for Microbiology, Washington, DC.
Werkgroep Richtlijnen Gevoelighheidsbepalingen. 1981. Standaadisatie
van gevoelighheidsbepalingen. RIVM, Bilthoven, The Netherlands.
Werkgroep Richtlijnen Gevoelighheidsbepalingen. 1990. Standaadisatie
van gevoelighheidsbepalingen, supplement e. RIVM, Bilthoven, The Netherlands.
Werkgroep Richtlijnen Gevoelighheidsbepalingen. 1991. Standaadisatie
van gevoelighheidsbepalingen, supplement e, bijlage. RIVM, Bilthoven,
The Netherlands.
Wikler, M. A., and P. G. Ambrose. 2005. The breakpoint, p. 1–7. In V.
CLIN. MICROBIOL. REV.
Lorian (ed.), Antibiotics in laboratory medicine, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA.
142. Yu, V. L., C. C. C. Chiou, C. Feldman, A. Ortqvist, J. Rello, A. J. Morris,
L. M. Baddour, C. M. Luna, D. R. Snydman, M. Ip, W. C. Ko, B. F. Chedid,
A. Andremont, and K. Klugman. 2003. An international prospective study
of pneumococcal bacteremia: correlation with in vitro resistance, antibiotics
administered, and clinical outcome. Clin. Infect. Dis. 37:320–327.
143. Zelenitsky, S. A., G. K. Harding, S. Sun, K. Ubhi, and R. E. Ariano.
2003. Treatment and outcome of Pseudomonas aeruginosa bacteraemia:
an antibiotic pharmacodynamic analysis. J. Antimicrob. Chemother. 52:
668–674.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 409–425
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00041-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Ventilator-Associated Pneumonia in Neonatal and Pediatric
Intensive Care Unit Patients
Elizabeth Foglia, Mary Dawn Meier, and Alexis Elward*
Division of Infectious Diseases, Department of Pediatrics, Washington University School of Medicine, St. Louis, Missouri
INTRODUCTION .......................................................................................................................................................409
OUTCOMES................................................................................................................................................................410
Recommendations for Current Practice and Future Research ........................................................................411
DIAGNOSIS ................................................................................................................................................................411
Clinical Criteria ......................................................................................................................................................411
Invasive Testing in Adults .....................................................................................................................................412
Invasive Testing in Children .................................................................................................................................413
Computerized Surveillance ....................................................................................................................................413
Recommendations for Current Practice and Future Research ........................................................................414
MICROBIOLOGY ......................................................................................................................................................414
RISK FACTORS FOR VAP IN NICU PATIENTS ................................................................................................414
RISK FACTORS FOR VAP IN PICU PATIENTS.................................................................................................415
Recommendations for Current Practice and Future Research ........................................................................415
PREVENTION.............................................................................................................................................................416
Head-of-Bed Elevation............................................................................................................................................416
In-Line Suctioning ..................................................................................................................................................416
H2 Blockers/Sucralfate ...........................................................................................................................................416
Hand Hygiene ..........................................................................................................................................................417
Selective Decontamination.....................................................................................................................................417
Oral Hygiene............................................................................................................................................................419
The Bundle Approach ............................................................................................................................................419
Educational Interventions......................................................................................................................................419
Recommendations for Current Practice and Future Research ........................................................................420
VAP TREATMENT .....................................................................................................................................................420
Empirical Therapy ..................................................................................................................................................420
Specific Treatment ..................................................................................................................................................422
Duration of Therapy...............................................................................................................................................423
Recommendations for Current Practice and Future Research ........................................................................423
CONCLUSION............................................................................................................................................................423
REFERENCES ............................................................................................................................................................423
The most recent National Nosocomial Infection Surveillance
(NNIS) data from 2002 to 2004 show NICU VAP rates ranging
from 1.4 to 3.5 per 1,000 ventilator days (68). In 1998, a crosssectional study of hospital-acquired infections in 50 children’s
hospitals was performed by the Pediatric Prevention Network
(88). Of 43 children’s hospitals that returned questionnaires
reporting NICU and PICU surveillance data, the VAP rate by
device days was reported by 19 hospitals, and 12 hospitals
provided VAP rates stratified by birth weight groups (Table 1).
In this cross-sectional survey, VAP rates were highest for the
1,001- to 1,500-g and ⬍1,000-g birth weight categories.
Differences in study methodology and case mix can influence
the reported incidence of VAP (6). Surveillance methods differ
across study institutions, introducing variability into the reported incidence of VAP. The influence of surveillance intensity on the reported prevalence of nosocomial infections is
illustrated by a 41-month surveillance study in a children’s
hospital. Infection control surveillance was conducted twice a
week for the first 2 years of the study and then daily for the
second 2 years of the study through a nursing sentinel sheet.
Those investigators found a 50% increase in the incidence of
INTRODUCTION
Ventilator-associated pneumonia (VAP) is pneumonia in
mechanically ventilated patients that develops later than or
at 48 h after the patient has been placed on mechanical
ventilation. VAP is the second most common hospital-acquired infection among pediatric and neonatal intensive
care unit (ICU) (NICU) patients (41, 43). Overall, VAP
occurs in 3 to 10% of ventilated pediatric ICU (PICU)
patients (1, 28). Surveillance studies of nosocomial infections in NICU patients indicate that pneumonia comprises
6.8 to 32.3% of nosocomial infections in this setting (26, 39,
48). The incidence of VAP is higher in adult ICU patients,
ranging from 15 to 30% (8, 31, 50, 70, 90).
NICU VAP rates vary by birth weight category as well as
by institution. Two large studies are summarized in Table 1.
* Corresponding author. Mailing address: Pediatric Infectious Diseases, Washington University School of Medicine, Box 8116, St. Louis
Children’s Hospital, One Children’s Place, St. Louis, MO 63110.
Phone: (314) 454-6050. Fax: (314) 454-2836. E-mail: Elward_A@kids
.wustl.edu.
409
410
FOGLIA ET AL.
CLIN. MICROBIOL. REV.
TABLE 1. VAP rates stratified by birth weighta
Range (median) of VAP rates by birth weight (g) of:
Study
b
NNIS
Stoverc
a
b
c
Source
86–102 high-risk nurseries
12 NICUs
ⱕ1,000
1,001–1,500
1,501–2,500
⬎2,500
0.0–8.5 (2.4)
0.0–21.2 (3.5)
0.0–8.0 (0.0)
0.0–34.5 (4.9)
0.0–6.1 (0.0)
0.0–13.7 (1.1)
0.0–3.2 (0.0)
0.0–6.0 (0.9)
Range given is the 10th to 90th percentile for NNIS data.
See reference 68.
See reference 88.
reported nosocomial infections following the introduction of
daily surveillance (39).
NNIS definitions for VAP were revised in 2002, resulting in
a more stringent definition of VAP. Studies of VAP incorporating these revised definitions reported lower rates of VAP,
making it difficult to know if VAP was previously overdiagnosed or is now underdiagnosed. The revised definitions must
also be considered when VAP rates are compared over time.
Applying the Centers for Disease Control and Prevention
(CDC) definitions for VAP in low-birth-weight infants introduces additional complexity in defining the incidence of VAP.
CDC definitions for VAP exist for infants ⬍1 year of age,
but there are no specific definitions for low- or very-lowbirth-weight infants. These patients often have comorbidities such as bronchopulmonary dysplasia, hyaline membrane
disease, bloodstream infections (BSIs), and necrotizing enterocolitis that obscure clinical, laboratory, and radiographic evidence of VAP.
OUTCOMES
VAP is associated with increased morbidity in PICU patients, specifically, a longer duration of mechanical ventilation.
Fischer et al. (34) performed a prospective cohort study to
determine the delay of extubation attributable to VAP among
neonates and children undergoing repair of congenital heart
disease. Twenty-six of the 272 patients enrolled over a 22month period developed VAP (9.6%). VAP diagnosis was
made when the following criteria were met: fever exceeding
38.5°C, tachypnea and/or otherwise unexplained increased oxygen requirement, elevated white blood cell count (⬎15 ⫻ 109
cells/liter), a cultured pathogen from tracheal aspirate together
with a positive gram stain, and increased leukocyte contents,
plus an infiltrate on chest radiographs persisting for 48 h or
more (29). Using a Cox proportional hazards model to control
for complexity of surgery, other respiratory complications, and
secondary surgeries, those investigators found that the median
delay of extubation attributable to VAP was 3.7 days (average
of 5.2 versus 1.5 for patients with and without VAP, respectively). VAP rates increased dramatically for patients intubated for long periods of time. Among patients extubated
within the first 3 days of surgery, only 4% developed VAP,
compared to 40% of postoperative cardiothoracic surgery patients intubated longer than 30 days (34). Of the 26 VAP cases,
19 occurred within the first 3 to 6 days after surgery.
Presumed VAP is also associated with additional resource
utilization with respect to antibiotic administration. VAP is the
most common reason for the initiation of empirical antibiotics
among PICU patients. A prospective cohort study at an aca-
demic tertiary care center performed in a PICU (n ⫽ 456)
found that over half (56.6%) of all patients (n ⫽ 258) received
antibiotics (33). Treatment for suspected VAP comprised 616
of 1,303 (47%) of the antibiotic treatment days. Those authors
reviewed medical records to determine whether patients had
evidence of an alternative explanation for the symptoms attributed to VAP, such as a viral infection. For 40% of the antibiotic days (552/1,303 treatment days), patients were classified as
having no infection (i.e., did not meet clinical criteria as defined by the CDC) or as having a viral infection. Those authors
concluded that an intervention targeted at decreasing antibiotic use for VAP would have the greatest impact on antibiotic use.
In pediatric populations, the published data are unmatched
for severity of illness and univariate but suggest that pediatric
patients with VAP may have excess mortality and length of
PICU and NICU stay. The European Multicenter Trial examined the epidemiology of hospital-acquired infections in 20
units (5 PICUs, 7 neonatal units, 2 hematology-oncology units,
and 8 general pediatric units) in eight countries, with a total of
14,675 admissions (710 admission in PICUs) (77). Those investigators found the infected patients had a longer mean
length of stay in the PICU (26.1 ⫾ 17.3 versus 10.6 ⫾ 6 days;
P ⬍ 0.001) than uninfected patients. The mortality rate was
10% for PICU patients with nosocomial infections. The mortality and length of stay associated specifically with VAP were
not reported, although VAP accounted for 53% of the nosocomial infections in PICU patients. Mortality among uninfected PICU patients was not reported. Similarly, PICU length
of stay in a 9-month prospective cohort study in an academic
tertiary care center revealed that patients with VAP (n ⫽ 30)
had a mean PICU length of stay of 27 days versus 6 days for
uninfected patients (n ⫽ 595) (P ⫽ 0.001) (28). In that same
study, the mortality rates with and without VAP were 20% and
7%, respectively (P ⫽ 0.065). Outcomes between patients on
mechanical ventilation for more than 8 days with VAP (n ⫽ 30)
and those without VAP (n ⫽ 62) were also compared. PICU
length of stay was longer for VAP patients (27.53 ⫾ 20.09
versus 18.72 ⫾ 35 days), as was hospital length of stay (52.63 ⫾
37.43 versus 33.77 ⫾ 49.51 days), but no differences in mortality rates for VAP (20%) or uninfected patients (21%) were
found. Almuneef et al. (1) determined in a prospective cohort
study (n ⫽ 361) that PICU lengths of stay with (n ⫽ 37) and
without (n ⫽ 324) VAP were longer for patients with VAP
(33.70 ⫾ 30.28 versus 14.66 ⫾ 17.34 days; P ⫽ 0.001). Statistically significant differences in mortality rates between
patients with VAP and those without VAP were not found (P ⫽
0.362). Both of those studies performed only univariate analyses to compare mortality rates among patients with and with-
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
out VAP. Multivariate analysis of predictors of mortality
among PICU patients with sufficient numbers of VAP controlling for severity of illness both at admission and at the time of
VAP as well as other potential predictors of death is necessary
to determine the true attributable mortality of VAP in pediatric patients.
VAP has also been shown to increase hospital costs. The
cost of VAP was analyzed in a 2-year study of PICU patients
(n ⫽ 1919) with a single admission (38). The direct cost for
patients with VAP (n ⫽ 56) was $38,614, and that for patients
without VAP was $7,682. In a multivariate analysis controlling
for other predictors of cost including age, severity of illness,
underlying disease, and ventilator days, VAP was independently associated with a direct cost of $30,931 (95% confidence
interval [CI], $18,349 to $82,638) (38). This is a single study
from an academic tertiary care center; further studies are
needed to determine whether the results from this single center are generalizable.
Recommendations for Current Practice
and Future Research
Differences in the incidence of VAP occur as a result of the
definitions used, persons doing surveillance, and frequency of
surveillance. Standardization of surveillance methodology and
validation of current definitions against a histopathologic or
microbiologic “gold standard” would make interinstitutional
comparisons meaningful, particularly in light of mandatory
reporting of health care-associated infections. Recent literature suggests that pediatric VAP is associated with increased
morbidity, antibiotic use, PICU cost, and PICU and hospital
length of stay. Prospective studies using consistent definitions
of VAP and controlling for severity of illness both at admission
and at the time of VAP as well as other possible predictors of
death and length of stay are necessary to define the true attributable mortality and cost associated with VAP in pediatric
patients.
DIAGNOSIS
Clinical Criteria
The lack of a gold standard for the diagnosis of VAP in both
adults and children makes an interpretation of the literature
complex. The clinical criteria for the diagnosis of VAP have
been established by the NNIS and the CDC (22). Patients who
are mechanically ventilated for more than or equal to 48 h
must have two or more abnormal chest radiographs with at
least one of the following symptoms: new or progressive and
persistent infiltrate, consolidation, cavitation, and/or pneumatoceles (in infants ⱕ1 year of age). However, in patients
without underlying pulmonary or cardiac disease (respiratory
distress syndrome, bronchopulmonary dysplasia, pulmonary
edema, or chronic obstructive pulmonary disease), one definitive chest radiograph is acceptable. In addition to abnormal
chest radiographs, a patient must have at least one of the
following symptoms: fever (⬎38°C) with no other recognized
cause, leukopenia (⬍4,000 white blood cells [WBC]/mm3) or
leukocytosis (ⱖ12,000 WBC/mm3), and at least two of the
following criteria: new onset of purulent sputum, change in
411
character of sputum, increased respiratory secretions, or increased suctioning requirements; new onset of or worsening
cough, dyspnea, or tachypnea; rales or bronchial breath sounds;
and worsening gas exchange (e.g., O2 desaturations [e.g., PaO2/
FiO2 levels of ⱕ240], increased oxygen requirements, or increased ventilation demand). The criteria described above may be
used to diagnose VAP in children; however, specific diagnostic
criteria for VAP have been developed for infants ⱕ1 year of age
and children ⬎1 and ⱕ12 years of age. Infants that are ⱕ1 year
old must have worsening gas exchange (oxygen desaturations,
increased oxygen requirements, or increased ventilator demand)
and at least three of the following criteria: temperature instability
with no other recognized cause; new onset of purulent sputum,
change in character of sputum, increased respiratory secretions,
or increased suctioning requirements; apnea, tachypnea, nasal
flaring with retraction of chest wall, or grunting; wheezing, rales,
or rhonchi; cough; and bradycardia (⬍100 beats/min) or tachycardia (⬎170 beats/min). Children ⬎1 and ⱕ12 years of age must
meet at least three of the following criteria: fever (⬎38.4°C or
⬎101.1°F) or hypothermia (⬍37°C or 97.7°F) with no other recognized cause; leukopenia (⬍4,000 WBC/mm3) or leukocytosis
(ⱖ15,000 WBC/mm3); new onset of purulent sputum, change in
character of sputum, increased respiratory secretions, or increased suctioning requirements; rales or bronchial breath
sounds; and worsening gas exchange (O2 desaturations [pulse
oximetry of ⬍94%], increased oxygen requirements, or increased
ventilation demand). NNIS/CDC criteria do not require microbiologic confirmation to diagnose pneumonia.
In summary, many of the diagnostic criteria are similar for
the ⱕ1-year-old and ⬎1- or ⱕ12-year-old age groups. Temperature instability is a diagnostic criterion for the ⱕ1-year-old
age group; either temperature elevation or hypothermia is a
criterion for the ⬎1- and ⱕ12-year-old age group. For the
⬍1-year-old group, cough, bradycardia, tachycardia, nasal flaring, grunting, and wheezing are diagnostic criteria not listed for
the ⬎1- or ⱕ12-year-old age groups, although for the older age
group, dyspnea without further specific definition is a diagnostic criterion. Worsening gas exchange, change in character or
amount of sputum, cough, rales, or bronchial breath sounds
are criteria for diagnosis in all three age groups. We suggest
that a consistent use of the age-specific definitions are preferred, although we were unable to find any published studies
directly comparing the sensitivity and specificity of the agespecific definitions to those for any age group.
Clinical definitions for VAP may be applied inconsistently,
and the lack of specific definitions of components of the clinical definition such as worsening gas exchange, oxygen desaturations, increased oxygen requirements, and increased ventilator demand may exacerbate this. Cordero et al. (19)
determined differences in the application of the CDC definitions using NICU patients (n ⫽ 37) diagnosed with VAP by
interpretation of CDC definitions by infection control practitioners (ICPs) and a positive tracheal aspirate culture. A panel
of neonatologists reviewed the clinical and laboratory evidence
as well as the radiographs. The neonatologists diagnosed VAP
in only seven patients. The neonatologists categorized the
other patients as having asymptomatic airway colonization
(n ⫽ 12), BSI (n ⫽ 7), and airway colonization with equivocal
signs of infection (n ⫽ 11). Among 8 of the 11 patients with
equivocal signs of infection, the general radiologist report
412
FOGLIA ET AL.
CLIN. MICROBIOL. REV.
TABLE 2. Accuracy of invasive diagnostic techniques for the diagnosis of VAP in adults and childrena
Age group and source
(reference)
No. of
patients
Adults
Rouby et al. (80)
Chastre et al. (13)
Fabregas et al. (30)
26
26
25
Protected mini-BAL
PSB
TBA
Protected BAL
BAL
PSB
Any invasive diagnostic
technique
Children
Gauvin et al. (42)
10
BAL (104 CFU/ml)
29
Bacterial index ⬎5
ICB
Endotracheal cultures
BAL (104 CFU/ml)
Labenne et al. (60)
SE
(%)
SP
(%)
Histopathology, lung tissue culture
Histopathology, lung tissue culture
Histopathology, lung tissue culture
70
100
69
39
77
62
85
69
60
92
100
58
75
50
Expert opinion; 2/3 blinded to BAL
and PSB results
50
80
78
30
90
72
86
95
40
88
69
79
90
95
88
88
Diagnostic technique
Gold standard(s)
(i) Positive pleural fluid culture, (ii)
computed tomography scan with
abscess, (iii) histopathology, (iv) lung
tissue culture, (v) blood and tracheal
aspirate positive for same organism
without other source, (vi) expert
opinion; 2/3 blinded to BAL/PSB
PSB
ICB on gram stain and ⫹ BAL
ICB on gram stain and ⫹ BAL
and ⫹ PSB
a
SE, sensitivity; SP, specificity; TBA, tracheobronchial aspirates; ICB, intracellular bacteria.
stated that the radiographic changes were suggestive of VAP;
the neonatologist panel, reviewing the same radiographs, concluded that VAP was unlikely in these patients. Those authors
concluded that an isolated positive tracheal aspirate does not
distinguish between airway colonization and VAP and that
routine radiology reports without definitive clinical and laboratory evidence may be misleading.
Invasive Testing in Adults
NNIS/CDC criteria for VAP do not require microbiologic
confirmation. A brief review of invasive testing to confirm the
diagnosis of VAP in adults will be performed, given the paucity
of literature regarding invasive testing in children. It is unclear
whether the adult experience can be extrapolated to children.
Several studies have examined the accuracy of invasive testing
for the diagnosis of VAP in critically ill adults (Table 2).
Microbiologic examination of specimens obtained from bronchoalveolar lavage (BAL) or protected specimen brush (PSB)
have an estimated 70% sensitivity and 77% specificity compared to histopathology and/or lung tissue culture (13, 30, 80).
In one of the most comprehensive studies of VAP in mechanically ventilated adults, Rouby et al. (80) sought to describe the histologic and bacteriologic characteristics of human
nosocomial pneumonia and to evaluate the accuracy of protected mini-BAL for the diagnosis of VAP compared to lung
tissue cultures and lung histology in patients who died while on
mechanical ventilation. Twenty-six patients had both positive
pathology and lung tissue culture; in 20 of these patients, the
BAL and lung tissue culture results were concordant (Fig. 1).
Chastre (13) compared the accuracy of the bronchoscopic
PSB to that of histologic and bacteriologic examinations of
pulmonary specimens in adults (n ⫽ 26). PSB and lung cultures
were highly correlated (r ⫽ 0.65; n ⫽ 28; P ⬍ 0.001) and higher
in patients not on antibiotics within 1 week before death than
in patients on antibiotics before death (r ⫽ 0.55; n ⫽ 33; P ⬍
0.001). Pneumonia was not found by histology or lung tissue
culture when PSB culture organisms were ⬍103 CFU per ml.
PSB cultures with ⱖ103 CFU/ml identified all patients with
histologically proven pneumonia. In patients treated with antibiotics, four patients had microorganisms isolated by PSB
with concentrations of ⬎103 CFU/ml not found in the lung
tissue cultures.
Fabregas and colleagues (30) sought to determine the accu-
FIG. 1. Comparison of protected minibronchoalveolar lavage with
histopathology and bacteriology for diagnosing VAP.
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
racy of clinical criteria and microbiologic testing for the diagnosis of VAP. The clinical pulmonary infection score (CPIS)
was used to compare microbiological criteria, clinical criteria,
and sampling techniques. Lung biopsies were performed for 25
mechanically ventilated patients immediately after death. The
reference standard was the presence of positive histology for
pneumonia or positive lung cultures. Chest X-ray infiltrates
and at least two of three clinical criteria achieved sensitivity
and specificity of 69% and 75%, respectively. The CPIS sensitivity and specificity were 77% and 42%, respectively. Noninvasive and invasive techniques achieved similar results. All
diagnostic techniques combined (PSB, BAL fluid, and protected BAL fluid) achieved sensitivity and specificity of 85%
and 50%, respectively.
A meta-analysis done in 2005 (n ⫽ 628) determined whether
invasive testing altered the management and mortality of VAP
in critically ill adults (84). VAP was confirmed bronchoscopically in 44 to 69% of the patients. Overall, antibiotics were
almost three times as likely to be changed if a bronchoscopy
was performed. In a separate pooled analysis of prospective
uncontrolled trials, alteration in antibiotic prescription occurred 50% (36 to 65%) of the time. To our knowledge, no
similar meta-analyses exist for pediatric populations.
Invasive Testing in Children
A few studies have examined the sensitivity and specificity of
lower airway sampling in PICU patients and found the sensitivity and specificity of BAL (104 CFU/ml) to be 50 to 72% and
80 to 88%, respectively (42, 60) (Table 2). The nonbronchosopic BAL (NB-BAL) has been used in children as an alternative
to fiberoptic BAL to diagnose pneumonia. This procedure is
performed by placing a suction catheter into the endotracheal
tube until resistance is met and then placing and suctioning
back a small amount of sterile normal saline from the lower
airway. The presence of bubbles in the returned fluid is suggestive that a lower airway sample containing surfactant has
been obtained. Quantitative cultures of the fluid are then performed by the microbiology laboratory. This procedure may be
advantageous compared to fiberoptic bronchoscopic techniques because bronchoscopic equipment is not required, a
trained bronchoscopist is not necessary, and the diagnostic
accuracy is comparable to that of fiberoptic techniques (36,
37, 71).
Gauvin et al. (42) performed a 27-month prospective cohort
study of PICU patients suspected of having VAP in a tertiary
academic care center. Of 30 patients, 10 were diagnosed with
VAP and 9 were diagnosed with ventilator-associated tracheitis by an expert panel. The expert panel was used as the
reference standard; they were given clinical, radiographic, and
microbiologic data but were blinded to the BAL results. A
bacterial index (sum of the log of all species obtained from
BAL) of ⬎5 had the highest correlation with the reference
standard (concordance, 83%; kappa ⫽ 0.61), a sensitivity of
78%, a specificity of 86%, a positive predictive value of 70%,
and a negative predictive value of 90% (42). Intracellular bacteria and gram stain from BAL were specific (95% and 81%,
respectively) but not sensitive (30% and 50%, respectively) for
the diagnosis of pediatric VAP, whereas clinical criteria and
endotracheal cultures were sensitive (100% and 90%, respec-
413
tively) but not specific (15% and 40%, respectively). That study
concluded that blind BALs with a bacterial index of ⬎5 are the
most reliable method for diagnosing VAP in mechanically ventilated children. The study did not describe what proportion of
patients were on antibiotics or the duration of antibiotic exposure prior to BAL.
Labenne et al. (60) also investigated the sensitivity and specificity of PSB and BAL in PICU patients with suspected VAP.
The gold standards used by those investigators were a positive
pleural fluid culture, computed tomography scan with pulmonary abscesses, histopathological evidence, positive lung biopsy
(⬎104 CFU/gram), the same bacteria isolated in blood and
endotracheal aspirate without another source, or clinical diagnosis using CDC guidelines established independently by two
investigators blinded to PSB/BAL culture results. Of 103 patients, 29 were diagnosed with VAP, 10 were labeled as “uncertain,” and 64 were classified as not having VAP. Thirteen of
64 patients with negative PSB and BAL cultures had antibiotics
stopped after 48 h, 25 of 64 had negative cultures, and antibiotics were not used at all, and 28 of 38 had a positive tracheal
aspirate culture but negative PSB and BAL, so antibiotics were
discontinued prior to the standard 7-day treatment in that
center. The sensitivity and specificity for BAL fluid culture
were 72% and 88%, respectively. The intracellular bacteria
and the BAL combined had sensitivity and specificity of 79%
and 88%, respectively. Use of PSB culture results in combination with intracellular bacteria and BAL further increased the
sensitivity and specificity to 90% and 88%, respectively. The
PSB and BAL are effective methods of collecting distal samples and were helpful in diagnosing VAP. However, a combined diagnostic approach was superior to either one alone.
The safety of the NB-BAL in children has also been determined by several studies; few adverse experiences (n ⫽ 18)
have been reported (12, 42, 60, 66, 79). The types of adverse
events were sustained oxygen desaturation requiring increased
ventilatory support (n ⫽ 11), pneumothorax (n ⫽ 4), hypotension (n ⫽ 2), and significant increase in intracranial pressure
(n ⫽ 1). Of the 11 patients who experienced sustained oxygen
desaturations, 7 patients were diagnosed with acute respiratory
distress syndrome and saturations in the low 80s before the
procedure was performed. Pneumothorax occurred in patients
less than 1 month of age (n ⫽ 4). Hypotension occurred in
patients requiring dopamine before the NB-BAL procedure
began.
The safety of NB-BAL and BAL have been examined in a
study evaluating the diagnosis of infectious and interstitial lung
disease in children (n ⫽ 32) (79). That study found that both
NB-BAL and the BAL were safe, as respiratory rate, heart
rate, and oxygen saturation were monitored during the procedure and a minimum of 6 h afterwards. Patients did not require
increased supplemental oxygen after the procedure, and no
major airway bleeding occurred.
Computerized Surveillance
Recently, a retrospective study was performed to determine
the accuracy of computerized surveillance to detect nosocomial pneumonia in two NICUs over a 2-year period (n ⫽ 2,932
patients) (46). The automated monitoring system was a natural
language processor, referred to as the Medical Language Ex-
414
FOGLIA ET AL.
traction and Encoding system, that converted the electronic
narrative reports to coded descriptions to identify patients with
pneumonia. The automated monitoring system was compared
to diagnosis of VAP by an ICP who performed prospective
surveillance for pneumonia using NNIS definitions. A total of
1,277 patients had chest radiographs. In NICU 1, seven cases
of VAP were identified by the ICP prospective surveillance;
five of the seven cases found by the ICP were also identified by
automated computer surveillance, which flagged an additional
61 patients with possible nosocomial pneumonia. Nine were
considered to be inappropriately flagged by a second independent ICP review. The sensitivity and specificity of the computerized surveillance were 71% and 99.8%, respectively. The
positive predictive value was 7.9%, and the negative predictive
value was ⬎99%. In NICU 2, 10 cases of VAP were identified
by the ICP; only 2 of these were flagged by the computer.
Further investigation revealed that 7 of the original 10 cases
were not flagged by the computer because the original chest
radiograph reports could not be found. Eight hundred thirtysix patients had chest radiographs performed; 84 were flagged
by the computer as VAP. The sensitivity and specificity for
NICU 2 could not be calculated. The findings of that study
indicate that computerized surveillance may be useful in
streamlining the identification of patients with possible VAP
who require a more time-consuming chart review by an ICP.
This system was not linked with microbiology reports. An unstudied area is computerized surveillance linking both radiology and microbiology reports.
Recommendations for Current Practice
and Future Research
The lack of a gold standard plagues all literature regarding
VAP in both adults and children. The current literature suggests that NB-BAL, BAL, and PSB are safe in older children
who do not have severe hypoxemia, increased intracranial
pressure, hemodynamic instability, or bleeding problems and
that invasive testing is sensitive and specific compared to a
reference of expert opinion. Comparison of the clinical definitions, including the age-specific definitions, with and without
invasive testing against histopathology and/or lung tissue culture would be a valuable addition to the literature. The feasibility of using NB-BAL in a general patient population and the
effect on antibiotic use remain to be determined.
Computerized surveillance has the potential for considerable time savings, particularly if electronic surveillance of the
radiographic reports could be combined with that of microbiology and vital signs and validated against the current practical
gold standard of application of CDC/NNIS definitions by an
experienced clinician who has reviewed the complete medical
record. Additional computerized surveillance studies are necessary to help further understand the impact that computerized surveillance may have on diagnosing pneumonia.
MICROBIOLOGY
Understanding the microbiology of VAP is critical for guiding decisions regarding empirical antibiotic therapy. A retrospective cohort study of the microbiologic etiology of VAP in
the ICU setting was performed in three hospital settings: a
CLIN. MICROBIOL. REV.
large teaching hospital, a community hospital, and a children’s
hospital (5). The most commonly isolated organisms were similar across adult and pediatric hospitals: Staphylococcus aureus
(28.4%), Pseudomonas aeruginosa (25.2%), and other gramnegative bacilli (26.6%). The microbiologies of early-onset and
late-onset infections differed in the adult populations, but this
was not the case in the children’s hospital. Pseudomonas aeruginosa and Staphylococcus aureus were the most commonly isolated organisms in the children’s hospital. Pseudomonas aeruginosa was more common in the PICU than in the NICU (33.3%
versus 17%; P ⫽ 0.01), while Staphylococcus aureus was more
common in the NICU than in the PICU (38% versus 17.6%;
P ⬍ 0.001). A prospective cohort study of VAP in the same
NICU was performed. Most of the tracheal isolates from patients with VAP grew polymicrobial cultures; the organisms
most commonly isolated included Staphylococcus aureus
(23%), Pseudomonas aeruginosa (38.4%), Enterobacter spp.
(38.4%), and Klebsiella spp. (23%) (3). A limitation of these
studies is that the vast majority of isolates were from endotracheal aspirates rather than from invasive sampling of the lower
airway, and thus, the results may represent oropharyngeal
flora.
Two studies reported differences in the microbiologies of
early-onset and late-onset nosocomial pneumonia among children. Group B streptococci were most commonly isolated from
infants with maternally acquired pneumonia (31.8%), while
these organisms were rarely isolated in cases of late-onset
pneumonia (1.3%). The frequency of Staphylococcus aureus
increased from 2.4% of maternally acquired cases to 18.7% of
non-maternally-acquired cases of pneumonia, and Pseudomonas aeruginosa frequency increased from 2.9% of maternally
acquired cases to 12.9% of non-maternally-acquired cases of
pneumonia (43).
A 41-month prospective surveillance study of nosocomial
infections in a NICU divided pneumonia into early-onset (onset of symptoms within first 48 h of life) and late-onset (onset
of symptoms more than 48 h after birth) infections (98). There
were 35 cases of definite or probable early-onset pneumonia.
In 26 of these cases, potential pathogens were identified: 18
(76.9%) group B streptococci, 1 (3.8%) group F streptococcus,
3 (11.5%) Streptococcus pneumoniae isolates, and 2 (7.7%)
nontypeable Haemophilus influenzae infections. Late-onset
pneumonia occurred in 36 of 358 (10%) neonates who were
ventilated for over 24 h. Cultures were taken from endotracheal tubes or nasopharyngeal secretions for 41 episodes of
late-onset nosocomial pneumonia. The most commonly isolated organisms were coliform spp. (n ⫽ 18; 43.9%), Pseudomonas aeruginosa (n ⫽ 14; 34.1%), and Staphylococcus aureus
(n ⫽ 6; 14.6%).
RISK FACTORS FOR VAP IN NICU PATIENTS
In pediatric populations, the pathogenesis of VAP is not well
studied. In adult patients, aspiration of oropharyngeal secretions, inhalation of aerosols containing bacteria, hematogenous spread, and bacterial translocation from the gastrointestinal tract are all considered to be mechanisms of the
development of VAP (89).
Neonates have unique characteristics predisposing them to
nosocomial infections. These patients’ immature immune sys-
VOL. 20, 2007
tems place them at increased risk for infection (24). Skin and
mucous membranes are more permeable and are less effective
barriers to infection (47). Abnormal granulocyte migration and
bacterial digestion in these patients have been demonstrated.
Additionally, decreased activity of complement, particularly
complement opsonization, occurs in newborns (40). Lastly,
hypogammaglobulinemia occurs in premature newborns. Maternal immunoglobulin G (IgG) is transported to the fetus in
the second and last trimesters of pregnancy, and fetal IgG
levels reach maternal levels by term (58). Levels of IgG are
lower in premature newborns, as maternal levels have not yet
been attained. In the initial months following birth, maternal
IgG levels drop, and it takes the infant months to produce
ample levels of IgG and other immunoglobulins.
Low birth weight has been shown to be a risk factor for the
development of nosocomial pneumonia. A 41-month surveillance study demonstrated a significant association between a
birth weight of ⬍1,500 g and a higher rate of nosocomial
pneumonia (48). However, low birth weight may be a marker
for an increased duration of mechanical ventilation. That study
was limited by the lack of a specific control for the duration of
mechanical ventilation. Apisarnthanarak et al. (3) focused on
estimated gestational age (EGA) rather than birth weight in
their 10-month-long case control study of 211 intubated NICU
patients. VAP rates were much higher in babies with an EGA
of ⬍28 weeks (19 VAP cases) than in babies with an EGA of
ⱖ28 weeks (5 VAP cases) (P ⬍ 0.001) (3). The VAP rate per
1,000 ventilator days was also higher in babies with an EGA of
⬍28 weeks (6.5/1,000 ventilator days) than in babies with an
EGA of ⱖ28 weeks (4.0/1,000 ventilator days) but was not
statistically significant (P ⫽ 0.34) (3). Not all investigators
found an inverse relationship between birth weight and frequency of nosocomial pneumonia. A prospective surveillance
study of nosocomial infections in seven Brazilian NICUs found
that the rate of nosocomial pneumonia was actually higher in
neonates with birth weights of ⬎1,500 g than in babies with
birth weights of ⱕ1,500 g (4.4/1,000 patient days versus 2.8/
1,000 patient days) (72).
Prior BSIs have been identified as a being a risk factor for
VAP in NICU patients. In babies with an EGA of ⬍28 weeks,
history of a prior BSI was the only significant risk factor for the
development of VAP in multivariate analyses after controlling
for the duration of mechanical ventilation (P ⫽ 0.03). Although none of the cases of VAP were caused by the same
organism as that which caused the BSI, those authors suggested that prior BSI may serve as a surrogate for severity of
illness rather than actually contributing to VAP (3).
The design of the NICU may also have an effect on the
incidence of nosocomial infections and specifically VAP. A
5-year prospective study of nosocomial infections in a NICU
was performed (44). Midway through that study, the NICU
location was moved from cramped quarters adjacent to a busy
medical ward to a new facility. The new nursery had a 50%
increase in staffing and improved infection control features. In
the old nursery, 16 of 492 patients had pneumonia, whereas
in the new nursery, only 1 patient of 419 had pneumonia. While
the new nursery had improved structural infection control
measures such as more space per patient, a large number of
sinks, and a separate isolation room, it is not clear if other
practices of care, such as head-of-bed elevation or suctioning,
VAP IN PEDIATRIC PATIENTS
415
changed after the move to the new unit. Those authors did not
report any changes in infection control surveillance or diagnosis in the new nursery.
RISK FACTORS FOR VAP IN PICU PATIENTS
Several prospective cohort studies described risk factors for
pediatric VAP. In a prospective cohort study at a tertiary care
center, genetic syndrome (odds ratio [OR], 2.37; 95% CI, 1.01
to 5.46), transport out of the PICU (OR, 8.90; 95% CI, 3.82 to
20.74), and reintubation (OR, 2.71; 95% CI, 1.18 to 6.21) were
all independent predictors of pediatric VAP (28). That study
also found that primary BSIs were associated with the development of VAP, as five of the nine patients with primary BSIs
and VAP had the BSI first. Another prospective cohort study
identified prior antibiotic use (OR, 2.45; 95% CI, 1.112 to
5.405), continuous enteral feeding (OR, 2.29; 95% CI, 1.093 to
4.798), and bronchoscopy (OR, 5.04; 95% CI, 1.665 to 15.266)
as being independent predictors of pediatric VAP (1). Immunosuppressant drugs (OR, 4.8; P ⫽ 0.04), immunodeficiency
(OR, 6.9; P ⫽ 0.06), and neuromuscular blockade (OR, 11.4;
P ⫽ 0.002) were also found to be independent predictors in
another prospective cohort study (32). Torres et al. (94) identified several factors associated with increased risk of developing VAP: reintubation (OR, 4.95; 95% CI, 3.48 to 7.04; P ⫽
0.000012), gastric aspiration (OR, 5.05; 95% CI, 3.28 to 7.77;
P ⫽ 0.00018), mechanical ventilation for ⬎3 days (OR, 1.17;
95% CI, 1.15 to 1.19; P ⫽ 0.015), chronic obstructive pulmonary disease (OR, 1.89; 95% CI, 1.38 to 2.59; P ⫽ 0.048), and
positive end-expiratory pressure (OR, 1.85; 95% CI, 1.30 to
2.64; P ⫽ 0.092). In nosocomial pneumonia patients, factors
associated with increased mortality risk were a rapidly fatal
underlying condition (OR, 8.84; 95% CI, 3.52 to 22.22; P ⫽
0.0018), worsening acute respiratory failure from developing
pneumonia (OR, 11.94; 95% CI, 4.75 to 30; P ⫽ 0.0096), septic
shock (OR, 2.83; 95% CI, 1.41 to 5.78; P ⫽ 0.016), inappropriate antibiotic treatment (OR, 5.81; 95% CI, 2.70 to 12.48;
P ⫽ 0.02), and non-cardiac-surgery ICU patients (OR, 3.38;
95% CI, 1.70 to 6.71; P ⫽ 0.08) (78). Medications associated
with the development of VAP are NADP, steroids, and histamine type 2 receptor blockers (28).
Recommendations for Current Practice
and Future Research
Several factors have been identified as being risk factors for
VAP in NICU and PICU patients. Many of these factors reflect a risk for aspiration such as that which may occur during
reintubation, physical movement out of the ICU, and bronchoscopy. In addition, neuromuscular weakness and immunodeficiency may predispose a patient to VAP, as does prolonged
mechanical ventilation. A risk stratification system incorporating preventable and nonpreventable risk factors for pediatric
VAP might assist intensivists in the development of pediatric
VAP prevention bundles and methods for identifying meaningful indicators as a measure of an institution’s success at
VAP prevention. Larger, multicenter, randomized controlled
trials using a standard reference definition of VAP to test
interventions to prevent aspiration in children would be useful.
Testing the efficacy of a standardized assessment of readiness
416
FOGLIA ET AL.
to wean mechanical ventilatory support would also be useful in
this patient population, as would a standardized assessment of
pain and the need for sedation and neuromuscular blockade.
PREVENTION
Several recommendations have been given to decrease VAP.
The CDC and Healthcare Infection Control Practices Advisory
Committee suggest using orotracheal tubes (instead of nasotracheal tubes) when patients require mechanical ventilation,
changing breathing circuits of ventilators only if they malfunction or if they are visibly contaminated, and using endotracheal
tubes with dorsal lumens to allow respiratory secretions to
drain (89). There are no recommendations for the preferential
use of sucralfate, histamine 2 receptor antagonists, or antacids
for stress bleeding prophylaxis (89).
Head-of-Bed Elevation
Supine position has been associated with VAP in adult patients, which is thought to be related to an increase in gastroesophageal reflux and aspiration. Semirecumbent positioning
has been demonstrated to decrease surrogate outcomes such
as aspiration and gastroesophageal reflux in adults (16), and
one clinical trial demonstrated a dramatic decrease in the
incidence of confirmed VAP in patients with head-of-bed elevation (5% versus 23%; OR, 6.8; 95% CI, 1.7 to 26.7) (25). The
efficacy of semirecumbent positioning in preventing VAP in
children has not been established. One age- and sex-matched
case control study of nosocomial pneumonia in children found
that head-of-bed elevation did not differ between cases and
controls. That study was limited by small numbers of cases
and controls (n ⫽ 9 for each group) (10). Additionally, sizerelated factors must be considered in the utility of semirecumbent positioning in children. For instance, elevating the head
⬎30° is logistically challenging for small pediatric patients such
as infants and toddlers.
In-Line Suctioning
Endotracheal suctioning is used for eliminating bronchopulmonary secretions from the airway. Traditional open endotracheal suction requires disconnection from the ventilator. This
process has been shown to result in increased intracranial
pressure, increased mean blood pressure, and hypoxia in mechanically ventilated children (27, 57). The introduction of a
closed multiuse suction catheter in the 1980s allowed endotracheal suctioning without disconnection from the ventilator. In
critically ill adult populations, closed suction systems have
been shown to result in fewer physiologic disruptions such as
arterial and venous desaturations and arrhythmias (54).
Closed endotracheal suction systems present the potential
for bacterially contaminated secretions to pool in the lumen of
the tube, with reinoculation of the respiratory tract with each
repeated suctioning. On the other hand, a closed system could
potentially decrease environmental contamination of the
respiratory device. Many studies of critically ill adults have compared the incidence of airway colonization and nosocomial
pneumonia in patients on a closed multiuse system to that in
patients on a single-use open suction system. The frequency of
CLIN. MICROBIOL. REV.
airway colonization has been shown to be significantly more
frequent in patients on the closed suction system (23). However, studies have not demonstrated an increased frequency of
nosocomial pneumonia in patients on the closed suction system (23, 54). Indeed, a more recent prospective randomized
study of 102 ventilated adults demonstrated an increased risk
of VAP for patients with an open suction system compared to
a closed suction system (adjusted risk, 3.5; 95% CI, 1.0 to
12.33) (17). There are currently no CDC recommendations
regarding the preferential use of closed or open suction systems, nor are there recommendations regarding the frequency
of change for multiuse closed suctioning systems in a single
patient (89).
A single study has compared open and closed suction systems in critically ill children. Cordero et al. (20) monitored 133
ventilated NICU patients who were alternately assigned to a
closed or open suction system for bacterial airway colonization,
nosocomial pneumonia, BSI, and bronchopulmonary dysplasia. A definition of nosocomial pneumonia required radiographic evidence of “probable” pneumonia (new airspace disease or a parenchymal process) and positive blood cultures and
tracheal culture for a respiratory pathogen. Colonization patterns from tracheal cultures were comparable between groups,
with gram-positive colonization occurring by the second week
of intubation and gram-negative colonization occurring after
the third week of ventilation. There were no significant differences in the incidences of VAP or BSIs or mortality between
patient groups. Additionally, the numbers of endotracheal suctions per day, the numbers of reintubations, the incidences and
severities of bronchopulmonary dysplasia, and the numbers of
infants discharged on supplemental oxygen were similar between groups. Finally, 40 of 44 (91%) NICU nurses judged the
closed suction system to be easier to use, less time-consuming,
and better tolerated by NICU patients.
H2 Blockers/Sucralfate
The acidification of gastric contents is thought to decrease
colonization with potentially pathogenic bacteria. Stress ulcer
prophylactic medications that increase gastric pH, like H2antagonists and antacids, may increase colonization with
pathogenic organisms and increase the risk of VAP (18).
Sucralfate is an alternative stress ulcer prophylactic agent that
does not alter gastric pH, and this medication may lower the
risk of VAP while maintaining stress ulcer prophylaxis. Over 20
clinical trials with adults have investigated the risk of VAP
associated with these medications. Of seven meta-analyses of
these clinical trials, four found a significant reduction in the
incidence of VAP in patients treated with sucralfate compared
to patients receiving H2 antagonists. The same effect occurred
in the other three analyses but did not reach statistical significance. Three of these meta-analyses demonstrated a significant reduction in mortality associated with sucralfate therapy
(16).
Two clinical trials compared the risk of VAP with various
methods of stress ulcer prophylaxis in pediatric patients. A
retrospective study included 155 PICU patients who had a
nasogastric tube in place and were mechanically ventilated for
⬎48 h: 54 were given ranitidine, 53 were give sucralfate, and 48
were not on stress ulcer prophylaxis (62). There was no signif-
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
icant difference in the incidences of VAP between patients
treated with ranitidine and patients treated with sucralfate
(11.1% versus 7.5%; ␹2 ⫽ 0.40; P ⫽ 0.52). That study had
several limitations. Patients were not randomized into study
groups, and patient characteristics differed between patients
given stress ulcer prophylaxis and those who were not given
prophylaxis. The retrospective nature of the study may have
resulted in errors in diagnosing VAP.
A prospective study was performed to study the incidence of
VAP and associated mortality among patients randomized to
one of four groups for stress ulcer prophylaxis in Turkey (101).
That study included 160 PICU patients: 38 received sucralfate,
42 received ranitidine, 38 received omeprazole, and 42 did not
receive prophylaxis. VAP occurred in 70 of 160 (44%) patients,
ranging from 41 to 48% in individual treatment groups. There
was no difference in the incidence of VAP across treatment
groups. The overall mortality rate was 35 of 160 (22%) and did
not differ significantly among treatment groups, ranging from
21 to 23% across groups. The overall incidence of VAP (44%)
in this study was much higher than that reported in other
pediatric studies from referral hospitals (5.1% to 10.2%) (1,
28). It is possible that VAP was overdiagnosed in that study,
although diagnostic criteria used in that study were similar to
criteria used in this country. If VAP was overdiagnosed, this
effect would likely be distributed throughout all study groups.
That study may also have been underpowered to detect differences in the incidences of VAP among these patient groups.
Both of those studies failed to demonstrate a difference in
the incidence of VAP in patients treated with sucralfate compared to those treated with agents that alter gastric pH. Additionally, neither study demonstrated an increased risk of
VAP in patients treated with agents that alter gastric pH compared to that in patients with no treatment. The microbiologies
of infections were similar across treatment groups, and many
infections were caused by organisms that are not likely to be
affected by stress ulcer prophylaxis. It is possible that the study
sizes presented were simply too small to appreciate a significant difference in the incidence of VAP, or it is possible that
stress ulcer prophylaxis is not associated with VAP in the
pediatric population. Larger prospective randomized studies of
children are needed to asses the impact of stress ulcer prophylaxis on VAP and whether sucralfate has a protective effect
compared to medications that decrease gastric acidity.
Hand Hygiene
Efforts at reducing person-to-person transmission of bacteria are crucial for preventing nosocomial infections. Significant
bacterial contamination of hospital employees’ hands during
routine patient care has been demonstrated (75). The concept
that routine hand washing by health care workers reduces
nosocomial infections is not new, but the first study investigating the impact of hand hygiene on the rate of hospital-acquired
infections in NICU patients was recently performed (99). A
2-year-long multimodal intervention was instigated, which consisted of formal lectures, written and posted instruction regarding proper hand hygiene technique, covert observation, financial incentives, and regular feedback of observed hand hygiene
rates. Surveillance of hand washing compliance and nosocomial infections from the pre- and postintervention periods
417
were compared. The rate of hand hygiene compliance increased from 43% at baseline to 80% during the intervention,
and the rate of respiratory infections decreased from 3.35 to
1.06 per 1,000 patient days (P ⫽ 0.002) in the pre- and postintervention periods. The two parameters were statistically correlated (r ⫽ ⫺0.385; P ⫽ 0.014). That study is helpful in
demonstrating an association of hand hygiene and prevention
of nosocomial pneumonia, but it has limitations. The beforeafter design of the study makes it difficult to assess if a reduction in the rate of pneumonia is attributable exclusively to the
increase in hand hygiene. An intervention of this magnitude
may have altered other clinical practices related to the spread
of bacterial contamination, as employees’ awareness of preventing nosocomial infections was increased. Those authors
did point out that no changes in the use of surfactant or suction
procedures occurred during the study period but did not comment on other procedural changes that may have occurred
such as head-of-bed elevation, stress ulcer prophylaxis, or oral
hygiene changes. Additionally, while rates of hand hygiene
compliance remained at 81% during the 16-month postintervention period, it is unclear how sustainable this effect was
after observations were discontinued.
A prospective study of a 3-month-long implementation of an
intervention to decrease rates of nosocomial infection in NICU
patients was undertaken (69). The intervention consisted of
three parts: (i) grouping of all blood-taking tasks to reduce the
number of daily blood draws, (ii) reducing the frequency of
blood investigations after stabilization of acute illness, and (iii)
using an aseptic delivery system of drugs though a central
venous catheter to reduce peripheral intravenous access. The
incidences of nosocomial infection in the NICU between the
1-year preintervention period and the 1-year postintervention
period were compared. VAP rates declined from 3.3/1,000
ventilator days to 1.0/1,000 ventilator days after the intervention. Again, that study was limited by the before-after nature of
the design. Those authors acknowledged that practices regarding mechanical ventilation also changed during the study period, as patients were weaned from the ventilator more aggressively and as soon as possible. Earlier weaning may have
contributed to lowering the VAP rates, as prolonged intubation is a risk factor for VAP in children (62).
The importance of hand hygiene in preventing horizontal
transmission of pathogens among mechanically ventilated patients was highlighted by a study performed by Sole et al. (86)
to evaluate the proportion of suctioning devices colonized with
pathogenic bacteria and to correlate the bacteria found on
respiratory equipment with those found in patients’ mouths
and sputum. Those investigators found that within 24 h of
changing to new suctioning equipment, 94% of tonsil suction
tubing, 83% of in-line suction tubing, and 61% of distal suction
connectors were colonized with pathogenic bacteria similar to
those found in the patients’ oropharynx and sputum (86).
Selective Decontamination
The impact of using topical antibiotics on tracheostomy sites
on exogenous colonization or infection of the lower airways
has been studied. A 2-year-long prospective observational cohort study was performed with 23 children who were treated
with 2% paste of polymyxin E and tobramycin on the trache-
418
FOGLIA ET AL.
ostoma four times a day for the first two postoperative weeks
(65). Only 1 of 23 (4%) patients developed exogenous colonization or infection of the lower respiratory tract, which was
lower than that in historical controls (6/22 [27%]). While topical antibiotics may be useful in preventing exogenous colonization or infection of the lower airways in children with tracheostoma, the risk of endogenous colonization remains high.
Endogenous colonization or infection occurred in 15 episodes
in 14 of 23 (61%) patients during the 2-week postoperative
period.
Many investigators have studied the efficacy of selective digestive tract decontamination (SDD) in preventing VAP. SDD
traditionally consists of a regimen of topical antimicrobials
applied to the oropharynx and through a nasogastric tube, with
the aim of reducing the burden of pathogenic bacteria in aspirated secretions. While the majority of trials have focused
exclusively on the use of topical antimicrobials, many have also
used a short course of intravenous antimicrobial therapy.
Seven meta-analyses of randomized, controlled trials of SDD
in adults all showed a significant reduction in the risk of VAP,
and four of those analyses also demonstrated a significant
reduction in mortality in patients treated with SDD (16). One
recent meta-analysis divided trials into those that used topical
antibiotics alone and those that used a combination of topical
and systemic antimicrobials for the prevention of nosocomial
respiratory infections (61). That analysis included 32 randomized, controlled trials including a total of 5,185 adult patients.
A protective effect was demonstrated in trials comparing patients on a combination of systemic and topical antibiotics with
controls (OR, 0.35; 95% CI, 0.29 to 0.41) and in trials comparing patients on topical antibiotics alone with controls (OR,
0.52; 95% CI, 0.43 to 0.63). A significant reduction in mortality
was seen only in trials that used a combination of topical and
systemic therapy (OR, 0.78; 95% CI, 0.68 to 0.89). Mortality
from VAP was not reduced when topical therapy alone was
used (OR, 0.97; 95% CI, 0.81 to 1.16).
Recent evidence suggests that results from some of those
trials may be overly optimistic. A meta-analysis of 32 primary
trials of SDD was performed to assess the impact of study
methodology on results (97). Study methodology was evaluated based on allocation and concealment, patient selection,
patient characteristics, blinding, and definition of nosocomial
pneumonia. That analysis found an inverse relationship between the methodologic quality and benefit of SDD on the
incidence of pneumonia, suggesting that the benefit of SDD
for the prevention of VAP may be overestimated by many
clinical trials (97).
Studies focusing on the use of SDD to prevent VAP in
children have conflicting results. A prospective study of SDD
in 226 PICU patients randomized study subjects into a treatment (n ⫽ 116) or control (n ⫽ 110) group (81). The treatment
group received colistin, tobramycin, and nystatin orally or
through a nasogastric tube every 6 h, and patients were monitored for the development of nosocomial infection in any body
site. There were 87 episodes of any nosocomial infection in 65
of 226 (28.8%) patients. The most common nosocomial infections were catheter-related bacteremia, sepsis, pneumonia, and
urinary tract infection. The overall incidence of nosocomial
infection across all sites did not differ between treatment and
control groups. However, when infections were studied by
CLIN. MICROBIOL. REV.
body site, patients in the treatment group had a significantly
lower frequency of pneumonia (2.6% versus 7.2%). In multivariate analyses, SDD retained a protective effect against
pneumonia (OR, 0.21; 95% CI, 0.06 to 0.8). There was no
significant difference in overall mortality between the treatment and control groups (six versus five patients). Patients in
that study were randomized and were well matched for most
variables with the exception of severity of illness; the treatment
group had more severely ill patients. This difference in severity
of illness would be expected to skew the results toward the null
hypothesis, but there were actually fewer cases of pneumonia
in the more severely ill group who were treated with SDD.
A prospective, randomized, double-blinded study was performed to determine the efficacy of SDD in preventing nosocomial infections in severely burned (⬎30% total body surface
area) PICU patients (7). Patients were randomized to the
treatment group (n ⫽ 11) or control group (n ⫽ 12). The
treatment group was given a mixture of polymyxin E, tobramycin, and amphotericin B four times daily by nasogastric
tube. No significant differences regarding demographics, underlying conditions, inhalation, injury, or percent of surface
area burned between patient and control groups existed. There
was no difference in the proportion of patients with colonization of wounds, feces, nasogastric aspirates, or sputum between
groups at the start of the study or throughout the study. No
significant differences between groups were noted with regard
to the serious complications measured: sepsis, pneumonia, gastrointestinal bleeding, respiratory distress syndrome, and mortality. The group treated with SDD had a higher incidence of
diarrhea than the control group (82% versus 17%; P ⫽ 0.003).
Results from that study suggest that SDD may not prevent
nosocomial infections in pediatric patients. However, that
study was limited by a small sample size (n ⫽ 23). Additionally,
results of that study may not be generalizable to all PICU
patients, as that study was restricted to burn patients.
A prospective nonrandomized cohort study was performed
to determine the impact of SDD on nosocomial infections in
NICU patients (49). The decision to administer decolonization
was left to attending physicians. Investigators later determined
if patients had received well-performed decolonization (decolonization within the first 5 days with oral polymyxin E,
tobramycin, and nystatin), incorrect decolonization (started
after 5 days or less than three drugs used), or no decolonization. The incidence of nosocomial respiratory infection was
lower in patients given well-performed (2.5%) or incorrect
(7%) decolonization (P value not given). Interestingly, the
incidence of nosocomial respiratory infection was lowest in
patients who were not decolonized (1%). However, because
patients were not randomized into treatment groups, significant underlying differences between groups, including gestational age, birth weight, NICU length of stay, exposure to
central catheters, and respiratory support, existed. To control
for these differences, investigators performed logistic regression and found that well-performed selective intestinal decolonization exerted a protective effect toward nosocomial infections of intestinal origin (OR, 0.17; 95% CI, 0.03 to 0.83). This
group of infections included respiratory tract infections, sepsis,
surgical wound infections, and urinary tract infections. The
investigators did not supply a separate analysis of the impact of
SDD on respiratory infections alone.
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
Oral Hygiene
The CDC suggests that health care facilities develop and
implement a comprehensive oral hygiene program for patients
in acute-care settings or residents in long-term care facilities
who are at high risk for health care-associated pneumonia (89).
Fitch et al. (35) demonstrated that an oral care protocol and
scores developed by a dental hygienist could be used by ICU
nurses to improve oral health in critically ill adult patients.
Mean oral inflammation scores were significantly lower after
the implementation of a standard oral care protocol using
toothpaste, antibacterial mouthwash, and oral gel (3.9 [standard error of the mean, 3.0] versus 12.4 [standard error of the
mean, 2.2]; P ⫽ 0.03). Those investigators also noted lower
mean scores for oral candidiasis, purulence, bleeding, and
plaque, but the differences were not statistically significant.
The dental hygienist and nurses’ assessments had a high degree
of interrater reliability (kappa ⫽ 0.64). The scores used in that
study were developed by one of the investigators and reviewed
by other dental faculty members but were not validated in
other patient populations. In addition, those investigators did
not examine the effect of the standard oral care protocol on the
incidence of VAP or bacterial oropharyngeal colonization.
Bergmans et al. (9) performed a prospective, randomized,
placebo-controlled, double-blind study in adult ICU patients
to determine if VAP was preventable by the modulation of
bacterial flora in the oropharynx. Those investigators compared topical prophylaxis to the buccal cavities with 2% each
gentamicin, colistin, and vancomycin (n ⫽ 87) to an Orabase
placebo group (n ⫽ 78) (group A) and a second control group
of patients admitted to an ICU where no topical preparation
was used (n ⫽ 61) (group B). Topical prophylaxis eradicated a
significantly higher proportion of organisms present on admission in the oropharynx in the treatment group than in either
control group (75% of the treatment group versus 0% in the
placebo group and 9% in the no-preparation ICU group; P ⬍
0.00001). Topical prophylaxis was also effective in eradicating
organisms from the trachea (treatment group, 52%; group A,
22%; group B, 7% [P ⱕ 0.03]). The incidence of VAP was also
lower in the treatment group (10%) than in the controls (group
A, 31% [P ⫽ 0.001]; group B, 23% [P ⫽ 0.04]). That study
concluded that preventing oropharyngeal colonization is protective against VAP, with an absolute risk reduction of 0.21
(95% CI, 0.09 to 0.33); treating five patients with topical antibiotics would prevent one case of VAP. VAP was defined
prospectively using CDC definitions and confirmed with BAL
or PSB. However, it is unclear whether the person who determined whether the patients had VAP was blinded to the treatment group. In addition, the treatment group received enteral
feeds more frequently than controls, which could alter oropharyngeal flora. The placebo group (group A) was significantly
more likely than the treatment group to receive sucralfate,
another potential confounder of oropharyngeal colonization.
Pineda et al. (73) performed a meta-analysis to determine if
oral chlorhexidine treatment reduced the incidence of VAP.
Four randomized controlled trials including 1,202 patients met
inclusion criteria for the meta-analysis. Patients in the chlorhexidine treatment group were less likely to develop VAP than
those in the control group (4% [24 of 587] versus 7% [41 of
615]), although the difference did not reach statistical signifi-
419
cance (OR, 0.42; 95% CI, 0.16 to 1.06; P ⫽ 0.07). ICU length
of stay and duration of mechanical ventilation did not differ
between the groups. Mortality was not significantly different
between the two groups (OR, 0.77; 95% CI, 0.28 to 2.11; P ⫽
0.6). The magnitude of the protective OR is striking, as is the
proximity of the CIs to statistical significance, suggesting that
additional studies with larger sample sizes might demonstrate
a significant protective effect from oral chlorhexidine rinses. Of
note, patients in those studies received either a 0.12% chlorhexidine rinse twice a day (n ⫽ 914) or 0.2% chlorhexidine gel
three times a day (n ⫽ 288).
A meta-analysis of seven randomized controlled trials (n ⫽
1,650 patients) performed by Chlebicki and Safdar (15) revealed a similar protective effect with a relative risk (RR) of
0.74 (95% CI, 0.56 to 0.96; P ⫽ 0.02) using a fixed-effects
model and a RR of 0.70 (95% CI, 0.47 to 1.04; P ⫽ 0.07) using
a random-effects model for patients treated orally with chlorhexidine. The risk reduction was even higher in cardiac surgery
patients (RR, 0.41; 95% CI, 0.17 to 0.98; P ⫽ 0.04) (15).
The Bundle Approach
In December 2004, the Institute for Healthcare Improvement (IHI) challenged hospitals to save 100,000 lives by June
2006 (21). One of the six evidence-based guidelines to be
implemented was the prevention of VAP. The VAP bundle for
adults is to (i) avoid/decrease endotracheal intubation and
duration of mechanical ventilation whenever possible, (ii) use
orotracheal and orogastric tubes to decrease the risk of hospital-acquired sinusitis, (iii) avoid heavy sedation and neuromuscular blockade with depression of cough reflexes, (iv) maintain
endotracheal cuff pressures to greater than 20 cm water, (v)
prevent condensate in tubing from entering the lower respiratory tract, (vi) maintain head-of-bed elevation at 30° to 45°,
(vii) maintain oral care, and (viii) maintain hand hygiene
(21, 67).
The team approach using the IHI bundle has been shown to
be successful in reducing VAP (21). The bundle approach has
been used at the Children’s Hospital in Boston and at Vanderbilt Children’s Hospital. In the latter, an education and intervention termed “ZAP VAP” was put into practice, with their
efforts emphasizing the IHI bundle (21). Prevention included
hand washing, elevating the head of the bed 30° to 45°, monitoring gastric residuals every 4 h to prevent aspiration, providing aggressive oral care (and documentation) every 2 h,
managing hypopharyngeal secretions, providing in-line endotracheal suction, and providing equipment care. During the
first 6 months of implementation, the time between VAP occurrences has nearly tripled.
Educational Interventions
Identifying effective measures for preventing VAP is only as
useful as the proper implementation of these measures in the
clinical setting. Many studies have shown a reduction in rates
of VAP following initiatives to educate health care workers
about the epidemiology of VAP and infection control measures used to prevent VAP (89). Most of those studies were
performed in the adult ICU setting. A recent educational intervention was performed in an integrated health system, with
420
FOGLIA ET AL.
results compared across a large adult teaching hospital, two
community hospitals, and a pediatric teaching hospital (4). The
targeted health care workers were respiratory care practitioners and nursing staff working in the ICU setting. This intervention centered on a 10-page self-study module that focused
on multiple aspects of VAP and also included posters, fact
sheets, and in-services for nursing staff and respiratory therapists. VAP rates between the 12-month preintervention period
and the 18-month postintervention period were compared.
Nursing compliance rates were highest among nurses at the
pediatric hospital (100%) and one of the community hospitals
(98.9%). The adult teaching hospital and the other community
hospital had significantly lower compliance rates among nurses
(64.9% and 44.2%; P ⬍ 0.001). Three hospitals had a significant drop in the VAP rates from the preintervention period to
the postintervention period. The VAP rate at the pediatric
hospital fell 38%, from 7.9 episodes to 4.9 episodes per 1,000
ventilator days (P ⬍ 0.001). The community hospital with no
change in the rate of VAP had the lowest compliance of
respiratory therapists compared to the other three hospital
combined (56.3% versus 95.2%; P ⬍ 0.001).
Not all lapses in infection control measures result from a
lack of knowledge. A survey of NICU health care workers was
performed to investigate the knowledge, beliefs, and practices
regarding nosocomial infections and infection control measures (56). The survey revealed some areas in which health
care workers’ actions arose from unawareness of data related
to infection control. For instance, few participants believed
that nosocomial infections were related to health care workers’
rings (40%), artificial fingernails (61%), or long fingernails
(48%). However, that study also revealed some disconnects
between knowledge and practice. Although 96% of respondents believed that using sterile techniques for catheter insertion and care reduces a patient’s risk for BSI, only 67% reported using full sterile barriers at least 76% of the time when
participating in inserting a line. Likewise, 91% of participants
believed gloves are important for preventing the spread of
nosocomial infections, but only 53% reported changing their
gloves in all indicated situations. That study demonstrated the
need for increased educational efforts to bridge the gaps in
knowledge of infection control recommendations. Additionally, the study demonstrated that a lack of knowledge alone
does not account for the lapses in infection control practices in
the NICU studied. The most common barriers to infection
control perceived by respondents included logistics (54%),
time (48%), and lack of supplies (47%).
Interventions that lower rates of VAP may have temporary
effects, with VAP rates eventually rising following the conclusion of the intervention, indicating the need for continuous
reinforcement of interventional measures (55). Factors associated with noncompliance with hand hygiene exist at the individual, group, and institutional levels (74). A proposed framework for the promotion of hand hygiene includes 12 factors: (i)
education, (ii) routine observation and feedback, (iii) engineering controls, (iv) patient education, (v) reminders in the
workplace, (vi) administrative sanctions and rewards, (vii)
change in hand hygiene agents, (viii) promotion of workers’
skin care, (ix) active participation at the individual and institutional level, (x) maintenance of an institutional safety climate, (xi) enhancement of individual and institutional self-
CLIN. MICROBIOL. REV.
efficacy, and (xii) avoidance of overcrowding, understaffing,
and excessive workload (74). The diversity of these factors
emphasizes the need for a multipronged and continuous approach necessary to maintain high levels of compliance with
infection control measures.
A summary of interventional measures to decrease the incidence of VAP in children is provided in Table 3.
Recommendations for Current Practice
and Future Research
There is scant literature regarding testing the efficacy of
head-of-bed elevation, in-line suctioning, and preferential use
of sucralfate over histamine type 2 receptor antagonists in
pediatric VAP prevention. However, head-of-bed elevation
and other measures to prevent aspiration, a consistent approach to oral hygiene, meticulous hand hygiene, and regular
assessment of readiness to wean are biologically plausible as
effective VAP prevention measures in children. Further studies
documenting that head-of-bed elevation in children decreases
aspiration and risk of pneumonia as well as determining the
natural history of aerodigestive tract colonization and its relationship to gastric acidity in children may shed light on the
risk/benefit ratio of sucralfate and/or H2 blockers and the number needed to treat to prevent pediatric VAP.
VAP TREATMENT
Treatment of suspected VAP is centered on an approach of
initial empirical therapy with broad-spectrum antibiotics followed by de-escalation to specific antimicrobial therapy once
culture results are known or discontinuation of antibiotics if
VAP is no longer suspected. The American Thoracic Society
and Infectious Disease Society of America have recently published an updated version of their evidence-based guidelines
for the management of VAP in adults (2). Key recommendations in the new document include the use of early, appropriate, and broad-spectrum antibiotics for empirical therapy; utilization of empirical antibiotics from a different class than
antibiotics that the patient has recently received; judicious use
of combination therapy in hospital-acquired pneumonia; the
potential use of linezolid as an alternative to vancomycin for
VAP caused by methicillin-resistant Staphylococcus aureus
(MRSA); the use of colistin for patients with VAP caused by
carbapenem-resistant Acinetobacter species; the potential use
of aerosolized antibiotics as adjunctive therapy for patients
with VAP caused by certain antibiotic-resistant organisms; deescalation of antibiotics based on patients’ culture results and
clinical improvement; and a shorter duration of antibiotics for
patients with uncomplicated health care-associated pneumonia
from bacteria other than nonfermenting gram-negative bacilli.
These guidelines are based on data from clinical trials of hospital-acquired pneumonia in adult patients. There have been
few clinical studies regarding the optimal treatment for VAP in
children.
Empirical Therapy
The importance of prompt initiation of appropriate empirical therapy for suspected VAP has been demonstrated in
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
421
TABLE 3. Summary of interventions to prevent VAPa
Intervention and source
(reference)
Design
Patient description
Lopriore et al. (62)
Prospective active
surveillance
Retrospective case control
361 PICU patients(37 with VAP,
324 without VAP)
155 PICU patients (13 with VAP,
142 without VAP)
Cases had higher frequency of enteral feeds
(48.6% vs 26.8%; OR, 2.58; P ⫽ 0.006)
No significant difference between cases and
controls (53.8% vs 43.6%)
Motility agents
Lopriore et al (62)
Retrospective case control
155 PICU patients (13 with VAP,
142 without VAP)
Cases had higher frequency of motility agent
use (P ⬍ 0.05) (association not significant
in logistic regression)
Matched case control
study
18 PICU patients (9 with VAP,
9 without VAP)
No significant difference between cases and
controls in head-of-bed elevation
Prospective, randomized
133 NICU patients (67 closed,
66 open)
No difference in diagnosis of nosocomial
pneumonia between groups (n ⫽ 5
patients each)
Prospective, randomized,
double-blinded
Prospective, randomized,
nonblinded
23 burn patients (11 SDD,
12 placebo)
226 PICU patients (116 with SDD,
110 without SDD)
Prospective cohort,
nonrandomized
536 neonates (58 WP SID,
88 IP SID, 392 no SID)
No difference in rates of pneumonia (1 case
in SDD group, 0 in placebo group)
SDD protective toward respiratory infection
in logistic regression (OR, 0.21; 95% CI,
0.06–0.8)
WP SID protective toward NI of intestinal
origin in logistic regression (OR, 0.17;
95% CI, 0.03–0.83).
Retrospective case control
155 PICU patients (54 ranitidine,
53 sucralfate, 48 no prophylaxis)
Prospective, randomized,
nonblinded
160 PICU patients (38 sucralfate,
42 ranitidine, 38 omeprazole,
42 no prophylaxis)
Prospective study of hand
hygiene campaign
NICU patients admitted during
hand hygiene campaign
Prospective study of
educational intervention
PICU patients at pediatric
teaching hospital
Prospective surveillance
493 NICU patients (227 before
period, 266 after period)
Non-statistically-significant decrease in VAP
rate from 3.3 to 1.0 per 1,000 ventilator
days (P ⫽ 0.22)
Meta-analysis, seven
randomized controlled
trials
1,650 patients total (n ⫽ 812
关topical chlorhexidine兴;
n ⫽ 838 关comparator兴)
Pineda et al. (73)
Meta-analysis, four
randomized controlled
trials
1202 patients total (n ⫽ 587
关chlorhexidine group兴;
n ⫽ 615 关control group兴)
Bergmans et al. (9)
Prospective, randomized,
double-blinded, placebo
controlled
Longitudinal design,
repeated measures
87 patients (treatment group), 78
patients, (control group A), and
61 patients (control group B)
ICU nurses and dental hygienist
Topical chlorhexidine reduced VAP
incidence (RR, 0.74; P ⫽ 0.02); risk
reduction was even higher in cardiac
surgery patients (RR, 0.41; P ⫽ 0.04).
Chlorhexidine group less likely to develop
VAP (4%) compared to control group
(7%)(P ⫽ 0.07); ICU length of stay,
duration of mechanical ventilation, and
mortality not significantly different
VAP incidences were less in treatment group
(10%) than in groups A (31%; P ⫽ 0.001)
and B (23%; P ⫽ 0.04)
Nurses following oral care protocols can help
improve ICU patient oral health
Enteral feeds
Almuneef et al. (1)
Head-of-bed elevation
Black et al. (10)
Closed vs open suctioning
Cordero et al. (20)
SDD
Barret et al. (7)
Ruza et al. (81)
Herruzo-Cabrera
et al. (49)
Stress ulcer prophylaxis
Lopriore et al. (62)
Yildizdas et al. (101)
Infection control
interventions
Won et al. (99)
Babcock et al. (4)
Nursing practice (decreasing
peripheral intravenous
access)
Ng et al. (69)
Oral hygiene
Chlebicki and Safdar (15)
Fitch et al. (35)
a
Outcome
No significant difference in upper airway
colonization with GNB, no significant
difference in incidence of VAP
No significant difference in VAP between
patient groups
Rate of respiratory infections dropped
from 3.35 to 1.06 per 1,000 patient days
(P ⫽ 0.002)
38% reduction in VAP rate from 7.9 to
4.9 episodes per 1,000 ventilator days
(P ⬍ 0.001)
WP, well performed; IP, incorrectly performed; GNB, gram-negative bacilli; NI, nosocomial infection.
adults, with many studies describing higher mortality in patients who received delayed appropriate treatment for VAP
(51, 59, 63). However, inappropriate use and overuse of antibiotics can lead to increased hospital expenditures and could
potentially promote antibiotic resistance (33, 83). Empirical
antibiotic therapy for suspected VAP accounts for a major
proportion of inappropriate antibiotic use in pediatric patients,
with up to 33% of patients receiving unwarranted antimicro-
422
FOGLIA ET AL.
bial therapy for suspected VAP (33). Prescribing patterns have
also shifted toward more expensive and broader-spectrum antibiotics in hospitalized children in recent years, with the proportion of total antibiotic expenditure used for vancomycin
increasing from 0.2% in 1984 to 17.2% in 1994. Additionally,
broad-spectrum cephalosporins accounted for 17.7% of antibiotic expenditures in 1984 and 49.6% in 1994 (96). Thus,
prescribing patterns for empirical therapy for suspected VAP
should maintain a balance between adequately covering patients who are potentially infected and minimizing unnecessary
and prolonged exposure to antimicrobials.
Infection with potentially antibiotic-resistant organisms accounts for a large proportion of VAP in adults (95). When
selecting empirical therapy, physicians should be aware of the
patient’s risk factors for infection with multidrug-resistant
(MDR) bacteria, the antibiotics that the patient has recently
received, and the local antibiotic resistance patterns. Risk factors for VAP with MDR pathogens in adults include mechanical ventilation for at least 7 days, prior antibiotic use, and prior
exposure to broad-spectrum antibiotics (imipenem, broadspectrum cephalosporins, or fluoroquinolones) (95). In children, it has been postulated that patients may be colonized
with organisms from their own preexisting endogenous flora in
response to antibiotic pressure (92). Risk factors for colonization with antibiotic-resistant gram-negative organisms in PICU
patients include younger age, increasing PRISM (pediatric risk
of mortality) score, previous PICU admissions, intravenous
antibiotic use in the past 12 months, and exposure to chronic
care facilities (91, 93). Additional special considerations for
the pediatric population include premature infants with an
increased risk of Staphylococcus epidermidis infections and immunocompromised patients with an additional need for empirical antifungal therapy (52).
Monotherapy for empirical coverage is recommended for
adult patients with early-onset VAP without risk factors for
infection with MDR pathogens, while combination therapy
should be used for coverage of potential infection with MDR
organisms or late-onset VAP based on a local antibiogram.
Additionally, patients should be treated with antibiotics differing in class from those that they have recently received in case
colonizing bacteria have developed antibiotic resistance from
previous exposures (2). No consensus guidelines for empirical
coverage of suspected VAP in children exist.
Empirical therapy should be discontinued or altered based on
culture results and clinical status. The fear that negative culture
results may have missed an infection in critically ill children often
leads to prolonged empirical antimicrobial therapy in neonates
(87). A study of late-onset sepsis evaluations in neonates was
undertaken to determine a sufficient time point for the discontinuation of empirical therapy. Those investigators found that 99%
of blood cultures were positive within 48 h, and investigators used
this finding as a basis for decreasing empirical coverage from 72 h
to 48 h for suspected late-onset sepsis in neonates. That study
examined cultures from sterile body sites only. Cultures from the
respiratory tract and the vagaries of diagnosing VAP may not
lend themselves to an easily defined time point for the discontinuation of empirical therapy in suspected VAP.
Singh et al. (85) used the CPIS to guide the duration of
empirical therapy in adults. Intensive care patients with newonset pulmonary infiltrate who were suspected of having pneu-
CLIN. MICROBIOL. REV.
monia were evaluated at baseline with five of the seven CPIS
items on a scale of 0 to 2 each (temperature, blood leukocytes,
tracheal secretions, oxygenation, and pulmonary radiography).
Patients with a total CPIS of ⱕ6 were considered to have a low
likelihood of pneumonia and were randomized to receive standard care as determined by their attending physician or experimental therapy with ciprofloxacin monotherapy. All patients
were reevaluated at 3 days, and of those with CPIS remaining
at ⱕ6, 100% of patients in the experimental arm had a cessation
of antimicrobial therapy, compared to 4% of patients in the standard therapy arm. There was no difference in mortality or length
of stay between treatment groups; antibiotic resistance, superinfections, or both occurred more frequently in patients receiving
standard therapy than patients receiving experimental therapy
(35% versus 15%; P ⫽ 0.017). Replication of these results in
children could offer clinical guidelines for the rapid cessation of
empirical antimicrobial therapy for suspected VAP.
Specific Treatment
Combination therapy exposes patients to multiple antibiotics
and is more expensive; a prompt de-escalation of empirical therapy to more specific antimicrobial therapy should occur once
culture results and susceptibilities are known. Monotherapy is
recommended for patients who are not at risk for infection with
MDR pathogens and for patients infected with gram-positive
pathogens including MRSA. Additionally, patients with severe
VAP should initially be treated with combination therapy but may
be changed to monotherapy if lower respiratory tract cultures do
not identify an antibiotic-resistant pathogen (2). Agents that have
demonstrated efficacy for monotherapy in adult patients infected
with susceptible organisms include fluoroquinolones, carbapenems,
cefepime, and piperacillin-tazobactam (2).
Recent interest surrounding the substitution of linezolid for
vancomycin in the treatment of VAP caused by MRSA has
emerged. A meta-analysis of two prospective, randomized,
double-blind, multicenter, multinational trials in adults with
nosocomial pneumonia comparing clinical cure from linezolid
to vancomycin was performed (100). Patients with MRSA
pneumonia who were treated with linezolid had survival that
was significantly higher than that of patients treated with vancomycin (80.0% versus 63.5%; P ⫽ 0.03). Clinical cure rates
were also higher for patients treated with linezolid than those
treated with vancomycin (59.0% versus 35.5%; P ⬍ 0.01). Both
of these effects remained significant in logistic regression models.
A prospective, randomized, open-label, multicenter, multinational trial was performed to compare the efficacy and safety
of linezolid and vancomycin for antibiotic-resistant gram-positive bacteremia and nosocomial pneumonia in hospitalized
children (53). Among patients with nosocomial pneumonia,
patients randomized to the linezolid group were more often
mechanically ventilated (63.6% versus 10.0%; P ⫽ 0.011) and
had more multiple-lobe involvement (90.9% versus 50.0%; P ⫽
0.038). No significant difference in clinical cure was seen between patients treated with linezolid and those treated with
vancomycin. However, patients treated with linezolid appeared
to experience a faster resolution of dyspnea/tachypnea/grunting than patients with vancomycin, with fewer than 40% of
patients receiving linezolid and more than 80% of patients
receiving vancomycin demonstrating these symptoms of VAP
VOL. 20, 2007
VAP IN PEDIATRIC PATIENTS
on day 3 of treatment (P value not given). Additionally, patients treated with linezolid experienced a shorter mean duration of total therapy (10.5 days versus 12.8 days; P ⫽ 0.03) and
intravenous therapy (8.5 days versus 11.3 days; P ⫽ 0.004). The
frequency of drug-related adverse events was similar between
groups. That analysis was a subset of a larger study, and it
analysis was not powered for nosocomial pneumonia or bacteremia. Other subanalyses of this same patient population
have demonstrated the safety of linezolid compared to vancomycin in children (64, 82).
Aerosolized antibiotics have been studied most extensively
in children in the setting of cystic fibrosis. The FDA approval
of tobramycin solution for inhalation is only for maintenance
therapy in patients with cystic fibrosis known to be colonized
with Pseudomonas aeruginosa (76). In two randomized controlled trials, a modest improvement in the forced expiratory
volume in 1 min occurred after 24 weeks of therapy with
tobramycin solution for inhalation; there were significant decreases in CFU/ml of Pseudomonas aeruginosa in sputum, decreases in hospital admission days, and decreases in numbers
of parenteral antibiotic days for treatment of Pseudomonas
aeruginosa infections. To our knowledge, there are no data
showing that treatment of acute pulmonary infections with
aerosolized antibiotics is beneficial in children. Inhaled aminoglycosides do produce low but measurable serum concentrations (1 to 4 ␮g/ml). Sputum concentrations vary. No ototoxicity or nephrotoxicity has been associated with the use of inhaled
aminoglycosides, although many of those studies excluded children with serum creatinine levels greater than 2. The potential
disadvantages of use include bronchospasm, increased MICs of
the targeted organism, increased isolation of Candida and Aspergillus species from sputum, nebulization of microorganisms,
and antibiotic contamination of the environment (76).
Finally, subpopulations of pediatric patients deserve special
consideration. Neurologically impaired children are at increased risk for aspiration or tracheostomy-associated pneumonia. The mixed microbiology of these infections, often including anaerobic organisms, warrants specific antimicrobial
therapy against likely pathogens. A retrospective study of 57
neurologically impaired children with aspiration or tracheostomy-related pneumonia was performed to evaluate the efficacy of various antimicrobial therapies (11). Children with
either type of pneumonia had better clinical improvement and
microbiological response when treated with agents effective
against penicillin-resistant anaerobic bacteria (ticarcillin-clavulanate or clindamycin) than patients treated with ceftriaxone
(P ⬍ 0.05 for both tracheostomy-related pneumonia and aspiration pneumonia groups). Although this was a small study
within a focused population, it underscores the need to account for unique underlying conditions in children that may
predispose them to infections with specific pathogens.
Duration of Therapy
No consensus exists regarding the appropriate duration of antimicrobial therapy for VAP in adults, and the appropriate duration for proven infections in critically ill children has not been
established (45). A multicenter, randomized, controlled trial was
performed using adults with VAP to compare patients treated
with appropriate empirical therapy for 8 days to patients treated
423
for 15 days (14). There was no difference in mortality or recurrent
infections between groups. Among patients infected with nonfermenting gram-negative bacilli, patients treated for 8 days did have
a higher relapse rate (32.8% versus 19.0%; 13.8% risk difference;
90% CI, 7.8% to 19.7%). However, among patients who experienced recurrent infections, patients treated for 8 days were less
likely to become infected with MDR pathogens (42.1% versus
62.0%; P ⫽ 0.04). These data suggest that limiting treatment of
VAP in patients infected with pathogens other than nonfermenting gram-negative bacilli is safe and may decrease the incidence of
reinfection with MDR pathogens.
Recommendations for Current Practice
and Future Research
No consensus guidelines exist for empirical coverage of suspected VAP in children.
Empirical therapy should be discontinued or altered based on
clinical status and culture results, preferably from lower airway
samples. Patients who are severely ill and/or with previous exposure to the health care system should be treated with combination
therapy. Areas for future research in children include the efficacy
of linezolid compared to vancomycin for VAP treatment, the
duration of optimal antibiotic therapy for VAP, and validation of
the CPIS in children as well as its use in treatment decisions.
CONCLUSION
VAP is the second most common hospital-acquired infection
among PICU patients. Empirical therapy for VAP accounts for
approximately 50% of antibiotic use in PICUs. VAP is associated with an excess of 3 days of mechanical ventilation among
pediatric cardiothoracic surgery patients. The attributable
mortality and excess length of ICU stay of VAP have not been
defined in matched case control studies. VAP is associated
with an estimated $30,000 in attributable cost. Surveillance for
VAP is complex and usually performed using clinical definitions
established by the CDC. Invasive testing via BAL increases the
sensitivity and specificity of the diagnosis. The pathogenesis is
poorly understood in children, but several prospective cohort
studies suggest that aspiration and immunodeficiency are risk
factors. In children, educational interventions and efforts to improve adherence to hand hygiene have been associated with decreased VAP rates. More consistent and precise approaches to
the diagnosis of pediatric VAP are needed to better define the
attributable morbidity and mortality, pathophysiology, and appropriate interventions to prevent this disease.
REFERENCES
1. Almuneef, M., Z. A. Memish, H. H. Balkhy, H. Alalem, and A. Abutaleb.
2004. Ventilator-associated pneumonia in a pediatric intensive care unit in
Saudi Arabia: a 30-month prospective surveillance. Infect. Control Hosp.
Epidemiol. 25:753–758.
2. American Thoracic Society. 2005. Guidelines for the management of adults
with hospital-acquired, ventilator-associated, and healthcare-associated
pneumonia. Am. J. Respir. Crit. Care Med. 171:388–416.
3. Apisarnthanarak, A., G. Holzmann-Pazgal, A. Hamvas, M. A. Olsen, and
V. J. Fraser. 2003. Ventilator-associated pneumonia in extremely preterm
neonates in a neonatal intensive care unit: characteristics, risk factors, and
outcomes. Pediatrics 112:1283–1289.
4. Babcock, H. M., J. E. Zack, T. Garrison, E. Trovillion, M. Jones, V. J.
Fraser, and M. H. Kollef. 2004. An educational intervention to reduce
ventilator-associated pneumonia in an integrated health system: a comparison of effects. Chest 125:2224–2231.
5. Babcock, H. M., J. E. Zack, T. Garrison, E. Trovollion, M. H. Kollef, and
424
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
FOGLIA ET AL.
V. J. Fraser. 2003. Ventilator-associated pneumonia in a multi-hospital
system: differences in microbiology by location. Infect. Control Hosp. Epidemiol. 24:853–858.
Baltimore, R. S. 1998. Neonatal nosocomial infections. Semin. Perinatol.
22:25–32.
Barret, J. P., M. G. Jeschke, and D. N. Herndon. 2001. Selective decontamination of the digestive tract in severely burned pediatric patients. Burns
27:439–445.
Bercault, N., and T. Boulain. 2001. Mortality rate attributable to ventilatorassociated nosocomial pneumonia in an adult intensive care unit: a prospective case-control study. Crit. Care Med. 29:2303–2309.
Bergmans, D. C., M. J. Bonten, C. A. Gaillard, J. C. Paling, S. van der
Geest, F. H. van Tiel, A. J. Beysens, P. W. de Leeuw, and E. E. Stobberingh.
2001. Prevention of ventilator-associated pneumonia by oral decontamination: a prospective, randomized, double-blind, placebo-controlled study.
Am. J. Respir. Crit. Care Med. 164:382–388.
Black, S. R., E. Lo, M. Madriaga, M. Zimmerman, and J. Segreti. 2002.
Nosocomial pneumonia in the PICU. Abstr. 40th Intersci. Conf. Antimicrob. Agents Chermother., abstr. K-452.
Brook, I. 1996. Treatment of aspiration or tracheostomy-associated pneumonia in neurologically impaired children: effect of antimicrobials effective
against anaerobic bacteria. Int. J. Pediatr. Otorhinolaryngol. 35:171–177.
Burmester, M., and Q. Mok. 2001. How safe is non-bronchoscopic bronchoalveolar lavage in critically ill mechanically ventilated children? Intensive Care Med. 27:716–721.
Chastre, J., F. Viau, P. Brun, J. Pierre, M. C. Dauge, A. Bouchama, A.
Akesbi, and C. Gibert. 1984. Prospective evaluation of the protected specimen brush for the diagnosis of pulmonary infections in ventilated patients.
Am. Rev. Respir. Dis. 130:924–929.
Chastre, J., M. Wolff, J. Y. Fagon, S. Chevret, F. Thomas, D. Wermert, E.
Clementi, J. Gonzalez, D. Jusserand, P. Asfar, D. Perrin, F. Fieux, S.
Aubas, and the PneumA Trial Group. 2003. Comparison of 8 vs 15 days of
antibiotic therapy for ventilator-associated pneumonia in adults: a randomized trial. JAMA 290:2588–2598.
Chlebicki, M. P., and N. Safdar. 2007. Topical chlorhexidine for prevention
of ventilator-associated pneumonia: a meta-analysis. Crit. Care Med. 35:
595–602.
Collard, H. R., S. Saint, and M. A. Matthay. 2003. Prevention of ventilatorassociated pneumonia: an evidence-based systematic review. Ann. Intern.
Med. 138:494–501.
Combes, P., B. Fauvage, and C. Oleyer. 2000. Nosocomial pneumonia in
mechanically ventilated patients, a prospective randomized evaluation of
the Stericath closed suctioning system. Intensive Care Med. 26:878–882.
Cook, D. J., B. K. Reeve, G. H. Guyatt, D. K. Heyland, L. E. Griffith, L.
Buckingham, and M. Tryba. 1996. Stress ulcer prophylaxis in critically ill
patients. Resolving discordant meta-analyses. JAMA 275:308–314.
Cordero, L., L. W. Ayers, R. R. Miller, J. H. Seguin, and B. D. Coley. 2002.
Surveillance of ventilator-associated pneumonia in very-low-birth-weight
infants. Am. J. Infect. Control 30:32–39.
Cordero, L., M. Sananes, and L. W. Ayers. 2000. Comparison of a closed
(Trach Care MAC) with an open endotracheal suction system in small
premature infants. J. Perinatol. 3:151–156.
Curley, M. A., E. Schwalenstocker, J. K. Deshpande, C. C. Ganser, D.
Bertoch, J. Brandon, and P. Kurtin. 2006. Tailoring the Institute for Health
Care Improvement 100,000 Lives Campaign to pediatric settings: the example of ventilator-associated pneumonia. Pediatr. Clin. N. Am. 53:1231–
1251.
Department of Health and Human Services. 23 August 2006, accession
date. Criteria for defining nosocomial pneumonia. http://www.cdc.gov
/ncidod/hip/NNIS/members/pneumonia/Final/PneumoCriteriaV1.pdf.
Deppe, S. A., J. W. Kelly, L. L. Thoi, J. H. Chudy, R. N. Longfield, J. P.
Ducey, C. L. Truwit, and M. R. Antopol. 1990. Incidence of colonization,
nosocomial pneumonia, and mortality in critically ill patients using a Trach
Care closed-suction system versus an open-suction system: prospective,
randomized study. Crit. Care Med. 18:1389–1393.
Donowitz, L. G. 1989. Nosocomial infection in neonatal intensive care units.
Am. J. Infect. Control 17:250–257.
Drakulovic, M. B., A. Torres, T. T. Bauer, J. M. Nicolas, S. Nogué, and M.
Ferrer. 1999. Supine body position as a risk factor for nosocomial pneumonia in mechanically ventilated patients: a randomised trial. Lancet 354:
1851–1858.
Drews, M. B., A. C. Ludwig, J. U. Leititis, and F. D. Daschner. 1995. Low
birth weight and nosocomial infection of neonates in a neonatal intensive
care unit. J. Hosp. Infect. 30:65–72.
Durand, M., B. Sangha, L. A. Cabal, T. Hoppenbrouwers, and J. E. Hodgman. 1989. Cardiopulmonary and intracranial pressure changes related to
endotracheal suctioning in preterm infants. Crit. Care Med. 17:506–510.
Elward, A. M., D. K. Warren, and V. J. Fraser. 2002. Ventilator-associated
pneumonia in pediatric intensive care unit patients: risk factors and outcomes. Pediatrics 109:758–764.
Ely, E. W., A. M. Baker, D. P. Dunagan, H. L. Burke, A. C. Smith, P. T.
Kelly, M. M. Johnson, R. W. Browder, D. L. Bowton, and E. F. Haponik.
CLIN. MICROBIOL. REV.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
1996. Effect on the duration of mechanical ventilation of identifying patients capable of breathing spontaneously. N. Engl. J. Med. 335:1864–1869.
Fabregas, N., S. Ewig, A. Torres, M. El-Ebiary, J. Ramirez, J. P. de La
Bellacasa, T. Bauer, and H. Cabello. 1999. Clinical diagnosis of ventilator
associated pneumonia revisited: comparative validation using immediate
post-mortem lung biopsies. Thorax 54:867–873.
Fagon, J. Y., J. Chastre, A. J. Hance, P. Montravers, A. Novara, and C.
Gibert. 1993. Nosocomial pneumonia in ventilated patients: a cohort study
evaluating attributable mortality and hospital stay. Am. J. Med. 94:281–288.
Fayon, M. J., M. Tucci, J. Lacroix, C. A. Farrell, M. Gauthier, L. Lafleur,
and D. Nadeau. 1997. Nosocomial pneumonia and tracheitis in a pediatric
intensive care unit: a prospective study. Am. J. Respir. Crit. Care Med.
155:162–169.
Fischer, J. E., M. Ramser, and S. Fanconi. 2000. Use of antibiotics in
pediatric intensive care and potential savings. Intensive Care Med. 26:959–
966.
Fischer, J. E., P. Allen, and S. Fanconi. 2000. Delay of extubation in
neonates and children after cardiac surgery: impact of ventilator-associated
pneumonia. Intensive Care Med. 26:942–949.
Fitch, J. A., C. L. Munro, C. A. Glass, and J. M. Pellegrini. 1999. Oral care
in the adult intensive care unit. Am. J. Crit. Care 8:314–318.
Flanagan, P. G. 1999. Diagnosis of ventilator-associated pneumonia. J.
Hosp. Infect. 41:87–99.
Flanagan, P. G., G. P. Findlay, J. T. Magee, A. Ionescu, R. A. Barnes, and
M. Smithies. 2000. The diagnosis of ventilator-associated pneumonia using
non-bronchoscopic, non-directed lung lavages. Intensive Care Med. 26:
20–30.
Foglia, E., C. Hollenbeak, V. Fraser, and A. Elward. 2006. Costs associated
with nosocomial bloodstream infections and ventilator-associated pneumonia in pediatric intensive care unit patients. Abstr. 16th Annu. Meet. Soc.
Healthcare Epidemiol. America, abstr. 109.
Ford-Jones, E. L., C. M. Mindorff, J. M. Langley, U. Allen, L. Navas, M. L.
Patrick, R. Milner, and R. Gold. 1989. Epidemiologic study of 4684 hospital-acquired infections in pediatric patients. Pediatr. Infect. Dis. J. 8:668–
675.
Forman, M. L., and E. R. Stiehm. 1969. Impaired opsonic activity but
normal phagocytosis in low-birth-weight infants. N. Engl. J. Med. 281:926–
931.
Garner, J. S., W. R. Jarvis, T. G. Emori, T. C. Horan, and J. M. Hughes.
1996. CDC definitions for nosocomial infections, p. A1–A19. In R. N.
Olmsted (ed.), APIC infection control and applied epidemiology: principles
and practice. Mosby, St. Louis, MO.
Gauvin, F., C. Dassa, M. Chaibou, F. Proulx, C. A. Farrell, and J. Lacroix.
2003. Ventilator-associated pneumonia in intubated children: comparison
of different diagnostic methods. Pediatr. Crit. Care Med. 4:437–443.
Gaynes, R. P., J. R. Edwards, W. R. Jarvis, D. H. Culver, J. S. Tolson, W. J.
Martone, and the National Nosocomial Infection Surveillance System.
1996. Nosocomial infections among neonates in high-risk nurseries in the
United States. Pediatrics 98:357–361.
Goldmann, D. A., J. Freeman, and W. A. Durbin, Jr. 1983. Nosocomial
infection and death in a neonatal intensive care unit. J. Infect. Dis. 147:
635–641.
Gordon, A., and D. Isaacs. 2004. Late-onset infection and the role of
antibiotic prescribing policies. Curr. Opin. Infect. Dis. 17:231–236.
Haas, J. P., E. A. Mendonca, B. Ross, C. Friedman, and E. Larson. 2005.
Use of computerized surveillance to detect nosocomial pneumonia in neonatal intensive care unit patents. Am. J. Infect. Control 33:439–443.
Harpin, V. A., and N. Rutter. 1983. Barrier properties of the newborn
infant’s skin. J. Pediatr. 102:419–425.
Hemming, V. G., J. C. Overall, Jr., and M. R. Britt. 1976. Nosocomial
infections in a newborn intensive-care unit. Results of forty-one months of
surveillance. N. Engl. J. Med. 294:1310–1316.
Herruzo-Cabrera, R., J. I. Garcia Gonzalez, P. Garcia-Magan, and J. del
Rey-Calero. 1994. Nosocomial infection in a neonatal intensive care unit
and its prevention with selective intestinal decolonization: a multivariant
evaluation of infection reduction. Eur. J. Epidemiol. 10:573–580.
Heyland, D. K., D. J. Cook, L. Griffith, S. P. Keenan, C. Brun-Buisson, et
al. 1999. The attributable morbidity and mortality of ventilator-associated
pneumonia in the critically ill patient. Am. J. Respir. Crit. Care Med.
159:1249–1256.
Iregui, M., S. Ward, G. Sherman, V. J. Fraser, and M. H. Kollef. 2002.
Clinical importance of delays in the initiation of appropriate antibiotic
treatment for ventilator-associated pneumonia. Chest 122:262–268.
Jacobs, R. F. 1991. Nosocomial pneumonia in children. Infection 19:64–72.
Jantausch, B. A., J. Deville, S. Adler, M. R. Morfin, P. Lopez, B. EdgePadbury, S. Naberhuis-Stehouwer, and J. B. Bruss. 2003. Linezolid for the
treatment of children with bacteremia or nosocomial pneumonia caused by
resistant gram-positive bacterial pathogens. Pediatr. Infect. Dis. J. 22:S164–
S171.
Johnson, K. L., P. A. Kearney, S. B. Johnson, J. B. Niblett, N. L. MacMillan, and R. E. McClain. 1994. Closed versus open endotracheal suctioning:
costs and physiologic consequences. Crit. Care Med. 22:658–666.
VOL. 20, 2007
55. Kelleghan, S. I., C. Salemi, S. Padilla, M. McCord, G. Mermilliod, T.
Canola, and L. Becker. 1993. An effective continuous quality improvement
approach to the prevention of ventilator-associated pneumonia. Am. J.
Infect. Control 21:322–330.
56. Kennedy, A. M., A. M. Elward, and V. J. Fraser. 2004. Survey of knowledge,
beliefs, and practices of neonatal intensive care unit healthcare workers
regarding nosocomial infections, central venous catheter care, and hand
hygiene. Infect. Control Hosp. Epidemiol. 25:747–752.
57. Kerem, E., I. Yatsiv, and K. J. Goitein. 1990. Effect of endotracheal suctioning on arterial blood gases in children. Intensive Care Med. 16:95–99.
58. Kohler, P. F., and R. S. Farr. 1966. Elevation of cord over maternal IgG
immunoglobulin: evidence for an active placental IgG transport. Nature
210:1070–1071.
59. Kollef, M. H., G. Sherman, S. Ward, and V. J. Fraser. 1999. Inadequate
antimicrobial treatment of infections: a risk factor for hospital mortality
among critically ill patients. Chest 115:462–474.
60. Labenne, M., C. Poyart, C. Rambaud, B. Goldfarb, B. Pron, P. Jouvet, C.
Delamare, G. Sebag, and P. Hubert. 1999. Blind protected specimen brush
and bronchoalveolar lavage in ventilated children. Crit. Care Med. 27:2537–
2543.
61. Liberati, A., R. D’Amico, Pifferi, V. Torri, and L. Brazzi. 2004. Antibiotic
prophylaxis to reduce respiratory infections and mortality in adults receiving intensive care. Cochrane Database Syst. Rev. 2004(1):CD000022.
62. Lopriore, E., D. G. Markhorst, and R. J. Gemke. 2002. Ventilator-associated pneumonia and upper airway colonisation with gram negative bacilli:
the role of stress ulcer prophylaxis in children. Intensive Care Med. 28:763–
767.
63. Luna, C. M., P. Vujacich, M. S. Niederman, C. Vay, C. Gherardi, J. Matera,
and E. C. Jolley. 1997. Impact of BAL data on the therapy and outcome of
ventilator-associated pneumonia. Chest 111:676–685.
64. Meissner, H. C., T. Tonwsend, W. Wenman, S. L. Kaplan, M. R. Morfin, B.
Edge-Padbury, S. Naberhuis-Stehouwer, and J. B. Bruss. 2003. Hematologic effects of linezolid in young children. Pediatr. Infect. Dis. J. 22:S186–
S192.
65. Morar, P., Z. Makura, A. Jones, P. Baines, A. Selby, J. Hughes, and R. van
Saene. 2000. Topical antibiotics on tracheostoma prevents exogenous colonization and infection of lower airways in children. Chest 117:513–518.
66. Morrow, B., and A. Argent. 2001. Risks and complications of nonbronchoscopic bronchoalveolar lavage in a pediatric intensive care unit. Pediatr.
Pulmonol. 32:378–384.
67. Munro, C. L., and M. J. Grap. 2004. Oral health and care in the intensive
care unit: state of the science. Am. J. Crit. Care 13:25–34.
68. National Nosocomial Infections Surveillance System. 2004. National Nosocomial Infections Surveillance (NNIS) System report, data summary from
January 1992 through June 2004, issued October 2004. Am. J. Infect. Control 32:470–485.
69. Ng, S. P., J. M. Gomez, S. H. Lim, and N. K. Ho. 1998. Reduction of
nosocomial infection in a neonatal intensive care unit (NICU). Singapore
Med. J. 39:319–323.
70. Papazian, L., F. Bregeon, X. Thirion, R. Gregoire, P. Saux, J. P. Denis, G.
Perin, J. Charrel, J. F. Dumon, J. P. Affray, and F. Gouin. 1996. Effect of
ventilator-associated pneumonia on mortality and morbidity. Am. J. Respir.
Crit. Care Med. 154:91–97.
71. Perkins, G. D., S. Chatterjee, S. Giles, D. F. McAuley, S. Quinton, D. R.
Thickett, and F. Gao. 2005. Safety and tolerability of nonbronchoscopic
lavage in ARDS. Chest 127:1358–1363.
72. Pessoa-Silva, C. L., R. Richtmann, R. Calil, R. M. Santos, M. L. Costa,
A. C. Frota, and S. B. Wey. 2004. Healthcare-associated infections among
neonates in Brazil. Infect. Control Hosp. Epidemiol. 25:772–777.
73. Pineda, L. A., R. G. Saliba, and A. A. El Solh. 2006. Effect of oral decontamination with chlorhexidine on the incidence of nosocomial pneumonia:
a meta-analysis. Crit. Care 10:R35.
74. Pittet, D. 2000. Improving compliance with hand hygiene in hospitals.
Infect. Control Hosp. Epidemiol. 21:381–386.
75. Pittet, D., S. Dharan, S. Touveneau, V. Sauvan, and T. V. Perneger. 1999.
Bacterial contamination of the hands of hospital staff during routine patient
care. Arch. Intern. Med. 159:821–826.
76. Prober, C. G., P. D. Walson, J. Jones, and the Committee on Infectious
Diseases and Committee on Drugs. 2000. Technical report: precautions
regarding the use of aerosolized antibiotics. Pediatrics 106:e89.
77. Raymond, J., Y. Aujard, and the European Study Group. 2000. Nosocomial
infections in pediatric patients: a European, multicenter prospective study.
Infect. Control Hosp. Epidemiol. 21:260–263.
78. Richards, M. J., J. R. Edwards, D. H. Culver, R. P. Gaynes, and the
National Nosocomial Infections Surveillance System. 1999. Nosocomial
infections in pediatric intensive care units in the United States. Pediatrics
103:e39.
79. Riedler, J., J. Grigg, and C. F. Robertson. 1995. Role of bronchoalveolar
lavage in children with lung disease. Eur. Respir. J. 8:1725–1730.
80. Rouby, J. J., E. M. De Lassale, P. Poete, M. H. Nicolas, L. Bodin, V. Jarlier,
Y. Le Charpentier, J. Grosset, and P. Viars. 1992. Nosocomial broncho-
VAP IN PEDIATRIC PATIENTS
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
425
pneumonia in the critically ill. Histologic and bacteriologic aspects. Am.
Rev. Respir. Dis. 146:1059–1066.
Ruza, F., F. Alvarado, R. Herruzo, M. A. Delgado, S. Garcia, P. Dorao, and
F. Goded. 1998. Prevention of nosocomial infection in a pediatric intensive
care unit (PICU) through the use of selective digestive decontamination.
Eur. J. Epidemiol. 14:719–727.
Saiman, L., J. Goldfarb, S. A. Kaplan, K. Wible, B. Edge-Padbury, S.
Naberhuis-Stehouwer, and J. B. Bruss. 2003. Safety and tolerability of
linezolid in children. Pediatr. Infect. Dis. J. 22:S193–S200.
Shlaes, D. M., D. N. Gerding, J. F. John, Jr., W. A. Craig, D. L. Bornstein,
R. A. Duncan, M. R. Eckman, W. E. Farrer, W. H. Greene, V. Lorian, S.
Levy, J. E. McGowan, Jr., S. M. Paul, J. Ruskin, F. C. Tenover, and C.
Watanakunakorn. 1997. Society for Healthcare Epidemiology of America
and Infectious Diseases Society of America Joint Committee on the Prevention of Antimicrobial Resistance: guidelines for the prevention of antimicrobial resistance in hospitals. Clin. Infect. Dis. 25:584–599.
Shorr, A. F., J. H. Sherner, W. L. Jackson, and M. H. Kollef. 2005. Invasive
approaches to the diagnosis of ventilator-associated pneumonia: a metaanalysis. Crit. Care Med. 33:46–53.
Singh, N., P. Rogers, C. W. Atwood, M. M. Wagener, and V. L. Yu. 2000.
Short-course empirical antibiotic therapy for patients with pulmonary infiltrates in the intensive care unit: a proposed solution for indiscriminate
antibiotic prescription. Am. J. Respir. Crit. Care Med. 162:505–511.
Sole, M. L., F. E. Poalillo, J. F. Byers, and J. E. Ludy. 2002. Bacterial
growth in secretions and on suctioning equipment of orally intubated patients: a pilot study. Am. J. Crit. Care 11:141–149.
Squire, E. N., Jr., H. M. Reich, G. B. Merenstein, B. E. Favara, and J. K.
Todd. 1982. Criteria for the discontinuation of antibiotic therapy during
presumptive treatment of suspected neonatal infection. Pediatr. Infect. Dis.
1:85–90.
Stover, B. H., S. T. Shulman, D. F. Bratcher, M. T. Brady, G. L. Levine,
W. R. Jarvis, and the Pediatric Prevention Network. 2001. Nosocomial
infection rates in US children’s hospitals’ neonatal and pediatric intensive
care units. Am. J. Infect. Control 29:152–157.
Tablan, O. C., L. J. Anderson, R. Besser, C. Bridges, R. Hajjeh, CDC, and
Healthcare Infection Control Practices Advisory Committee. 2004. Guidelines for preventing health-care-associated pneumonia, 2003: recommendations of CDC and the Healthcare Infection Control Practices Advisory
Committee. Morb. Mortal. Wkly. Rep. Recomm. Rep. 53:1–36.
Tejerina, E., F. Frutos-Vivar, M. I. Restrepo, A. Anzueto, F. Abroug, F.
Palizas, M. Gonzalez, G. D’Empaire, C. Apezteguia, A. Esteban, et al. 2006.
Incidence, risk factors, and outcome of ventilator-associated pneumonia. J.
Crit. Care 21:56–65.
Toltzis, P., C. Hoyen, S. Spinner-Block, A. E. Salvator, and L. B. Rice. 1999.
Factors that predict preexisting colonization with antibiotic-resistant gramnegative bacilli in patients admitted to a pediatric intensive care unit.
Pediatrics 103:719–723.
Toltzis, P., and J. L. Blumer. 2001. Nosocomial acquisition and transmission of antibiotic-resistant gram-negative organisms in the pediatric intensive care unit. Pediatr. Infect. Dis. J. 20:612–618.
Toltzis, P., T. Yamashita, L. Vilt, and J. L. Blumer. 1997. Colonization with
antibiotic-resistant gram-negative organisms in a pediatric intensive care
unit. Crit. Care Med. 25:538–544.
Torres, A., R. Aznar, J. M. Gatell, P. Jimenez, J. Gonzalez, A. Ferrer, R.
Celis, and R. Rodriguez-Roisin. 1990. Incidence, risk, and prognosis factors
of nosocomial pneumonia in mechanically ventilated patients. Am. Rev.
Respir. Dis. 142:523–528.
Trouillet, J. L., J. Chastre, A. Vuagnat, M. L. Joly-Guillou, D. Combaux,
M. C. Dombret, and C. Gibert. 1998. Ventilator-associated pneumonia
caused by potentially drug-resistant bacteria. Am. J. Respir. Crit. Care
Med. 157:531–539.
van Houten, M. A., M. Laseur, and J. L. Kimpen. 1998. Shift in antibiotic
prescribing patterns in relation to antibiotic expenditure in paediatrics. Eur.
J. Pediatr. 157:479–481.
van Nieuwenhoven, C. A., E. Buskens, F. H. van Tiel, and M. J. Bonten.
2001. Relationship between methodological trial quality and the effects of
selective digestive decontamination on pneumonia and mortality in critically ill patients. JAMA 286:335–340.
Webber, S., A. R. Wilkinson, D. Lindsell, P. L. Hope, S. R. Dobson, and D.
Isaacs. 1990. Neonatal pneumonia. Arch. Dis. Child. 65:207–211.
Won, S. P., H. C. Chou, W. S. Hsieh, C. Y. Chen, S. M. Huang, K. I. Tsou,
and P. N. Tsao. 2004. Handwashing program for the prevention of nosocomial infections in a neonatal intensive care unit. Infect. Control Hosp.
Epidemiol. 25:742–746.
Wunderink, R. G., J. Rello, S. K. Cammarata, R. V. Croos-Dabrera, and
M. H. Kollef. 2003. Linezolid vs vancomycin: analysis of two double-blind
studies of patients with methicillin-resistant Staphylococcus aureus nosocomial pneumonia. Chest 124:1789–1797.
Yildizdas, D., H. Yapicioglu, and H. L. Yilmaz. 2002. Occurrence of ventilator-associated pneumonia in mechanically ventilated pediatric intensive
care patients during stress ulcer prophylaxis with sucralfate, ranitidine, and
omeprazole. J. Crit. Care 17:240–245.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 426–439
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00009-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Molecular Testing in the Diagnosis and Management of
Chronic Hepatitis B
Alexandra Valsamakis*
Department of Pathology, Division of Clinical Microbiology, The Johns Hopkins Medical Institutions, Baltimore, Maryland
INTRODUCTION .......................................................................................................................................................426
HBV PROTEINS AND REPLICATION ..................................................................................................................426
EPIDEMIOLOGY .......................................................................................................................................................426
HBV INFECTION.......................................................................................................................................................427
ANTIVIRAL AGENTS................................................................................................................................................429
MOLECULAR ASSAYS IN THE DIAGNOSIS AND MANAGEMENT OF HBV INFECTION .....................430
Quantitative HBV DNA Assays: Utility ...............................................................................................................430
Molecular Tests for HBV Quantification: Available Assays and Performance Characteristics ..................432
HBV Genotyping: Utility ........................................................................................................................................433
HBV Genotyping Methods .....................................................................................................................................433
Antiviral Resistance Testing: Utility and Assays ...............................................................................................434
Detection of Core Promoter/Precore Mutations in HBeAgⴚ CHB: Utility and Assays ................................435
FUTURE TRENDS IN MOLECULAR DIAGNOSTIC TESTING FOR CHRONIC HEPATITIS B ..............435
ACKNOWLEDGMENTS ...........................................................................................................................................436
REFERENCES ............................................................................................................................................................436
ated with clinical improvement of hepatitis (reduced HBV
DNA, normalized serum aminotransferase levels, and quiescence of inflammation in the liver) (9).
HBV replicates primarily in human hepatocytes, although
viral DNA can be found in peripheral blood mononuclear cells.
Entry is mediated by envelope binding to an unknown receptor. After entry and virion uncoating, nucleocapsids are translocated into the nucleus, where cellular DNA repair enzymes
complete virion DNA synthesis. The resultant covalently
closed circular DNA (cccDNA) is the template for viral
mRNA transcription, which is mediated by host polymerase.
Replication-competent nucleocapsids comprised of core protein, encapsidated full-length pregenomic RNA, and viral polymerase are assembled in the cytoplasm. Genomic DNA is
synthesized by reverse transcription of pregenomic RNA by
viral polymerase. Encapsidated, relaxed, open circular DNA
can be transported to the nucleus to become cccDNA and
additional mRNA template, or it can be released from the host
cell via a process that requires cytosolic packaging (along with
polymerase) by envelope glycoproteins, budding into endoplasmic reticulum, and release after Golgi transit.
HBV infection is noncytolytic. Clearance of infected cells is
believed to be mediated in part by the noncytolytic intracellular activity of cytokines secreted by T cells (23). Cytotoxic T
lymphocytes also lyse infected hepatocytes and induce liver
injury (23).
INTRODUCTION
Hepatitis B virus (HBV) causes a highly complex chronic
infection that impacts a significant proportion of the world’s
population. Diagnostics for chronic hepatitis B have evolved
from the simple detection of HBsAg through the complex
antibody response against individual viral proteins and to the
detection and quantification of viral DNA. Implementation of
increasingly sensitive methods of HBV DNA quantification
has greatly aided the diagnosis and management of disease.
Assays are also available to determine HBV genotypes and to
detect the presence of viral mutants, including those that confer drug resistance and others that downregulate HBV e antigen. In this review, an overview of the virus and chronic hepatitis B infection is provided. The current utility of the different
types of molecular diagnostic tests is discussed, and the performance characteristics of the available assays are described.
HBV PROTEINS AND REPLICATION
HBV is an enveloped virus containing a 3.2-kb, partially
double-stranded, relaxed circular genome. The genomic coding scheme is extraordinarily efficient; every nucleotide is a
part of at least one open reading frame. The major viral proteins (polymerase, core, envelope, X, and e antigen) and their
activities are shown in Table 1. HBsAg and HBeAg are particularly important in the management of chronic hepatitis B.
Detectable HBsAg in serum is a marker of chronic infection.
HBeAg in serum is a marker of high viral replication levels in
the liver. Loss of HBeAg in serum and emergence of antiHBeAg antibody (termed HBeAg seroconversion) is associ-
EPIDEMIOLOGY
The worldwide burden of HBV is enormous. The World
Health Organization (WHO) currently estimates that 2 billion
people have been infected with HBV and that 360 million are
chronically infected (153). HBV is a significant contributor to
morbidity worldwide. Current estimates suggest that it causes
* Mailing address: Department of Pathology, The Johns Hopkins
Hospital, 600 North Wolfe St., Meyer B1-193, Baltimore, MD 21287.
Phone: (410) 955-5077. Fax: (410) 614-8087. E-mail: avalsam1@jhmi
.edu.
426
VOL. 20, 2007
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
427
TABLE 1. HBV proteins
Protein
Function
Envelope proteins: small
(HBsAg), medium, large........................Glycoproteins located on virion surface; bind unknown cellular receptor to initiate virion entry into
host cell
Core protein (HBcAg) ...............................Encapsidates pregenomic RNA and partially double-stranded DNA genome in cytoplasm
e antigen (HBeAg) .....................................Synthesized as precursor protein; proteolytically cleaved in endoplasmic reticulum; ultimately secreted
extracellularly and found in peripheral blood; has diverse activities, including immunomodulation
(tolerogenic) (21) and replication inhibition (45, 76, 127)
Polymerase...................................................Reverse transcriptase, RNase H (degrades pregenomic RNA template during reverse transcription),
DNA polymerase
X protein......................................................Transcriptional transactivator; cofactor for hepatocellular carcinoma (14)
30% of cirrhosis and approximately 50% of hepatocellular
carcinoma (HCC) globally (121).
HBV can be transmitted perinatally, percutaneously, and
sexually. Routes of transmission are dependent on the regional
prevalence of infection (131). In areas of high endemicity such
as Asia and the South Pacific, where seroprevalence is ⱖ8%,
most infections are acquired perinatally or horizontally during
childhood. In regions of intermediate seroprevalence (2 to
7%), such as sub-Saharan Africa, Alaska, the Mediterranean,
and India, infection is transmitted during childhood (perinatally or horizontally) and later in life (sexually, by intravenous
drug use, or by unsafe health care-related injection practices).
In low-prevalence regions (most of the developed world and
parts of Central and South America; seroprevalence, ⬍2%),
HBV is usually transmitted sexually and by intravenous drug
use.
Historically, the scheme for distinguishing HBV subtypes
was based on surface antigen serotyping. The current scheme
is genetically based, with a genotype defined as greater than
8% divergence of the complete genome sequence at the nucleotide level (110). Eight genotypes (A to H) have been defined (6, 105, 109, 110, 136). HBV genotypes have distinct
geographic distributions (128) (Fig. 1). Multiethnic populations tend to have multiple genotypes (25).
HBV INFECTION
HBV can cause acute and chronic infection. The incubation
period between exposure and clinical presentation of acute
infection is 1 to 4 months. The likelihood of development of
symptomatic acute infection is age related, with a small proportion of cases (approximately 10%) occurring in children
younger than 4 years old and a greater proportion (approximately 30%) in adults older than 30 years (99). Symptoms of
acute HBV infection are similar to other causes of acute hepatitis, including influenza-like syndrome and right upper-quadrant pain. The clinical syndrome of acute hepatitis B has been
well described and is diagnosed through the detection of viral
proteins and host anti-HBV antibodies (53, 70). There is currently no role for molecular testing in the diagnosis of acute
hepatitis B other than in the detection of asymptomatic patients during pretransfusion screening of blood products (67,
71). In contrast, chronic hepatitis B has been evolving as a
clinical concept, and various paradigms have been utilized and
FIG. 1. Geographic distribution of HBV genotypes. Letter sizes indicate relative prevalences in regions with multiple genotypes. Lowercase
letters indicate HBV subtypes.
428
VALSAMAKIS
CLIN. MICROBIOL. REV.
TABLE 2. Useful markers for distinguishing chronic hepatitis B phases
Phase
ALT
HBsAg
HBeAg
HBeAg antibody
HBV DNA
(IU/ml)a
Immune tolerance
Usually normal
Present
Present
Absent
ⱖ20,000
Immune clearance
Present
Present
Absent
ⱖ20,000
Inactive HBsAg
carrier
Elevated; can be
episodic
Usually normal; can
have flares
Present
Absent
Present
⬍20,000*
HBeAg⫺ CHB
Periodic flares
Present
Absent
Present
Occult hepatitis B
Can be elevated
Absent
Absent
Present in recovered
HBV infection
⬎20,000 or
⬍20,000
⬍20,000†
a
Liver histology
Usually normal; can have mild
inflammation
Active inflammation
Degree of abnormality dependent on
disease severity during clearance
phase (mild inflammation to
inactive cirrhosis)
Active inflammation
Ranges from normal to cirrhosis and
HCC
Symbols: *, can be undetectable by PCR; †, usually (often detectable only with highly sensitive molecular tests).
discarded. Importantly, molecular assays have begun to play
increasingly significant roles in chronic hepatitis B. The content of this review is therefore focused on chronic hepatitis B
and the commercial molecular assays that are available for its
diagnosis and management.
The probability of progression from acute to chronic hepatitis B infection is in part dependent on when acute infection
occurs (158). The highest rates of chronicity are observed as a
consequence of perinatal acquisition (90%) and in children
less than 5 years of age who are infected horizontally through
household contacts (25 to 30%). The incidence of chronic
infection is lowest after acute infection during adulthood
(⬍10%).
A paradigm of four phases of chronic infection, consisting of
immune tolerance, immune clearance, inactive carrier, and
HBeAg-negative chronic hepatitis B (HBeAg⫺ CHB), is now
widely accepted; however, not all patients go through each of
the four phases (158). Markers that are helpful in distinguishing these phases are depicted in Table 2. The first phase,
immune-tolerant chronic HBV, is observed primarily in perinatally acquired infection; it is characterized by high levels of
viral replication (HBeAg seropositivity, high levels of HBV
DNA in peripheral blood) and normal to minimally elevated
alanine aminotransferase (ALT) levels indicating mild hepatitis, if any. This phase can last for decades. It occurs variably
when infection is acquired later in childhood or as an adult.
The immune tolerance phase is fairly benign, with a low incidence of cirrhosis and HCC. In a longitudinal study of HBsAgpositive Taiwanese adults who likely acquired infection perinatally, the annual incidence of cirrhosis was 0.5%, the
cumulative probability of cirrhosis after 17 years was approximately 13%, and no HCC was observed during a mean follow-up period of 10.5 years (27). The majority of patients
(85%) underwent HBeAg seroconversion between the ages of
20 and 39.
The second phase, immune clearance, is associated with
HBeAg seropositivity, high or variable HBV DNA concentrations in peripheral blood, periodic abnormalities in liver enzymes, and histologic evidence of active inflammation (158).
The overall risk of progression to cirrhosis and HCC is directly
related to disease activity during this phase, including overall
duration and the number and severity of flares (26). This inflammatory phase also leads commonly to HBeAg seroconver-
sion and entry into inactive HBsAg carrier status (the third
phase of chronic infection). Spontaneous HBeAg seroconversion has been observed in 66% to 98% of prospectively studied
cohorts (26) and occurs at an estimated rate of 10% per year
(10, 100).
Patients in the inactive HBsAg carrier state have normal
liver enzymes and are HBeAg negative and anti-HBe antibody
positive. Most individuals have low HBV DNA levels in peripheral blood (⬍5.0 log10 copies/ml); a minority have undetectable viral loads by PCR (165). Biopsy findings can range
from mild inflammation and minimal fibrosis to inactive cirrhosis if disease was severe during immune clearance (158).
The HBsAg carrier state can have a number of potential
outcomes, including indefinite persistence, resolution of
chronic infection (manifested by HBsAg clearance and appearance of anti-HBsAg antibody), or disease reactivation due either to recrudescence of the original infection or the emergence of mutant viruses that fail to express HBeAg (HBeAg⫺
CHB). Approximately 70% of patients remain as inactive carriers indefinitely; however, their course and outcome are not
necessarily benign. ALT flares have been observed in 33% of
inactive carriers (55). In addition, ongoing inflammation can
cause progressive liver disease. Cirrhosis and HCC were observed in 8% and 2% of patients after HBeAg seroconversion
(55). Clearance of HBsAg and the emergence of anti-HBsAg
antibody has been reported to occur at a rate of 0.5% to 0.8%
per year (82, 100). Half of these patients continue to have
detectable HBV DNA (82, 100). A small proportion of inactive
carriers serorevert to HBeAg-positive status (HBeAg seroreversion). In two Asian cohorts, 3 to 4% of HBeAg-negative
patients experienced HBeAg seroreversion during long-term
follow-up (55, 165). Higher seroreversion rates (14%) were
observed in an Alaskan cohort (100).
The fourth phase of chronic infection, HBeAg⫺ CHB, is
characterized by lack of detectable HBeAg, the presence of
anti-HBeAg antibody, detectable HBV DNA, fluctuating liver
enzymes, and active inflammation upon biopsy (Table 2). Progression to this phase occurs spontaneously or in the setting of
immune suppression in inactive carriers. Some patients can
progress directly from HBeAg⫹ CHB to HBeAg⫺ CHB (55).
Replicating viruses have mutations that prevent HBeAg expression, including two sequence changes in the basal core
promoter that drives HBeAg transcription (A1762T and
VOL. 20, 2007
G1764A) (110) or a stop codon in the second-to-last codon of
the precore region (codon 28, nucleotide 1896) (12). These
mutations can occur singly or in combination. The stop codon
mutation is found only after infection with certain genotypes,
due to constraints imposed by secondary structure (46). Nucleotide 1896 is base-paired to nucleotide 1858 within a stem
loop structure required for HBV replication. Nucleotide 1858
varies according to genotype (T or U in B, D, E, G and some
C strains; C in A, F, and some C strains). The G-to-A stop
codon mutation at nucleotide 1896 stabilizes the stem loop in
B, D E, G, and some C strains. The opposite effect occurs in A,
F, and some C strains, likely leading to a relative lack of
replicative fitness. The stop codon mutation is therefore found
in infections with genotypes B, D, E, and G (and some C
strains).
HBeAg⫺ CHB was once thought to be uncommon outside
the Mediterranean region, but it is now recognized to be variably prevalent, ranging from 15% of total chronic hepatitis B in
the United States, northern Europe, and Asia-Pacific to 33%
in the Mediterranean region (38). The prevalent mutation
(basal core promoter versus stop codon) varies by geographic
locale, with the basal core promoter mutation found in Asia
(median, 77%) and the stop codon mutation found in the
Mediterranean region (median, 92%), likely due to the genotypes present in each region (38).
Occult hepatitis B infection, defined as detectable HBV
DNA in peripheral blood or liver by sensitive nucleic acid
detection methods in patients without detectable HBsAg, is
now widely recognized to occur, although it has not been discussed as a phase of chronic hepatitis B in any recent guidelines. Occult hepatitis B has been observed in patients with
unexplained liver disease (hepatocellular carcinoma and cryptogenic cirrhosis), in HBV-seropositive individuals with resolving or recovered chronic infection (spontaneously or after interferon [IFN] therapy), and in HBV-seronegative patients
without evidence of liver disease, such as hemodialysis patients
and blood donors (11, 20, 44, 101, 102, 139). Although data
from properly designed cross-sectional studies are lacking, the
available data suggest that the prevalence of occult HBV is
correlated to the rate of endemic infection (29). Within a given
population, occult HBV appears to be found more frequently
in patients with evidence of liver disease than in other subjects.
For example, occult hepatitis B was found in 16% of North
American patients with HCC (62) versus 2% of hepatitis B
core antibody-positive blood donors (50) and 4% of hemodialysis patients (101). Occult HBV is found more frequently in
patients with serologic evidence of HBV infection (anti-hepatitis B core antibody positive) than in core antibody-negative
individuals (11, 102). Finally, occult HBV is found in a significant proportion of patients with chronic hepatitis due to hepatitis C virus, with HBV DNA detectable in up to 30% of
serum samples and 50% of liver biopsies (11).
Although viruses with replication deficits could theoretically
explain occult HBV, the finding of cccDNA, RNA transcripts,
and pregenomic replicative RNA intermediates in a large proportion of patients suggests that most occult infections are due
to low-level replication of wild-type virus (97, 98). In addition,
the transmissibility of acute HBV via liver transplant or blood
product transfusion from donors with occult infection (5, 85,
88) provides evidence against the presence of defective viruses.
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
429
Occult HBV may also result from mutations in HBsAg coding or transcription control regions that alter antigenicity or
expression levels (19, 54, 61). Such mutant viruses have been
reported as the sole circulating strain in up to 40% of patients
with occult HBV (2, 15, 54, 101). A higher prevalence of
HBsAg mutants (⬃60%) in individuals with occult HBV from
an isolated Inuit community has recently been reported and
awaits further study (102).
Serum virus loads in occult HBV cases are usually below the
limits of detection of hybridization assays, and detection usually requires more-sensitive methods, such as nested or realtime PCR. In anti-core antibody-positive individuals with occult HBV, virus loads are usually ⬍10,000 copies/ml, or ⬍2,000
IU/ml with the approximate conversion factor of 5 copies per
international unit for PCR methods (50, 68, 102, 108). A single
study reported viral loads of ⬎4 million copies/ml in anti-core
antibody-positive individuals (145); however, further description of patients with such high-titer viremia was not provided.
The consequences of occult HBV infection are not clear.
Given the prevalence of HBV DNA in the livers of affected
patients (11, 20), it may play a role in the development of
cirrhosis and HCC. However, an overall risk of disease progression has not been defined. In hepatitis C virus-infected
patients, the data on the effects of occult HBV on fibrosis are
conflicting, with some studies documenting more-severe fibrosis (139) and others demonstrating no effect (57). However, a
number of studies suggest that occult HBV is associated with
an increased risk of HCC in chronic hepatitis C (104, 134, 139).
There are currently no consensus guidelines for diagnosis of
occult HBV. Testing has been advocated for a variety of settings, including cryptogenic liver disease, impending immunosuppression in patients with HBV risk factors (who may experience flares), and isolated positivity for core antibody, since
the presence of HBV DNA may affect solid-organ-donation
and HBV vaccination decisions (29, 139). From the perspective
of diagnostic yield, liver biopsy samples may be better specimens than serum, as HBV DNA positivity rates have been
found to be higher in liver than in serum in studies of paired
samples (2, 11, 40, 162). There are currently no available reports on treatment for occult HBV.
ANTIVIRAL AGENTS
Six drugs have been approved by the U.S. Food and Drug
Administration for therapy of chronic hepatitis B, including
IFN-␣, pegylated IFN-␣, lamivudine, adefovir dipivoxil, entecavir, and telbivudine (Table 3). Tenofovir disoproxil fumarate
is currently not approved for use in chronic hepatitis B but has
been shown to be effective in human immunodeficiency virus
type 1 (HIV-1)/HBV-coinfected patients (Table 3). IFN-␣
(and pegylated formulations) is the only drug that eliminates
cccDNA from hepatocytes and is therefore potentially curative. In comparison, prolonged treatment with other agents is
required due to greater relapse rates. The therapeutic gain of
this approach is balanced by the potential emergence of antiviral resistance. The incidence of resistance varies among the
different drugs (Table 3). The highest rates are observed for
lamivudine; reported resistance to other nucleoside and nucleotide reverse transcriptase inhibitors is much lower.
430
VALSAMAKIS
CLIN. MICROBIOL. REV.
TABLE 3. Antiviral therapeutics for chronic hepatitis B
Drug
a
Mechanism of actionb
Efficacyc
⫹
Resistance
IFN-␣
Immune-mediated clearance
HBeAg CHB: 20% greater VR, 6% greater CR than
untreated controls (150)
HBeAg⫺ CHB: avg 24% SR-12 vs 0% for untreated
controls (91)
None
Pegylated IFN-␣2a
and IFN-␣2b*
Immune-mediated clearance
HBeAg⫹ CHB: 10% greater BR and VR at 6 mo
posttreatment than with lamivudine (13, 79); pegylated
IFN-␣2a and IFN-␣2b similarly efficacious (60, 79)
HBeAg⫺ CHB: 15% greater BR and VR 6 at mo
posttreatment than with lamivudine (95)
No added benefit of combined pegylated IFN plus
lamivudine for HBeAg⫹ or HBeAg⫺ CHB (60, 79, 95)
None
Lamivudine
NRTI; cytidine analog
12-mo regimen: BR and VR at 12 mo posttreatment 10–15%
greater than untreated controls for HBeAg⫹ and HBeAg⫺
CHB (46, 91)
Prolonged treatment: HBeAg seroconversion rates
progressively increase to 50% after 5 yr in HBeAg⫹ CHB;
BR and VR peak after 24–36 mo (⬃50%) and then
decline in HBeAg⫺ CHB (91)
HBeAg⫹ and HBeAg⫺ CHB: 1 yr,
20%; 2 yr, 40%; 3 yr, 60%; 4–5
yr, 70% (18, 80, 115)
Adefovir dipivoxil
NRTI; dATP analog (chain
terminator)
HBeAg⫹ CHB (end of treatment): VR, ⬃20%; BR, ⬃50%
(compared to placebo) (94)
HBeAg⫺ CHB: VR, 70%; BR, 40% (47)
HBeAg⫹ and HBeAg⫺ CHB: 1 yr,
0% (47, 149)
HBeAg⫺ CHB: 2 yr, 3%; 3 yr, 6%
(47); 5 yr, 29% (48)
Entecavir
2⬘-Deoxyguanosine analog; inhibits
polymerase priming activity and
chain elongation
HBeAg⫹ CHB: higher rates of undetectable DNA by
PCR at end of treatment than with lamivudine; HBeAg
loss, seroconversion, and BR equivalent to that with
lamivudine (17)
HBeAg⫺ CHB: higher rates of undetectable DNA by PCR
at end of treatment than with lamivudine; BR equivalent
to that with lamivudine (75)
HBeAg⫹ and HBeAg⫺ CHB: 1 yr,
0% (17, 75); lamivudineresistant strains have reduced
susceptibility in vitro (155) and
in vivo (28)
Telbivudine
NRTI; dTTP analog
Not yet published in peer-reviewed literature
High-level cross-resistance to
lamivudine in vitro (155)
Tenofovir disoproxil
fumarate
NRTI; dATP analog (chain
terminator)
HIV-1/HBV coinfection: undetectable DNA by PCR in 30–
75% of patients (8, 73)
HBV monoinfection: undetectable DNA by PCR in 80–100%
of patients (72, 141)
1 yr, 0% (30)
Emtricitabine
NRTI; nucleoside analog of
cytidine
Improved histology, higher rates undetectable DNA by
PCR, normalized ALT compared to controls (83);
approved for use with HIV-1; may be useful in
HIV-1/HBV coinfection (133)
1 yr, 13% (83); 2 yr, 18% (42);
high-level cross-resistance to
lamivudine in vitro (155)
a
*, IFN-␣2b is not currently FDA approved for treatment of chronic hepatitis B.
NRTI, nucleoside reverse transcriptase inhibitor (causes chain termination).
VR, virologic response (decrease in serum HBV DNA level to ⬍1 ⫻ 105 copies/ml and loss of HBeAg in patients with HBeAg⫹ CHB); CR, complete response
(combined virologic response, biochemical response, and loss of HBsAg); SR-12, sustained response 12 months after therapy cessation; BR, biochemical response
(normalization of ALT).
b
c
MOLECULAR ASSAYS IN THE DIAGNOSIS AND
MANAGEMENT OF HBV INFECTION
Four types of molecular assays are available for the diagnosis and management of HBV infection: quantitative viral load
tests, genotyping assays, drug resistance mutation tests, and
core promoter/precore mutation assays. Viral load tests that
quantify HBV in peripheral blood (serum or plasma fractions)
are currently the most useful and most widely used. The applications of other assays are currently more specialized, and
their use is more limited. The utility of these assays and their
performance characteristics are reviewed below.
Quantitative HBV DNA Assays: Utility
Practice guidelines for the management of chronic hepatitis B
have been published by a number of professional societies (32, 65,
81, 90). These consensus documents recommend the quantifica-
tion of HBV DNA in the initial evaluation of chronic hepatitis B
and during management, particularly in the decision to initiate
treatment and in therapeutic monitoring. High-sensitivity molecular assays are clearly important for the diagnosis of HBeAg⫺
CHB and occult HBV, where viral loads can be quite low.
Detectable HBV DNA in plasma or serum is one of the
criteria for chronic hepatitis B in all guidelines. Assessment of
HBV DNA in plasma or serum should therefore be performed
along with other tests to establish this diagnosis. Several guidelines (65, 90, 91) specify a threshold of ⱖ20,000 IU/ml (100,000
copies/ml) for active viral replication during HBeAg⫹ CHB.
This value corresponds to the limit of detection of hybridization-based quantitative HBV DNA assays and was originally
proposed in an early consensus statement on HBV management (89) without much supporting evidence. Subsequent
studies have demonstrated that ⬃90% of patients with
HBeAg⫹ CHB had viral loads of ⬎20,000 IU/ml (24) and 98%
VOL. 20, 2007
of inactive HBsAg carriers consistently had levels of ⬍20,000
IU/ml (96), suggesting that this threshold is reasonable.
Measurement of HBV DNA is critical for the diagnosis and
management of HBeAg⫺ CHB (core promoter, precore stop
mutation), as it is the only marker of viral replication that can
be monitored. Distinguishing HBeAg⫺ CHB from the inactive
carrier state can be difficult due to fluctuating ALT and HBV
DNA levels. A cutoff of 2,000 IU/ml was found to optimally
differentiate HBeAg⫺ CHB from the inactive carrier state after short-term and long-term follow-up, particularly in patients
with normal ALT levels (93, 166). Application of a higher
threshold (20,000 IU/ml) was not found to be useful in this
setting given the inability to identify 30% of patients with
HBeAg⫺ CHB even after multiple sequential tests (24). Despite the observed predictive value of the 2,000-IU/ml threshold, serial testing should be performed in patients with low
HBV DNA and normal ALT levels to optimally distinguish the
inactive carrier state from HBeAg⫺ CHB (32). Viral loads can
fall below the detection limit of low-sensitivity hybridizationbased assays in 40 to 60% of patients with HBeAg⫺ CHB (93);
therefore, more-sensitive assay formats should be used in this
setting.
The detection of HBV DNA in peripheral blood (plasma or
serum) is also important to establish the diagnosis of occult
HBV (by definition, detectable HBV DNA in peripheral blood
or liver in the absence of HBsAg). Testing for occult hepatitis
B has been recommended in the following settings: (i) in cryptogenic liver disease, especially if serology is positive for previous exposure to HBV (anti-core antibody-positive individuals); (ii) prior to immunosuppression, due to the potential for
hepatitis flares; and (iii) in solid organ transplant donors whose
only serological marker of HBV infection is anti-core antibody,
due to the potential for transmission (29, 139).
There is general agreement between practice guidelines that
the decision to initiate therapy should be based on the demonstration of active viral replication (defined as an HBV DNA level
of ⱖ20,000 IU/ml in HBeAg⫹ CHB) and moderate to severe
disease, as evidenced by persistent ALT elevation (3 to 6 months)
and/or histologic demonstration of moderate to severe hepatitis
(32, 65, 81, 90). HBV DNA levels are not primary determinants of
therapy, because viral loads are not necessarily reflective of disease severity. Median viral loads in inactive chronic hepatitis B
are lower than in HBeAg-positive patients; however, there is
some overlap in viral load between individuals in these phases (66,
96, 129). Cirrhosis has also been observed in patients with low
viral loads (⬍2,000 IU/ml) (160).
One recent set of treatment guidelines (65) has applied viral
load thresholds more extensively than others. For example,
these guidelines suggest that viral loads can be helpful in the
decision to obtain a biopsy from HBeAg⫹ CHB or HBeAg⫺
CHB patients with normal ALT levels. Individuals with viral
loads greater than threshold (20,000 IU/ml for HBeAg⫹ CHB;
2,000 IU/ml for HBeAg⫺ CHB) may benefit from biopsy to
identify histologic evidence of disease requiring initiation of
treatment. Additionally, these guidelines recommend treatment for patients with compensated cirrhosis and viral loads
greater than 2,000 IU/ml, while those with lower viral loads
could either be treated or observed. Of note, the threshold for
HBeAg⫹ CHB without cirrhosis (20,000 IU/ml) was greater
than that for HBeAg⫺ CHB and for compensated cirrhosis
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
431
(2,000 IU/ml), largely reflecting the lower viral loads associated with the latter two states.
Once the decision to treat has been made, viral load testing
is useful at baseline to predict the response to antivirals and
the emergence of antiviral resistance, particularly to lamivudine (16, 74). Low viral loads are associated with response to
IFN-␣ (120) and pegylated IFN-␣ (60) in patients with
HBeAg⫹ CHB. The influence of pretreatment viral load on
IFN responsiveness in HBeAg⫺ CHB has not been reported.
The value of baseline viral load as a predictor of response to
lamivudine appears to depend on the patient cohort. In
HBeAg⫹ CHB, it has not been found to be a significant variable
for initial response, defined as HBeAg loss (52, 119), but was
found to be associated with relapse (143). In HBeAg⫺ CHB, high
viral loads were observed to be associated with lack of response to
lamivudine (116). The influence of pretreatment viral load on
response and the emergence of resistance to newer nucleoside/
nucleotide antivirals has not yet been reported.
Viral load measurement plays a significant role during therapy, as most guidelines propose that suppression of HBV replication is a major therapeutic goal. Measurement of viral load
at 3- to 6-month intervals during treatment has been recommended (32, 81). Monitoring intervals can also be guided by
specific treatment, with shorter intervals (every 3 months) for
lamivudine and longer intervals (at least every 6 months) for
other nucleoside/nucleotide reverse transcriptase inhibitors
due to the more rapid emergence of resistance during lamivudine therapy (65).
The treatment duration for IFN is relatively fixed (4 to 6
months for HBeAg⫹ CHB; 12 to 24 months for HBeAg⫺
CHB). However, viral load measurement is helpful in determining when to end treatment with nucleoside/nucleotide reverse transcriptase inhibitors. One study has suggested that
viral load can be used as a primary end point to assess the
response to nucleoside antiviral therapy, since a correlation
between a decline in viral load, an improved histologic necroinflammatory score, and HBeAg seroconversion was observed
(103). However, most guidelines also incorporate serologic
testing (HBeAg and anti-HBeAg antibody to assess HBeAg
seroconversion) in patients with HBeAg⫹ CHB. In this setting,
therapy can be stopped 4 to 12 months after HBeAg seroconversion occurs and HBV DNA levels decrease to less than
20,000 IU/ml (32, 90) or become undetectable by PCR (⬍40
IU/ml) (65, 81). Data documenting the relative utility of high
(20,000 IU/ml) versus low (40 IU/ml) thresholds are not available. In HBeAg⫺ CHB, HBV DNA is the only virologic
marker that can guide the decision to end treatment; however,
no specific stopping point for nucleoside/nucleotide reverse
transcriptase inhibitors has been recommended in practice
guidelines largely due to the higher relapse rates in these
patients (37, 116).
The identification of nonresponders through determination
of viral load kinetics at early time points posttreatment compared to baseline has become the standard of care in pegylated
IFN/ribavirin treatment for chronic hepatitis C. A similar paradigm for chronic hepatitis B therapy has not yet been
adopted, largely due to the lack of trials designed to address
this question; however, preliminary data are emerging. In one
recent study of IFN-␣ treatment in HBeAg⫹ CHB, nonresponders could be predicted accurately at week 8 and week 12
432
VALSAMAKIS
CLIN. MICROBIOL. REV.
TABLE 4. Commercially available assays and reagents for HBV DNA quantification
Test or reagent
(manufacturer)
Method
Analytical
sensitivitya
Linear rangea
Reference(s)
IU/ml Copies/ml
RealTime HBV PCR (Abbott
Molecular)
Real-time PCR
Hybrid Capture II (Digene)
Hybrid capture
COBAS Amplicor HBV
Monitor (Roche
Diagnostics)
COBAS TaqMan HBV
(Roche Diagnostics)
Europe, CE; United States,
ASR
5
1.9 ⫻ 105–1.7 ⫻ 109
3.0 ⫻ 106–1.0 ⫻ 109
107
118
United States, RUO
8 ⫻ 103
8.0 ⫻ 103–1.7 ⫻ 109
107
United States, RUO
56
Europe, CE; United States,
not available
1.9 ⫻ 10
54–3.6 ⫻ 109
Real-time PCR
2.5 ⫻ 10 –1.0 ⫻ 10
2
9
2 ⫻ 102
Semiautomated PCR
135
2.0 ⫻ 102–2.0 ⫻ 105
1 ⫻ 10 –3 ⫻ 10
3
Real-time PCR
5
8
54–1.1 ⫻ 108‡
30–1.1 ⫻ 108§
6–2.1 ⫻ 108¶
3.3 ⫻ 103
69, 90
Europe, CE; United States,
RUO
118
1.7 ⫻ 10 –8.5 ⫻ 10 †
2
35†
12‡
⬃35§
⬃2.5¶
VERSANT HBV DNA 3.0
bDNA
(Siemens Medical Solutions
Diagnostics)
Regulatory statusb
Copies/ml
9–4 ⫻ 109*
4*
Ultrasensitive Hybrid Capture Hybrid capture
II (Digene)
Artus HBV PCR (QIAGEN
Diagnostics)
IU/ml
146
Europe, CE; United States,
ASR, RUO (with
HighPure extraction)
51
124
39
3.3 ⫻ 103–1.0 ⫻ 108
156
Europe, CE; United States,
RUO
a
Symbols: *, data from company website (http://www.international.abbott.molecular.com/HBVPCRkit_1137.asp); †, nucleic acid extraction with HighPure (Roche
Diagnostics); ‡, extraction with COBAS AmpliPrep and HBV-specific chemistry (Roche Diagnostics); §, extraction with COBAS AmpliPrep and Total Nucleic Acid
chemistry (Roche Diagnostics); ¶, extraction with MagNAPure (Roche Diagnostics).
b
CE, Conformité Européen (approval according to European In Vitro Diagnostic Directive 98/79/EC); ASR, analyte-specific reagent; RUO, research use only.
of treatment, although sustained responders were identified
more accurately by measuring the response at week 12 (142).
HBV viral load measurement has been widely recommended
as part of a panel of follow-up tests (including transaminases
and HBeAg/HBeAg antibody, if relevant) to assess the durability of the antiviral response after treatment cessation. Recommended posttreatment monitoring intervals vary from every 1 to
3 months for 12 months and then every 6 to 12 months (32) to
monthly for 3 months then once again at 6 months, with continued monitoring only for nonresponders to identify delayed therapeutic responses or the need to reinitiate treatment (81).
Molecular Tests for HBV Quantification: Available
Assays and Performance Characteristics
First-generation assays for HBV DNA quantification in peripheral blood (usually serum or plasma) were based on solution hybridization technology and measured HBV DNA in
picograms per milliliter. Solution hybridization was successful
due to high viral loads in many patients with chronic hepatitis
B. This assay was relatively insensitive (approximately 5.0 log10
copies/ml), and its linearity ranged from 5.0 to 10.0 log10 copies/ml (90). Adaptation of advanced molecular technologies,
such as signal and target amplification, led to the development
of second-generation assays with enhanced sensitivity (as low
as 200 copies/ml) (117).
The latest generation HBV quantification assays utilize realtime PCR and have improved analytical performance characteristics, including low limits of detection, broad linear ranges,
and excellent precision (Table 4). These advances have been
demonstrated to translate into better clinical performance as
manifested by better detection of low virus concentrations and
elimination of specimen dilution for a large proportion of
specimens with high viral loads (43, 56).
A WHO international standard was created in response to
the need for standardization of quantification (126). This virus
preparation (code 97/746) was based on a high-titer genotype
A EUROHEP reference preparation (49). Results are reported in international units per milliliter for most currently
available assays. In the current WHO HBV standard preparation, 1 IU is equivalent to 5.4 genome equivalents (copies).
However, accurate conversion factors are likely to be dependent on the chemistry used for HBV DNA quantification. In
support of this, PCR-based quantification assays were demonstrated to have similar conversion factors (Amplicor, 7.3 copies
per IU; SuperQuant, 6.2 copies per IU) that were higher than
those for bDNA (VERSANT, v2.0, 4.5 copies per IU) and
Hybrid Capture II (2.3 copies per IU) (132).
Significant variability in quantification among different assays can occur randomly (39, 69) despite the standardization of
reporting units and the finding of generally good correlation between different assays (56, 77, 122). Patients should therefore be
monitored with a single assay.
The HBV genotype is a variable that may influence quantification by different methods. Genotype F-dependent underquantification by conventional PCR (COBAS Amplicor Monitor) has been observed (77, 146). For real-time PCR, no bias
in amplification has been observed (51, 146). Quantification by
the Hybrid Capture II and Ultrasensitive Hybrid Capture II
VOL. 20, 2007
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
tests also appears to be free of genotype-dependent bias (107).
Data on genotype influence in quantification by VERSANT
HBV DNA 3.0 have not been published.
Results of specificity studies have been reported for most of
the assays described in Table 4. Excellent results (⬎97%) have
been obtained in studies using samples from HBV-seronegative subjects (51, 107, 118, 146, 156). Problems with reproducibility at concentrations near the limits of quantification of
Hybrid Capture II and Ultrasensitive Hybrid Capture II have
been described (25 to 40% of samples originally determined to
have 5,000 to 10,000 copies/ml were undetectable after repeat
testing), suggesting that implementation of an equivocal zone
should be considered for these assays (69). False-positive results (ranging from 1 to 3%) at the lower limit of quantification
of VERSANT HBV DNA 3.0 have also been observed (39,
124, 156).
Real-time PCR assays have utilized a number of different
methods for extraction of HBV DNA. Automated extraction
methods with COBAS AmpliPrep (Roche Diagnostics) and
MagNAPure (Roche Diagnostics) have been reported for
RealArt HBV LC PCR reagents (Artus HBV PCR; QIAGEN
Diagnostics) (56, 135) and COBAS TaqMan reagents (39, 51,
124). Manual column methods have also been reported for use
with COBAS TaqMan reagents (84, 146).
HBV Genotyping: Utility
The HBV genotype is a variable that could potentially influence the outcome of chronic hepatitis B and the success of
antiviral therapy. The influence of the HBV genotype on
chronic infection has been most intensively studied in highprevalence populations in Asia, where genotypes B and C
predominate. Outcome data for these genotypes are probably
the most valid, since infection duration (due predominantly to
perinatal acquisition) is not a confounding variable (36). In
general, patients with genotype B infections have more-favorable outcomes than those with genotype C, including younger
age at HBeAg seroconversion, lower rates of active liver disease, and slower progression to cirrhosis (87). The influence of
genotype on HCC is complex. In most cases, genotype C correlates with higher risk (112, 138, 159); however, the association may also be dependent on other factors, such as host age
and geographically dependent virus strain (87). For example, a
high rate of HCC has been observed in young patients (63,
106) and in Taiwanese patients with genotype B infection (63).
An HBV genotype-dependent response to antiviral therapy has
been observed for some drugs but not for others. For IFN-␣
treatment of HBeAg⫹ CHB, greater rates of HBeAg seroconversion have been observed for genotype A than for genotype D
(49% versus 26%) (31) and for B than for C (39% versus 17%)
(144). Similar results have been found with pegylated IFN-␣2b
(33, 60). A trend of higher HBeAg seroconversion rates after
pegylated IFN-␣2a treatment of HBeAg⫹ CHB has been observed for genotype A compared to genotypes B, C, and D (79).
For nucleoside/nucleotide analogs, potential genotype-dependent predictive parameters include therapeutic response
and emergence of resistance. On the whole, there seems to be
little evidence for genotype-dependent responses to these
agents. For lamivudine treatment of HBeAg⫹ CHB, information is available primarily for genotypes B and C. There are
433
strong data demonstrating no effect of genotype (B versus C)
on lamivudine response, including equivalent rates of HBeAg
seroconversion, log HBV DNA reduction, and median aminotransferase normalization 12 months after end of therapy
(163). Another study, measuring similar parameters at the
same times (22), showed a greater sustained response in genotype B than in genotype C patients; however, the ratio of
genotype B to C patients in this study was 3:1, introducing a
potential for bias in the results. No genotype-dependent differences in HBV DNA responses have been observed for
adefovir (148) or tenofovir (8).
Development of resistance appears to be equivalent among
the different genotypes. Most data pertain to lamivudine, since
it has the highest resistance rates of the nucleoside/nucleotide
analogs. No difference in rates of resistance has been observed
between genotypes B and C (3, 64). More rapid emergence of
resistance has been reported for genotype A than for genotype
D; however, the difference between the two genotypes was
actually quite small (167). Recent data on adefovir resistance
identified a potential association with genotype D that bears
further investigation (35).
The above observations and data suggest that genotype determination in chronic hepatitis B has a more limited role in
clinical management than it does in chronic hepatitis C virus
infection. Genotyping is probably most important if IFN therapy is a consideration, and genotype determination has been
suggested prior to initiation of IFN therapy in one set of
practice guidelines (65). None of the current guidelines have
advocated a role for genotyping in counseling patients on the
outcome of chronic hepatitis B.
HBV Genotyping Methods
Given its limited utility, HBV genotype testing has not yet
been widely adopted in clinical laboratories. A variety of methods have been used, including whole- or partial-genome sequencing, restriction fragment length polymorphism, genotype-specific PCR amplification, PCR plus hybridization, and
serology (7). Whole-genome sequencing is the “gold standard,” and it is particularly accurate for detecting recombinant
viruses. However, it is cumbersome and time-consuming and
has limited ability to detect mixed-genotype infections. Single
gene sequencing, most commonly the S gene, is technically less
demanding. The most common method of sequence-based HBV
genotype determination has been searching of the GenBank database for homologous sequences using BlastN. This approach
was noted to be complicated by the paucity of genotype-annotated HBV sequences within GenBank (7); however, the deposition of a growing number of annotated sequences into the database has made this approach more practical.
PCR plus hybridization has been adapted into a commercial
product (INNO-LiPA; Innogenetics [research use only in Europe and the United States]). The amplification target lies in
the major hydrophilic domain of HBsAg and is encoded within
the pre-S1 gene, which has been found to be useful for genotype determination by direct sequencing. Amplicons are generated by nested PCR, although hybridization can be performed after the first PCR round if product is visualized by gel
electrophoresis. Data on the analytical and clinical performance characteristics of this assay are limited to two reports
434
VALSAMAKIS
(58, 113). The reported accuracy of single-genotype identification was 97 to 99.9% compared to direct sequencing (58, 113).
This method has several advantages over direct sequencing. It
can effectively identify mixed infection, as 65% of mixed infections were verified by clonal analysis (113). In addition, it can
be used to identify genotypes in samples that yield poor quality
sequence data (113). One disadvantage is the potential for
indeterminate results for viruses with single nucleotide polymorphisms or deletions in sequences that are complementary
to probes used in the hybridization phase. An indeterminate
rate of up to 5% has been observed (113). Reasonable analytical and clinical sensitivity has been achieved with a modified
protocol incorporating a number of different improvements to
the recommended PCR plus hybridization procedure, including automated extraction (MagNAPure; Roche Diagnostics),
single-round PCR (versus the recommended nested PCR), and
uracil N-glycosylase (123).
A commercial direct sequencing assay for genotype determination (TRUGENE HBV Genotyping Kit; Siemens Medical Solutions Diagnostics) is available as a research-use-only kit. Published assay performance data are limited. Correlation data with
other direct sequencing methods or with INNO-LiPA have not
been reported. The assay can be used in samples with fairly low
HBV concentrations (200 to 900 IU/ml) (41).
Antiviral Resistance Testing: Utility and Assays
The emergence of drug-resistant HBV should be suspected
when a 10-fold increase in viral load compared to nadir is
confirmed in a patient with documented therapeutic response.
Documenting the mutation that confers drug resistance has
not been part of routine clinical practice. This may change with
the growing armamentarium of antivirals and reported crossresistance among drugs within the same structural class (for
example, cross-resistance observed between lamivudine and
other L-nucleosides such as entecavir, emtricitabine, and telbivudine [28, 155]).
Resistance can be documented by phenotypic or sequence
analysis. Each strategy has advantages and disadvantages. Phenotypic analysis entails assessment of mutant replication in the
presence of drug and requires some form of genetic engineering (either site-directed mutagenesis of wild-type sequence or
construction of full-length mutant clones expressed in baculovirus models) followed by expression in cell culture systems
(130). This approach is the most effective means of ascertaining whether a complex set of mutations confers antiviral resistance. However, it is far too cumbersome for standard clinical
molecular laboratories and is usually limited to specialized
laboratories with a specific interest in antiviral resistance.
Direct sequencing can identify known and potential new
resistance mutations. However, this method is not sufficiently
sensitive for the detection of emerging, resistant mutants that
are present in low concentrations. These minor populations
can be identified by large-scale cloning and sequencing protocols; however, this is cumbersome and beyond the capacity of
clinical laboratories. In comparison, hybridization-based methods are more sensitive and less labor-intensive. This approach
also has a number of disadvantages: (i) only known mutations
can be identified, (ii) individual probes are required to detect
each mutation, and (iii) single-nucleotide polymorphisms that
CLIN. MICROBIOL. REV.
have no effect on phenotype can impair probe binding and
produce false-negative results (92).
While sequence determination is relatively simple to perform compared to phenotypic analysis, interpretation of sequence data is not always straightforward. For example, some
mutations confer resistance to multiple drugs (rtA181T is observed after long-term lamivudine therapy and in adefovirresistant viruses) (34, 157). Other sequence changes may not
confer resistance when present alone but apparently cause
resistance in combination with other mutations. While lamivudine
resistance has not been observed with the single mutation
rtL180M, it does occur with the double mutant rtL180M/
rtA181T, which apparently alters the position of rtM204, a critical
residue in the nucleotide binding pocket (130). Finally, it has been
noted that patients who have been treated with multiple drugs will
likely have a combination of sequence changes that represent (i)
drug resistance mutations, (ii) compensatory mutations that
improve the fitness of drug-resistant viruses, and (iii) singlenucleotide polymorphisms that have no phenotype (130).
A small number of sequence determination assays are
commercially available, including hybridization (biotinylated amplicons hybridized to membrane-bound oligonucleotides specific for each mutation) and direct-sequencing formats. The hybridization-based assay is in its second generation.
The first-generation product (for the detection of lamivudine
resistance mutations at amino acids 180, 204, and 207) was
found to be more sensitive for the detection of emerging variants than sequencing and was able to detect mutations in
specimens with low viral loads (approximately 200 IU/ml) (1,
92). The second-generation product (INNO-LiPA DR, version
2.0) has a refined, expanded lamivudine resistance panel
(codons 80, 173, 180, and 204) and also detects adefovir resistance mutations (codons 181 and 236). This test demonstrated
a high degree of concordance with direct sequencing (⬃95% of
codons interrogated) (59, 114). INNO-LiPA DR, version 2.0,
detected a greater number of mixed (resistance mutation plus
wild-type virus) infections, and lamivudine resistance was detected earlier (mean, 6 to 7months). Dual resistance (lamivudine and adefovir) was also demonstrated (59). Operational
disadvantages have been noted, including a large number of
reaction lines per strip (34 lines per strip), faint bands, absence
of bands (false negatives), and indeterminate results due to
lack of amplification by primers (114).
There is limited published experience with commercially
available direct-sequencing resistance detection assays. The
TRUGENE HBV genotyping kit (Siemens Medical Diagnostic
Solutions), modified to incorporate automated extraction (versus the recommended manual method), was able to provide
sequence data from specimens with low viral loads (⬍900 IU/
ml) (41). In one comparison between TRUGENE and INNOLiPA HBV DR, concordance was high (approximately 80%)
with clinical samples from HIV-1/HBV-coinfected patients
treated with lamivudine as part of antiretroviral therapy. However, the hybridization-based assay was better able to detect
mixed populations (125), as has been reported in other comparisons between PCR plus hybridization and noncommercial
direct sequencing protocols.
Another commercial platform (Affigene HBV DE/3TC assay; Sangtec Molecular Diagnostics AB) combines hybridization and direct sequencing in a microwell plate format to
VOL. 20, 2007
detect lamivudine resistance mutations. PCR amplicons are
immobilized by hybridization; codons 180 and 204 are subsequently interrogated by microsequencing. This assay demonstrated concordance with direct sequencing that was similar to
INNO-LiPA DR, version 1.0 (111). Indeterminate rates were
greater with Affigene than with INNO-LiPA (13 versus 3%).
Detection of Core Promoter/Precore Mutations in
HBeAgⴚ CHB: Utility and Assays
The diagnosis of HBeAg⫺ CHB is made primarily through
assessment of a combination of virological markers (HBsAg
positive, HBeAg negative, detectable HBV DNA), serology
(anti-HBeAg antibody positive), and evidence of hepatic injury
(elevated aminotransferases and or histologic evidence of
necroinflammation). Assays to detect mutations that abrogate
HBeAg expression are commercially available. Test formats
for the detection of antiviral resistance mutations have been
applied to the identification of precore/core promoter mutations (PCR plus hybridization, INNO-LiPA HBV PreCore;
hybridization/direct sequencing, Affigene HBV Mutant VL19
[Sangtec Molecular Diagnostics AB]). The PCR-plus-hybridization format detects three mutations (basal core promoter
nucleotides 1762 and 1764 and precore codon 28), while the
hybridization/direct-sequencing format detects two of these
three mutations (basal core promoter nucleotide 1764 and
precore codon 28). Both assays demonstrated high concordance with direct sequencing (approximately 90%); however,
they more effectively detected mixed populations (mutant
variant plus wild type) (111). Indeterminate results in lowviral-load specimens were observed only with the hybridization/direct sequencing assay, suggesting that PCR plus hybridization may be a more sensitive format (111). Procedural
improvements to the PCR-plus-hybridization test (automated
extraction, single round of PCR, incorporation of uracil Nglycosylase) have been published (123).
FUTURE TRENDS IN MOLECULAR DIAGNOSTIC
TESTING FOR CHRONIC HEPATITIS B
The adoption of new technologies and the identification of
new virological or host markers could potentially provide opportunities for growth and evolution of molecular testing in
chronic hepatitis B. Emerging technologies that have not yet
penetrated significantly into diagnostic laboratories may become useful in the future. For example, a high-density array
that can compete with sequencing for the identification of
mutations (polymerase-based resistance mutations and core
promoter/precore mutations) and genotypes has been reported
(140). This system has a number of advantages, including flexibility and throughput. Microarrays currently pose numerous
technical, regulatory, and cost challenges that will have to be
overcome in order for these types of platforms to become
widely adopted in clinical laboratories.
Virtual phenotyping, the prediction of drug resistance from
analysis of complex sequence changes, is used routinely in
managing HIV-1 resistance to antivirals. This method has
great applicability to the management of chronic hepatitis B. A
database that can be used to process HBV DNA sequence
information to identify genotype and detect mutations that
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
435
inhibit HBeAg expression and to predict resistance has been
reported (SEQHEPB) (161). Access is provided on a subscription basis. Clinical information can be deposited so that mutations can be correlated with patient presentation, course, and
treatment. One particularly interesting feature of this database is
that the potential effects of mutations on drug binding can be
visualized through a three-dimensional model of drug-bound reverse transcriptase. As the number of drugs to treat chronic hepatitis B expands, such databases may become increasingly useful.
New virological markers, such as cccDNA, the minichromosome that serves as the transcriptional template for viral
RNAs, could become clinically useful. cccDNA quantification
was once cumbersome but is now readily achievable by realtime PCR and other homogeneous amplification/detection
chemistries such as cleavase (Invader HBV DNA; Third Wave
Technologies). Studies utilizing these techniques are beginning
to elucidate the dynamics of HBV replication during the
course of infection and treatment. Median total intrahepatic
HBV DNA and cccDNA levels have been found to be greater
in HBeAg⫹ CHB than in HBeAg⫺ CHB (78, 147, 152, 154).
Interestingly, higher levels of cccDNA transcriptional activity,
defined as the ratio of pregenomic RNA to cccDNA, were
observed in HBeAg⫹ CHB than in HBeAg⫺ CHB (78), providing a potential explanation for the higher levels of viral
replication that occur in the former group. In HCC, tumor
tissue has been found to contain higher median cccDNA levels
and proportions of cccDNA to intrahepatic total HBV DNA
than adjacent nontumor tissue (151), supporting the current
paradigm that HBV replication is partially or completely
downregulated in HCC. Total intrahepatic HBV DNA and
cccDNA loads decline after antiviral therapy (137, 147, 154),
reflecting response to therapy.
Preliminary data on the utility of intrahepatic cccDNA as a
predictor of response to antiviral therapy are emerging.
Whether cccDNA will be useful to predict a sustained response
is not yet resolved. Data from studies with small cohorts are
conflicting (137, 147). Initial evidence suggests that baseline
intrahepatic cccDNA is useful for predicting HBeAg seroconversion after adefovir monotherapy or combination therapy
with pegylated IFN-␣ (147, 154). Whether this applies to other
therapies is unknown.
While novel intrahepatic markers of chronic HBV infection
and response to therapy are promising and of interest, diagnostic targets that can be monitored less invasively in peripheral blood are likely to be more useful and more widely applicable. One potential candidate is cccDNA measurement in
serum. This molecule has been detected in a greater proportion of patients with HBeAg⫹ CHB than with HBeAg⫺ CHB,
and median levels have been found to be greater in HBeAg⫹
CHB (152). In addition, a statistically significant decrease in
serum cccDNA was observed compared to placebo in patients
with HBeAg⫹ CHB who responded virologically to a 52-week
course of lamivudine (164). These studies indicate that measurement of cccDNA in peripheral blood is possible, but its
potential clinical utility awaits further investigation.
Overall, the field of molecular testing for the diagnosis and
management of HBV infection has shown steady improvement
in technology and standardization. Emerging, more-sensitive
technologies have facilitated diagnostics and therapeutics, particularly for HBeAg⫺ CHB and occult hepatitis B. They have
436
VALSAMAKIS
CLIN. MICROBIOL. REV.
also helped to better define the natural history of chronic
hepatitis B and how the host responds to therapy. Importantly,
these new methods have also raised questions and spurred
debate on the most useful virological markers for documenting
the response to antivirals, which can only improve the application of molecular methods to this field (4, 86, 103). In the
natural transfer of information that occurs between the basic
and clinical sciences, new markers are being identified during
investigation into chronic hepatitis B pathogenesis. As has
happened in the past, the most promising molecules will be
adapted for clinical use, propelling the field of clinical diagnostics forward yet again.
16.
17.
18.
19.
ACKNOWLEDGMENTS
20.
Many thanks to Michael Forman for thoughtful commentary on the
manuscript, John Ticehurst for spontaneously fielding numerous questions, and Sherron Wilson-Alexander for assistance with manuscript
preparation.
This work was supported by the HIV Prevention Trials Network
(HPTN), sponsored by NIAID, NIDA, NIMH, and the Office of AIDS
Research of the NIH, DHHS (U01-AI-068613).
21.
REFERENCES
24.
1. Aberle, S. W., J. Kletzmayr, B. Watschinger, B. Schmied, N. Vetter, and E.
Puchhammer-Stockl. 2001. Comparison of sequence analysis and the
INNO-LiPA HBV DR line probe assay for detection of lamivudine-resistant hepatitis B virus strains in patients under various clinical conditions.
J. Clin. Microbiol. 39:1972–1974.
2. Ahn, S. H., Y. N. Park, J. Y. Park, H. Y. Chang, J. M. Lee, J. E. Shin, K. H.
Han, C. Park, Y. M. Moon, and C. Y. Chon. 2005. Long-term clinical and
histological outcomes in patients with spontaneous hepatitis B surface antigen seroclearance. J. Hepatol. 42:188–194.
3. Akuta, N., F. Suzuki, M. Kobayashi, A. Tsubota, Y. Suzuki, T. Hosaka, T.
Someya, M. Kobayashi, S. Saitoh, Y. Arase, K. Ikeda, and H. Kumada.
2003. The influence of hepatitis B virus genotype on the development of
lamivudine resistance during long-term treatment. J. Hepatol. 38:315–321.
4. Alberti, A. 2003. Can serum HBV-DNA be used as a primary end point to
assess efficacy of new treatments for chronic hepatitis B? Hepatology 38:
18–20.
5. Allain, J. P. 2004. Occult hepatitis B virus infection: implications in transfusion. Vox Sang. 86:83–91.
6. Arauz-Ruiz, P., H. Norder, B. H. Robertson, and L. O. Magnius. 2002.
Genotype H: a new Amerindian genotype of hepatitis B virus revealed in
Central America. J. Gen. Virol. 83:2059–2073.
7. Bartholomeusz, A., and S. Schaefer. 2004. Hepatitis B virus genotypes:
comparison of genotyping methods. Rev. Med. Virol. 14:3–16.
8. Benhamou, Y., H. Fleury, P. Trimoulet, I. Pellegrin, R. Urbinelli, C.
Katlama, W. Rozenbaum, G. Le Teuff, A. Trylesinski, and C. Piketty. 2006.
Anti-hepatitis B virus efficacy of tenofovir disoproxil fumarate in HIVinfected patients. Hepatology 43:548–555.
9. Bortolotti, F., P. Cadrobbi, C. Crivellaro, M. Guido, M. Rugge, F. Noventa,
R. Calzia, and G. Realdi. 1990. Long-term outcome of chronic type B
hepatitis in patients who acquire hepatitis B virus infection in childhood.
Gastroenterology 99:805–810.
10. Bortolotti, F., M. Guido, S. Bartolacci, P. Cadrobbi, C. Crivellaro, F.
Noventa, G. Morsica, M. Moriondo, and A. Gatta. 2006. Chronic hepatitis
B in children after e antigen seroclearance: final report of a 29-year longitudinal study. Hepatology 43:556–562.
11. Brechot, C., V. Thiers, D. Kremsdorf, B. Nalpas, S. Pol, and P. PaterliniBrechot. 2001. Persistent hepatitis B virus infection in subjects without
hepatitis B surface antigen: clinically significant or purely “occult”? Hepatology 34:194–203.
12. Carman, W. F., M. R. Jacyna, S. Hadziyannis, P. Karayiannis, M. J.
McGarvey, A. Makris, and H. C. Thomas. 1989. Mutation preventing formation of hepatitis B e antigen in patients with chronic hepatitis B infection. Lancet ii:588–591.
13. Chan, H. L., N. W. Leung, A. Y. Hui, V. W. Wong, C. T. Liew, A. M. Chim,
F. K. Chan, L. C. Hung, Y. T. Lee, J. S. Tam, C. W. Lam, and J. J. Sung.
2005. A randomized, controlled trial of combination therapy for chronic
hepatitis B: comparing pegylated interferon-alpha2b and lamivudine with
lamivudine alone. Ann. Intern. Med. 142:240–250.
14. Chan, H. L., and J. J. Sung. 2006. Hepatocellular carcinoma and hepatitis
B virus. Semin. Liver Dis. 26:153–161.
15. Chan, H. L., S. W. Tsang, N. W. Leung, C. H. Tse, Y. Hui, J. S. Tam, F. K.
Chan, and J. J. Sung. 2002. Occult HBV infection in cryptogenic liver
22.
23.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
cirrhosis in an area with high prevalence of HBV infection. Am. J. Gastroenterol. 97:1211–1215.
Chang, M. L., R. N. Chien, C. T. Yeh, and Y. F. Liaw. 2005. Virus and
transaminase levels determine the emergence of drug resistance during
long-term lamivudine therapy in chronic hepatitis B. J. Hepatol. 43:72–77.
Chang, T. T., R. G. Gish, R. de Man, A. Gadano, J. Sollano, Y. C. Chao,
A. S. Lok, K. H. Han, Z. Goodman, J. Zhu, A. Cross, D. DeHertogh, R.
Wilber, R. Colonno, and D. Apelian. 2006. A comparison of entecavir and
lamivudine for HBeAg-positive chronic hepatitis B. N. Engl. J. Med. 354:
1001–1010.
Chang, T. T., C. L. Lai, R. N. Chien, R. Guan, S. G. Lim, C. M. Lee, K. Y.
Ng, G. J. Nicholls, J. C. Dent, and N. W. Leung. 2004. Four years of
lamivudine treatment in Chinese patients with chronic hepatitis B. J. Gastroenterol. Hepatol. 19:1276–1282.
Chaudhuri, V., R. Tayal, B. Nayak, S. K. Acharya, and S. K. Panda. 2004.
Occult hepatitis B virus infection in chronic liver disease: full-length genome and analysis of mutant surface promoter. Gastroenterology 127:
1356–1371.
Chemin, I., and C. Trepo. 2005. Clinical impact of occult HBV infections.
J. Clin. Virol. 34(Suppl. 1):S15–S21.
Chen, M. T., J. N. Billaud, M. Sallberg, L. G. Guidotti, F. V. Chisari, J.
Jones, J. Hughes, and D. R. Milich. 2004. A function of the hepatitis B virus
precore protein is to regulate the immune response to the core antigen.
Proc. Natl. Acad. Sci. USA 101:14913–14918.
Chien, R. N., C. T. Yeh, S. L. Tsai, C. M. Chu, and Y. F. Liaw. 2003.
Determinants for sustained HBeAg response to lamivudine therapy. Hepatology 38:1267–1273.
Chisari, F. V. 2000. Rous-Whipple Award lecture. Viruses, immunity, and
cancer: lessons from hepatitis B. Am. J. Pathol. 156:1117–1132.
Chu, C. J., M. Hussain, and A. S. Lok. 2002. Quantitative serum HBV DNA
levels during different stages of chronic hepatitis B infection. Hepatology
36:1408–1415.
Chu, C. J., E. B. Keeffe, S. H. Han, R. P. Perrillo, A. D. Min, C. SoldevilaPico, W. Carey, R. S. Brown, Jr., V. A. Luketic, N. Terrault, and A. S. Lok.
2003. Hepatitis B virus genotypes in the United States: results of a nationwide study. Gastroenterology 125:444–451.
Chu, C. M. 2000. Natural history of chronic hepatitis B virus infection in
adults with emphasis on the occurrence of cirrhosis and hepatocellular
carcinoma. J. Gastroenterol. Hepatol. 15(Suppl.):E25–E30.
Chu, C. M., S. J. Hung, J. Lin, D. I. Tai, and Y. F. Liaw. 2004. Natural
history of hepatitis B e antigen to antibody seroconversion in patients with
normal serum aminotransferase levels. Am. J. Med. 116:829–834.
Colonno, R. J., R. Rose, C. J. Baldick, S. Levine, K. Pokornowski, C. F. Yu,
A. Walsh, J. Fang, M. Hsu, C. Mazzucco, B. Eggers, S. Zhang, M. Plym, K.
Klesczewski, and D. J. Tenney. 2006. Entecavir resistance is rare in nucleoside naive patients with hepatitis B. Hepatology 44:1656–1665.
Conjeevaram, H. S., and A. S. Lok. 2001. Occult hepatitis B virus infection:
a hidden menace? Hepatology 34:204–206.
Dore, G. J., D. A. Cooper, A. L. Pozniak, E. DeJesus, L. Zhong, M. D.
Miller, B. Lu, and A. K. Cheng. 2004. Efficacy of tenofovir disoproxil
fumarate in antiretroviral therapy-naive and -experienced patients coinfected with HIV-1 and hepatitis B virus. J. Infect. Dis. 189:1185–1192.
Erhardt, A., D. Blondin, K. Hauck, A. Sagir, T. Kohnle, T. Heintges, and D.
Haussinger. 2005. Response to interferon alfa is hepatitis B virus genotype
dependent: genotype A is more sensitive to interferon than genotype D.
Gut 54:1009–1013.
European Association for the Study of the Liver. 2003. Proceedings of the
European Association for the Study of the Liver (EASL) International
Consensus Conference on Hepatitis B. September 14–16, 2002. Geneva,
Switzerland. J. Hepatol. 39(Suppl. 1):S1–S235.
Flink, H. J., M. van Zonneveld, B. E. Hansen, R. A. de Man, S. W. Schalm,
and H. L. Janssen. 2006. Treatment with Peg-interferon alpha-2b for
HBeAg-positive chronic hepatitis B: HBsAg loss is associated with HBV
genotype. Am. J. Gastroenterol. 101:297–303.
Fung, S. K., P. Andreone, S. H. Han, K. Rajender Reddy, A. Regev, E. B.
Keeffe, M. Hussain, C. Cursaro, P. Richtmyer, J. A. Marrero, and A. S. Lok.
2005. Adefovir-resistant hepatitis B can be associated with viral rebound
and hepatic decompensation. J. Hepatol. 43:937–943.
Fung, S. K., H. B. Chae, R. J. Fontana, H. Conjeevaram, J. Marrero, K.
Oberhelman, M. Hussain, and A. S. Lok. 2006. Virologic response and
resistance to adefovir in patients with chronic hepatitis B. J. Hepatol.
44:283–290.
Fung, S. K., and A. S. Lok. 2004. Hepatitis B virus genotypes: do they play
a role in the outcome of HBV infection? Hepatology 40:790–792.
Fung, S. K., F. Wong, M. Hussain, and A. S. Lok. 2004. Sustained response
after a 2-year course of lamivudine treatment of hepatitis B e antigennegative chronic hepatitis B. J. Viral Hepat. 11:432–438.
Funk, M. L., D. M. Rosenberg, and A. S. Lok. 2002. World-wide epidemiology of HBeAg-negative chronic hepatitis B and associated precore and
core promoter variants. J. Viral Hepat. 9:52–61.
Germer, J. J., M. O. Qutub, J. N. Mandrekar, P. S. Mitchell, and J. D. Yao.
2006. Quantification of hepatitis B virus (HBV) DNA with a TaqMan HBV
VOL. 20, 2007
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
analyte-specific reagent following sample processing with the MagNA Pure
LC instrument. J. Clin. Microbiol. 44:1490–1494.
Ghisetti, V., A. Marzano, F. Zamboni, A. Barbui, A. Franchello, S. Gaia, G.
Marchiaro, M. Salizzoni, and M. Rizzetto. 2004. Occult hepatitis B virus
infection in HBsAg negative patients undergoing liver transplantation: clinical significance. Liver Transpl. 10:356–362.
Gintowt, A. A., J. J. Germer, P. S. Mitchell, and J. D. Yao. 2005. Evaluation
of the MagNA Pure LC used with the TRUGENE HBV genotyping kit.
J. Clin. Virol. 34:155–157.
Gish, R. G., H. Trinh, N. Leung, F. K. Chan, M. W. Fried, T. L. Wright, C.
Wang, J. Anderson, E. Mondou, A. Snow, J. Sorbel, F. Rousseau, and L.
Corey. 2005. Safety and antiviral activity of emtricitabine (FTC) for the
treatment of chronic hepatitis B infection: a two-year study. J. Hepatol.
43:60–66.
Gordillo, R. M., J. Gutierrez, and M. Casal. 2005. Evaluation of the COBAS
TaqMan 48 real-time PCR system for quantitation of hepatitis B virus DNA.
J. Clin. Microbiol. 43:3504–3507.
Gregorek, H., K. Dzierzanowska-Fangrat, M. Woynarowski, P. Jozwiak, E.
Witkowska-Vogtt, J. Socha, M. Syczewska, and K. Madalinski. 2005. Persistence of HBV-DNA in children with chronic hepatitis B who seroconverted to anti-HBs antibodies after interferon-alpha therapy: correlation
with specific IgG subclass responses to HBsAg. J. Hepatol. 42:486–490.
Guidotti, L. G., B. Matzke, C. Pasquinelli, J. M. Shoenberger, C. E. Rogler,
and F. V. Chisari. 1996. The hepatitis B virus (HBV) precore protein
inhibits HBV replication in transgenic mice. J. Virol. 70:7056–7061.
Hadziyannis, S. J., and G. V. Papatheodoridis. 2006. Hepatitis B e antigennegative chronic hepatitis B: natural history and treatment. Semin. Liver
Dis. 26:130–141.
Hadziyannis, S. J., N. C. Tassopoulos, E. J. Heathcote, T. T. Chang, G.
Kitis, M. Rizzetto, P. Marcellin, S. G. Lim, Z. Goodman, J. Ma, S. Arterburn, S. Xiong, G. Currie, and C. L. Brosgart. 2005. Long-term therapy
with adefovir dipivoxil for HBeAg-negative chronic hepatitis B. N. Engl.
J. Med. 352:2673–2681.
Hadziyannis, S. J., N. C. Tassopoulos, E. J. Heathcote, T. T. Chang, G.
Kitis, M. Rizzetto, P. Marcellin, S. G. Lim, Z. Goodman, J. Ma, C. L.
Brosgart, K. Borroto-Esoda, S. Arterburn, and S. L. Chuck. 2006. Longterm therapy with adefovir dipivoxil for HBeAg-negative chronic hepatitis
B for up to 5 years. Gastroenterology 131:1743–1751.
Heermann, K. H., W. H. Gerlich, M. Chudy, S. Schaefer, R. Thomssen, and
the Eurohep Pathobiology Group. 1999. Quantitative detection of hepatitis
B virus DNA in two international reference plasma preparations. J. Clin.
Microbiol. 37:68–73.
Hennig, H., I. Puchta, J. Luhm, P. Schlenke, S. Goerg, and H. Kirchner.
2002. Frequency and load of hepatitis B virus DNA in first-time blood
donors with antibodies to hepatitis B core antigen. Blood 100:2637–2641.
Hochberger, S., D. Althof, R. Gallegos de Schrott, N. Nachbaur, H. Rock,
and H. Leying. 2006. Fully automated quantitation of hepatitis B virus
(HBV) DNA in human plasma by the COBAS AmpliPrep/COBAS TaqMan
system. J. Clin. Virol. 35:373–380.
Hom, X., N. R. Little, S. D. Gardner, and M. M. Jonas. 2004. Predictors of
virologic response to lamivudine treatment in children with chronic hepatitis B infection. Pediatr. Infect. Dis. J. 23:441–445.
Horvat, R. T., and G. E. Tegtmeier. 2007. Hepatitis B and D viruses, p.
1641–1659. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry, and
M. A. Pfaller (ed.), Manual of clinical microbiology, 9th ed., vol. 2. ASM
Press, Washington, DC.
Hou, J., Z. Wang, J. Cheng, Y. Lin, G. K. Lau, J. Sun, F. Zhou, J. Waters,
P. Karayiannis, and K. Luo. 2001. Prevalence of naturally occurring surface
gene variants of hepatitis B virus in nonimmunized surface antigen-negative
Chinese carriers. Hepatology 34:1027–1034.
Hsu, Y. S., R. N. Chien, C. T. Yeh, I. S. Sheen, H. Y. Chiou, C. M. Chu, and
Y. F. Liaw. 2002. Long-term outcome after spontaneous HBeAg seroconversion in patients with chronic hepatitis B. Hepatology 35:1522–1527.
Hui, C. K., S. Bowden, H. Y. Zhang, A. Wong, S. Lewin, F. Rousseau, H.
Mommeja-Marin, N. P. Lee, J. M. Luk, S. Locarnini, N. Leung, N. V.
Naoumov, and G. K. Lau. 2006. Comparison of real-time PCR assays for
monitoring serum hepatitis B virus DNA levels during antiviral therapy.
J. Clin. Microbiol. 44:2983–2987.
Hui, C. K., E. Lau, H. Wu, A. Monto, M. Kim, J. M. Luk, G. K. Lau, and
T. L. Wright. 2006. Fibrosis progression in chronic hepatitis C patients with
occult hepatitis B co-infection. J. Clin. Virol. 35:185–192.
Hussain, M., C. J. Chu, E. Sablon, and A. S. Lok. 2003. Rapid and sensitive
assays for determination of hepatitis B virus (HBV) genotypes and detection of HBV precore and core promoter variants. J. Clin. Microbiol. 41:
3699–3705.
Hussain, M., S. Fung, E. Libbrecht, E. Sablon, C. Cursaro, P. Andreone,
and A. S. Lok. 2006. Sensitive line probe assay that simultaneously detects
mutations conveying resistance to lamivudine and adefovir. J. Clin. Microbiol. 44:1094–1097.
Janssen, H. L., M. van Zonneveld, H. Senturk, S. Zeuzem, U. S. Akarca, Y.
Cakaloglu, C. Simon, T. M. So, G. Gerken, R. A. de Man, H. G. Niesters,
P. Zondervan, B. Hansen, and S. W. Schalm. 2005. Pegylated interferon
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
437
alfa-2b alone or in combination with lamivudine for HBeAg-positive
chronic hepatitis B: a randomised trial. Lancet 365:123–129.
Jeantet, D., I. Chemin, B. Mandrand, A. Tran, F. Zoulim, P. Merle, C.
Trepo, and A. Kay. 2004. Cloning and expression of surface antigens from
occult chronic hepatitis B virus infections and their recognition by commercial detection assays. J. Med. Virol. 73:508–515.
Kannangai, R., E. Molmenti, L. Arrazola, A. Klein, M. Choti, D. L.
Thomas, and M. Torbenson. 2004. Occult hepatitis B viral DNA in liver
carcinomas from a region with a low prevalence of chronic hepatitis B
infection. J. Viral Hepat. 11:297–301.
Kao, J. H., P. J. Chen, M. Y. Lai, and D. S. Chen. 2000. Hepatitis B
genotypes correlate with clinical outcomes in patients with chronic hepatitis
B. Gastroenterology 118:554–559.
Kao, J. H., C. J. Liu, and D. S. Chen. 2002. Hepatitis B viral genotypes and
lamivudine resistance. J. Hepatol. 36:303–304.
Keeffe, E. B., D. T. Dieterich, S. H. Han, I. M. Jacobson, P. Martin, E. R.
Schiff, H. Tobias, and T. L. Wright. 2006. A treatment algorithm for the
management of chronic hepatitis B virus infection in the United States: an
update. Clin. Gastroenterol. Hepatol. 4:936–962.
Kessler, H. H., S. Preininger, E. Stelzl, E. Daghofer, B. I. Santner, E.
Marth, H. Lackner, and R. E. Stauber. 2000. Identification of different
states of hepatitis B virus infection with a quantitative PCR assay. Clin.
Diagn. Lab Immunol. 7:298–300.
Kleinman, S. H., and M. P. Busch. 2006. Assessing the impact of HBV NAT
on window period reduction and residual risk. J. Clin. Virol. 36(Suppl.
1):S23–S29.
Kleinman, S. H., M. C. Kuhns, D. S. Todd, S. A. Glynn, A. McNamara, A.
DiMarco, and M. P. Busch. 2003. Frequency of HBV DNA detection in US
blood donors testing positive for the presence of anti-HBc: implications for
transfusion transmission and donor screening. Transfusion 43:696–704.
Konnick, E. Q., M. Erali, E. R. Ashwood, and D. R. Hillyard. 2005. Evaluation of the COBAS Amplicor HBV Monitor assay and comparison with
the Ultrasensitive HBV Hybrid Capture 2 assay for quantification of hepatitis B virus DNA. J. Clin. Microbiol. 43:596–603.
Koziel, M. J., and S. Siddiqui. 2005. Hepatitis B virus and hepatitis delta
virus. In G. L. Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and
practice of infectious diseases. Elsevier, Philadelphia, PA.
Kuhns, M. C., and M. P. Busch. 2006. New strategies for blood donor
screening for hepatitis B virus: nucleic acid testing versus immunoassay
methods. Mol. Diagn. Ther. 10:77–91.
Kuo, A., J. L. Dienstag, and R. T. Chung. 2004. Tenofovir disoproxil
fumarate for the treatment of lamivudine-resistant hepatitis B. Clin. Gastroenterol. Hepatol. 2:266–272.
Lacombe, K., J. Gozlan, P. Y. Boelle, L. Serfaty, F. Zoulim, A. J. Valleron,
and P. M. Girard. 2005. Long-term hepatitis B virus dynamics in HIVhepatitis B virus-co-infected patients treated with tenofovir disoproxil fumarate. AIDS 19:907–915.
Lai, C. L., J. Dienstag, E. Schiff, N. W. Leung, M. Atkins, C. Hunt, N.
Brown, M. Woessner, R. Boehme, and L. Condreay. 2003. Prevalence and
clinical correlates of YMDD variants during lamivudine therapy for patients with chronic hepatitis B. Clin. Infect. Dis. 36:687–696.
Lai, C. L., D. Shouval, A. S. Lok, T. T. Chang, H. Cheinquer, Z. Goodman,
D. DeHertogh, R. Wilber, R. C. Zink, A. Cross, R. Colonno, and L. Fernandes. 2006. Entecavir versus lamivudine for patients with HBeAg-negative chronic hepatitis B. N. Engl. J. Med. 354:1011–1020.
Lamberts, C., M. Nassal, I. Velhagen, H. Zentgraf, and C. H. Schroder.
1993. Precore-mediated inhibition of hepatitis B virus progeny DNA synthesis. J. Virol. 67:3756–3762.
Laperche, S., V. Thibault, F. Bouchardeau, S. Alain, S. Castelain, M.
Gassin, M. Gueudin, P. Halfon, S. Larrat, F. Lunel, M. Martinot-Peignoux,
B. Mercier, J. M. Pawlotsky, B. Pozzetto, A. M. Roque-Afonso, F. RoudotThoraval, K. Saune, and J. J. Lefrere. 2006. Expertise of laboratories in
viral load quantification, genotyping, and precore mutant determination for
hepatitis B virus in a multicenter study. J. Clin. Microbiol. 44:3600–3607.
Laras, A., J. Koskinas, E. Dimou, A. Kostamena, and S. J. Hadziyannis.
2006. Intrahepatic levels and replicative activity of covalently closed circular
hepatitis B virus DNA in chronically infected patients. Hepatology 44:694–
702.
Lau, G. K., T. Piratvisuth, K. X. Luo, P. Marcellin, S. Thongsawat, G.
Cooksley, E. Gane, M. W. Fried, W. C. Chow, S. W. Paik, W. Y. Chang, T.
Berg, R. Flisiak, P. McCloud, and N. Pluck. 2005. Peginterferon alfa-2a,
lamivudine, and the combination for HBeAg-positive chronic hepatitis B.
N. Engl. J. Med. 352:2682–2695.
Leung, N. W., C. L. Lai, T. T. Chang, R. Guan, C. M. Lee, K. Y. Ng, S. G.
Lim, P. C. Wu, J. C. Dent, S. Edmundson, L. D. Condreay, and R. N. Chien.
2001. Extended lamivudine treatment in patients with chronic hepatitis B
enhances hepatitis B e antigen seroconversion rates: results after 3 years of
therapy. Hepatology 33:1527–1532.
Liaw, Y. F., N. Leung, R. Guan, G. K. Lau, I. Merican, G. McCaughan, E.
Gane, J. H. Kao, and M. Omata. 2005. Asian-Pacific consensus statement
on the management of chronic hepatitis B: a 2005 update. Liver Int. 25:
472–489.
438
VALSAMAKIS
82. Liaw, Y. F., I. S. Sheen, T. J. Chen, C. M. Chu, and C. C. Pao. 1991.
Incidence, determinants and significance of delayed clearance of serum
HBsAg in chronic hepatitis B virus infection: a prospective study. Hepatology 13:627–631.
83. Lim, S. G., T. M. Ng, N. Kung, Z. Krastev, M. Volfova, P. Husa, S. S. Lee,
S. Chan, M. L. Shiffman, M. K. Washington, A. Rigney, J. Anderson, E.
Mondou, A. Snow, J. Sorbel, R. Guan, and F. Rousseau. 2006. A doubleblind placebo-controlled study of emtricitabine in chronic hepatitis B. Arch.
Intern. Med. 166:49–56.
84. Lindh, M., and C. Hannoun. 2005. Dynamic range and reproducibility of
hepatitis B virus (HBV) DNA detection and quantification by COBAS
TaqMan HBV, a real-time semiautomated assay. J. Clin. Microbiol. 43:
4251–4254.
85. Liu, C. J., D. S. Chen, and P. J. Chen. 2006. Epidemiology of HBV infection
in Asian blood donors: emphasis on occult HBV infection and the role of
NAT. J. Clin. Virol. 36(Suppl. 1):S33–S44.
86. Liu, C. J., J. H. Kao, and D. S. Chen. 2003. Molecular assays for hepatitis
B virus infection. Hepatology 38:1311.
87. Liu, C. J., J. H. Kao, and D. S. Chen. 2005. Therapeutic implications of
hepatitis B virus genotypes. Liver Int. 25:1097–1107.
88. Liu, C. J., S. C. Lo, J. H. Kao, P. T. Tseng, M. Y. Lai, Y. H. Ni, S. H. Yeh,
P. J. Chen, and D. S. Chen. 2006. Transmission of occult hepatitis B virus
by transfusion to adult and pediatric recipients in Taiwan. J. Hepatol.
44:39–46.
89. Lok, A. S., E. J. Heathcote, and J. H. Hoofnagle. 2001. Management of
hepatitis B: 2000—summary of a workshop. Gastroenterology 120:1828–
1853.
90. Lok, A. S., and B. J. McMahon. 2001. Chronic hepatitis B. Hepatology
34:1225–1241.
91. Lok, A. S., and B. J. McMahon. 2004. Chronic hepatitis B: update of
recommendations. Hepatology 39:857–861.
92. Lok, A. S., F. Zoulim, S. Locarnini, A. Mangia, G. Niro, H. Decraemer, G.
Maertens, F. Hulstaert, K. De Vreese, and E. Sablon. 2002. Monitoring
drug resistance in chronic hepatitis B virus (HBV)-infected patients during
lamivudine therapy: evaluation of performance of INNO-LiPA HBV DR
assay. J. Clin. Microbiol. 40:3729–3734.
93. Manesis, E. K., G. V. Papatheodoridis, V. Sevastianos, E. Cholongitas, C.
Papaioannou, and S. J. Hadziyannis. 2003. Significance of hepatitis B
viremia levels determined by a quantitative polymerase chain reaction assay
in patients with hepatitis B e antigen-negative chronic hepatitis B virus
infection. Am. J. Gastroenterol. 98:2261–2267.
94. Marcellin, P., T. T. Chang, S. G. Lim, M. J. Tong, W. Sievert, M. L.
Shiffman, L. Jeffers, Z. Goodman, M. S. Wulfsohn, S. Xiong, J. Fry, and
C. L. Brosgart. 2003. Adefovir dipivoxil for the treatment of hepatitis B e
antigen-positive chronic hepatitis B. N. Engl. J. Med. 348:808–816.
95. Marcellin, P., G. K. Lau, F. Bonino, P. Farci, S. Hadziyannis, R. Jin, Z. M.
Lu, T. Piratvisuth, G. Germanidis, C. Yurdaydin, M. Diago, S. Gurel, M. Y.
Lai, P. Button, and N. Pluck. 2004. Peginterferon alfa-2a alone, lamivudine
alone, and the two in combination in patients with HBeAg-negative chronic
hepatitis B. N. Engl. J. Med. 351:1206–1217.
96. Martinot-Peignoux, M., N. Boyer, M. Colombat, R. Akremi, B. N. Pham, S.
Ollivier, C. Castelnau, D. Valla, C. Degott, and P. Marcellin. 2002. Serum
hepatitis B virus DNA levels and liver histology in inactive HBsAg carriers.
J. Hepatol. 36:543–546.
97. Marusawa, H., S. Uemoto, M. Hijikata, Y. Ueda, K. Tanaka, K. Shimotohno, and T. Chiba. 2000. Latent hepatitis B virus infection in healthy
individuals with antibodies to hepatitis B core antigen. Hepatology 31:488–
495.
98. Mason, A. L., L. Xu, L. Guo, M. Kuhns, and R. P. Perrillo. 1998. Molecular
basis for persistent hepatitis B virus infection in the liver after clearance of
serum hepatitis B surface antigen. Hepatology 27:1736–1742.
99. McMahon, B. J., W. L. Alward, D. B. Hall, W. L. Heyward, T. R. Bender,
D. P. Francis, and J. E. Maynard. 1985. Acute hepatitis B virus infection:
relation of age to the clinical expression of disease and subsequent development of the carrier state. J. Infect. Dis. 151:599–603.
100. McMahon, B. J., P. Holck, L. Bulkow, and M. Snowball. 2001. Serologic
and clinical outcomes of 1536 Alaska natives chronically infected with
hepatitis B virus. Ann. Intern. Med. 135:759–768.
101. Minuk, G. Y., D. F. Sun, R. Greenberg, M. Zhang, K. Hawkins, J. Uhanova,
A. Gutkin, K. Bernstein, A. Giulivi, and C. Osiowy. 2004. Occult hepatitis
B virus infection in a North American adult hemodialysis patient population. Hepatology 40:1072–1077.
102. Minuk, G. Y., D. F. Sun, J. Uhanova, M. Zhang, S. Caouette, L. E. Nicolle,
A. Gutkin, K. Doucette, B. Martin, and A. Giulivi. 2005. Occult hepatitis B
virus infection in a North American community-based population. J. Hepatol. 42:480–485.
103. Mommeja-Marin, H., E. Mondou, M. R. Blum, and F. Rousseau. 2003.
Serum HBV DNA as a marker of efficacy during therapy for chronic HBV
infection: analysis and review of the literature. Hepatology 37:1309–1319.
104. Momosaki, S., Y. Nakashima, M. Kojiro, and E. Tabor. 2005. HBsAgnegative hepatitis B virus infections in hepatitis C virus-associated hepatocellular carcinoma. J. Viral Hepat. 12:325–329.
CLIN. MICROBIOL. REV.
105. Naumann, H., S. Schaefer, C. F. Yoshida, A. M. Gaspar, R. Repp, and
W. H. Gerlich. 1993. Identification of a new hepatitis B virus (HBV) genotype from Brazil that expresses HBV surface antigen subtype adw4.
J. Gen. Virol. 74:1627–1632.
106. Ni, Y. H., M. H. Chang, K. J. Wang, H. Y. Hsu, H. L. Chen, J. H. Kao, S. H.
Yeh, Y. M. Jeng, K. S. Tsai, and D. S. Chen. 2004. Clinical relevance of
hepatitis B virus genotype in children with chronic infection and hepatocellular carcinoma. Gastroenterology 127:1733–1738.
107. Niesters, H. G., M. Krajden, L. Cork, M. de Medina, M. Hill, E. Fries, and
A. D. Osterhaus. 2000. A multicenter study evaluation of the Digene Hybrid
Capture II signal amplification technique for detection of hepatitis B virus
DNA in serum samples and testing of EUROHEP standards. J. Clin.
Microbiol. 38:2150–2155.
108. Noborg, U., A. Gusdal, P. Horal, and M. Lindh. 2000. Levels of viraemia in
subjects with serological markers of past or chronic hepatitis B virus infection. Scand. J. Infect. Dis. 32:249–252.
109. Norder, H., A. M. Courouce, and L. O. Magnius. 1994. Complete genomes,
phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology 198:
489–503.
110. Okamoto, H., F. Tsuda, H. Sakugawa, R. I. Sastrosoewignjo, M. Imai, Y.
Miyakawa, and M. Mayumi. 1988. Typing hepatitis B virus by homology in
nucleotide sequence: comparison of surface antigen subtypes. J. Gen. Virol.
69:2575–2583.
111. Olivero, A., A. Ciancio, M. L. Abate, S. Gaia, A. Smedile, and M. Rizzetto.
2006. Performance of sequence analysis, INNO-LiPA line probe assays and
AFFIGENE assays in the detection of hepatitis B virus polymerase and
precore/core promoter mutations. J. Viral Hepat. 13:355–362.
112. Orito, E., T. Ichida, H. Sakugawa, M. Sata, N. Horiike, K. Hino, K. Okita,
T. Okanoue, S. Iino, E. Tanaka, K. Suzuki, H. Watanabe, S. Hige, and M.
Mizokami. 2001. Geographic distribution of hepatitis B virus (HBV) genotype in patients with chronic HBV infection in Japan. Hepatology 34:590–
594.
113. Osiowy, C., and E. Giles. 2003. Evaluation of the INNO-LiPA HBV Genotyping assay for determination of hepatitis B virus genotype. J. Clin. Microbiol.
41:5473–5477.
114. Osiowy, C., J. P. Villeneuve, E. J. Heathcote, E. Giles, and J. Borlang. 2006.
Detection of rtN236T and rtA181V/T mutations associated with resistance
to adefovir dipivoxil in samples from patients with chronic hepatitis B virus
infection by the INNO-LiPA HBV DR line probe assay (version 2). J. Clin.
Microbiol. 44:1994–1997.
115. Papatheodoridis, G. V., E. Dimou, K. Dimakopoulos, S. Manolakopoulos, I.
Rapti, G. Kitis, D. Tzourmakliotis, E. Manesis, and S. J. Hadziyannis.
2005. Outcome of hepatitis B e antigen-negative chronic hepatitis B on
long-term nucleos(t)ide analog therapy starting with lamivudine. Hepatology 42:121–129.
116. Papatheodoridis, G. V., E. Dimou, A. Laras, V. Papadimitropoulos, and
S. J. Hadziyannis. 2002. Course of virologic breakthroughs under long-term
lamivudine in HBeAg-negative precore mutant HBV liver disease. Hepatology 36:219–226.
117. Pawlotsky, J. M. 2003. Hepatitis B virus (HBV) DNA assays (methods and
practical use) and viral kinetics. J. Hepatol. 39(Suppl. 1):S31–S35.
118. Pawlotsky, J. M., A. Bastie, C. Hezode, I. Lonjon, F. Darthuy, J. Remire,
and D. Dhumeaux. 2000. Routine detection and quantification of hepatitis
B virus DNA in clinical laboratories: performance of three commercial
assays. J. Virol. Methods 85:11–21.
119. Perrillo, R. P., C. L. Lai, Y. F. Liaw, J. L. Dienstag, E. R. Schiff, S. W.
Schalm, E. J. Heathcote, N. A. Brown, M. Atkins, M. Woessner, and S. D.
Gardner. 2002. Predictors of HBeAg loss after lamivudine treatment for
chronic hepatitis B. Hepatology 36:186–194.
120. Perrillo, R. P., E. R. Schiff, G. L. Davis, H. C. Bodenheimer, Jr., K. Lindsay,
J. Payne, J. L. Dienstag, C. O’Brien, C. Tamburro, I. M. Jacobson, and the
Hepatitis Interventional Therapy Group. 1990. A randomized, controlled
trial of interferon alfa-2b alone and after prednisone withdrawal for the
treatment of chronic hepatitis B. N. Engl. J. Med. 323:295–301.
121. Perz, J. F., G. L. Armstrong, L. A. Farrington, Y. J. Hutin, and B. P. Bell.
2006. The contributions of hepatitis B virus and hepatitis C virus infections
to cirrhosis and primary liver cancer worldwide. J. Hepatol. 45:529–538.
122. Plentz, A., G. Koller, K. M. Weinberger, and W. Jilg. 2004. Precision and
stability of hepatitis B virus DNA levels in chronic surface antigen carriers.
J. Med. Virol. 73:522–528.
123. Qutub, M. O., J. J. Germer, S. P. Rebers, J. N. Mandrekar, M. G. Beld, and
J. D. Yao. 2006. Simplified PCR protocols for INNO-LiPA HBV Genotyping and INNO-LiPA HBV PreCore assays. J. Clin. Virol. 37:218–221.
124. Ronsin, C., A. Pillet, C. Bali, and G. A. Denoyel. 2006. Evaluation of the
COBAS AmpliPrep-total nucleic acid isolation-COBAS TaqMan hepatitis
B virus (HBV) quantitative test and comparison to the VERSANT HBV
DNA 3.0 assay. J. Clin. Microbiol. 44:1390–1399.
125. Roque-Afonso, A. M., M. P. Ferey, V. Mackiewicz, L. Fki, and E. Dussaix.
2003. Monitoring the emergence of hepatitis B virus polymerase gene
variants during lamivudine therapy in human immunodeficiency virus coin-
VOL. 20, 2007
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
fected patients: performance of CLIP sequencing and line probe assay.
Antivir. Ther. 8:627–634.
Saldanha, J., W. Gerlich, N. Lelie, P. Dawson, K. Heermann, and A. Heath.
2001. An international collaborative study to establish a World Health
Organization international standard for hepatitis B virus DNA nucleic acid
amplification techniques. Vox Sang. 80:63–71.
Scaglioni, P. P., M. Melegari, and J. R. Wands. 1997. Posttranscriptional
regulation of hepatitis B virus replication by the precore protein. J. Virol.
71:345–353.
Schaefer, S. 2005. Hepatitis B virus: significance of genotypes. J. Viral
Hepat. 12:111–124.
Seo, Y., S. Yoon, B. X. Truong, H. Kato, K. Hamano, M. Kato, Y. Yano, M.
Katayama, T. Ninomiya, Y. Hayashi, and M. Kasuga. 2005. Serum hepatitis
B virus DNA levels differentiating inactive carriers from patients with
chronic hepatitis B. Eur. J. Gastroenterol. Hepatol. 17:753–757.
Shaw, T., A. Bartholomeusz, and S. Locarnini. 2006. HBV drug resistance:
mechanisms, detection and interpretation. J. Hepatol. 44:593–606.
Shepard, C. W., E. P. Simard, L. Finelli, A. E. Fiore, and B. P. Bell. 2006.
Hepatitis B virus infection: epidemiology and vaccination. Epidemiol. Rev.
28:112–125.
Shyamala, V., P. Arcangel, J. Cottrell, D. Coit, A. Medina-Selby, C.
McCoin, D. Madriaga, D. Chien, and B. Phelps. 2004. Assessment of the
target-capture PCR hepatitis B virus (HBV) DNA quantitative assay and
comparison with commercial HBV DNA quantitative assays. J. Clin. Microbiol. 42:5199–5204.
Soriano, V., M. Puoti, M. Bonacini, G. Brook, A. Cargnel, J. Rockstroh, C.
Thio, and Y. Benhamou. 2005. Care of patients with chronic hepatitis B and
HIV co-infection: recommendations from an HIV-HBV international
panel. AIDS 19:221–240.
Squadrito, G., T. Pollicino, I. Cacciola, G. Caccamo, D. Villari, T. La Masa,
T. Restuccia, E. Cucinotta, C. Scisca, D. Magazzu, and G. Raimondo. 2006.
Occult hepatitis B virus infection is associated with the development of
hepatocellular carcinoma in chronic hepatitis C patients. Cancer 106:1326–
1330.
Stelzl, E., Z. Muller, E. Marth, and H. H. Kessler. 2004. Rapid quantification of hepatitis B virus DNA by automated sample preparation and
real-time PCR. J. Clin. Microbiol. 42:2445–2449.
Stuyver, L., S. De Gendt, C. Van Geyt, F. Zoulim, M. Fried, R. F. Schinazi,
and R. Rossau. 2000. A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J. Gen. Virol. 81:67–74.
Sung, J. J., M. L. Wong, S. Bowden, C. T. Liew, A. Y. Hui, V. W. Wong,
N. W. Leung, S. Locarnini, and H. L. Chan. 2005. Intrahepatic hepatitis B
virus covalently closed circular DNA can be a predictor of sustained response to therapy. Gastroenterology 128:1890–1897.
Toan, N. L., H. Song le, P. G. Kremsner, D. N. Duy, V. Q. Binh, B.
Koeberlein, S. Kaiser, R. Kandolf, J. Torresi, and C. T. Bock. 2006. Impact
of the hepatitis B virus genotype and genotype mixtures on the course of
liver disease in Vietnam. Hepatology 43:1375–1384.
Torbenson, M., and D. L. Thomas. 2002. Occult hepatitis B. Lancet Infect.
Dis. 2:479–486.
Tran, N., R. Berne, R. Chann, M. Gauthier, D. Martin, M. A. Armand, A.
Ollivet, C. G. Teo, S. Ijaz, D. Flichman, M. Brunetto, K. P. Bielawski, C.
Pichoud, F. Zoulim, and G. Vernet. 2006. European multicenter evaluation
of high-density DNA probe arrays for detection of hepatitis B virus resistance mutations and identification of genotypes. J. Clin. Microbiol. 44:
2792–2800.
van Bommel, F., B. Zollner, C. Sarrazin, U. Spengler, D. Huppe, B. Moller,
H. H. Feucht, B. Wiedenmann, and T. Berg. 2006. Tenofovir for patients
with lamivudine-resistant hepatitis B virus (HBV) infection and high HBV
DNA level during adefovir therapy. Hepatology 44:318–325.
van der Eijk, A. A., H. G. Niesters, B. E. Hansen, R. A. Heijtink, H. L.
Janssen, S. W. Schalm, and R. A. de Man. 2006. Quantitative HBV DNA
levels as an early predictor of nonresponse in chronic HBe-antigen positive
hepatitis B patients treated with interferon-alpha. J. Viral Hepat. 13:96–
103.
van Nunen, A. B., B. E. Hansen, D. J. Suh, H. F. Lohr, L. Chemello, H.
Fontaine, J. Heathcote, B. C. Song, H. L. Janssen, R. A. de Man, and S. W.
Schalm. 2003. Durability of HBeAg seroconversion following antiviral therapy for chronic hepatitis B: relation to type of therapy and pretreatment
serum hepatitis B virus DNA and alanine aminotransferase. Gut 52:420–
424.
Wai, C. T., C. J. Chu, M. Hussain, and A. S. Lok. 2002. HBV genotype B
is associated with better response to interferon therapy in HBeAg(⫹)
chronic hepatitis than genotype C. Hepatology 36:1425–1430.
Weber, B., W. Melchior, R. Gehrke, H. W. Doerr, A. Berger, and H. Rabenau. 2001. Hepatitis B virus markers in anti-HBc only positive individuals. J. Med. Virol. 64:312–319.
Weiss, J., H. Wu, B. Farrenkopf, T. Schultz, G. Song, S. Shah, and J. Siegel.
2004. Real time TaqMan PCR detection and quantitation of HBV genotypes A-G with the use of an internal quantitation standard. J. Clin. Virol.
30:86–93.
MOLECULAR TESTING FOR CHRONIC HEPATITIS B
439
147. Werle-Lapostolle, B., S. Bowden, S. Locarnini, K. Wursthorn, J. Petersen,
G. Lau, C. Trepo, P. Marcellin, Z. Goodman, W. E. T. Delaney, S. Xiong,
C. L. Brosgart, S. S. Chen, C. S. Gibbs, and F. Zoulim. 2004. Persistence of
cccDNA during the natural history of chronic hepatitis B and decline during
adefovir dipivoxil therapy. Gastroenterology 126:1750–1758.
148. Westland, C., W. T. Delaney, H. Yang, S. S. Chen, P. Marcellin, S.
Hadziyannis, R. Gish, J. Fry, C. Brosgart, C. Gibbs, M. Miller, and S.
Xiong. 2003. Hepatitis B virus genotypes and virologic response in 694
patients in phase III studies of adefovir dipivoxil. Gastroenterology 125:
107–116.
149. Westland, C. E., H. Yang, W. E. T. Delaney, C. S. Gibbs, M. D. Miller, M.
Wulfsohn, J. Fry, C. L. Brosgart, and S. Xiong. 2003. Week 48 resistance
surveillance in two phase 3 clinical studies of adefovir dipivoxil for chronic
hepatitis B. Hepatology 38:96–103.
150. Wong, D. K., A. M. Cheung, K. O’Rourke, C. D. Naylor, A. S. Detsky, and
J. Heathcote. 1993. Effect of alpha-interferon treatment in patients with
hepatitis B e antigen-positive chronic hepatitis B. A meta-analysis. Ann.
Intern. Med. 119:312–323.
151. Wong, D. K., M. F. Yuen, R. T. Poon, J. C. Yuen, J. Fung, and C. L. Lai.
2006. Quantification of hepatitis B virus covalently closed circular DNA in
patients with hepatocellular carcinoma. J. Hepatol. 45:553–559.
152. Wong, D. K., M. F. Yuen, H. Yuan, S. S. Sum, C. K. Hui, J. Hall, and C. L.
Lai. 2004. Quantitation of covalently closed circular hepatitis B virus DNA
in chronic hepatitis B patients. Hepatology 40:727–737.
153. World Health Organization. 2000. Hepatitis B. (Fact sheet no. 204.) World
Health Organization, Geneva, Switzerland.
154. Wursthorn, K., M. Lutgehetmann, M. Dandri, T. Volz, P. Buggisch, B.
Zollner, T. Longerich, P. Schirmacher, F. Metzler, M. Zankel, C. Fischer,
G. Currie, C. Brosgart, and J. Petersen. 2006. Peginterferon alpha-2b plus
adefovir induce strong cccDNA decline and HBsAg reduction in patients
with chronic hepatitis B. Hepatology 44:675–684.
155. Yang, H., X. Qi, A. Sabogal, M. Miller, S. Xiong, and W. E. T. Delaney.
2005. Cross-resistance testing of next-generation nucleoside and nucleotide
analogues against lamivudine-resistant HBV. Antivir. Ther. 10:625–633.
156. Yao, J. D., M. G. Beld, L. L. Oon, C. H. Sherlock, J. Germer, S. Menting,
S. Y. Se Thoe, L. Merrick, R. Ziermann, J. Surtihadi, and H. J. Hnatyszyn.
2004. Multicenter evaluation of the VERSANT Hepatitis B Virus DNA 3.0
assay. J. Clin. Microbiol. 42:800–806.
157. Yeh, C. T., R. N. Chien, C. M. Chu, and Y. F. Liaw. 2000. Clearance of the
original hepatitis B virus YMDD-motif mutants with emergence of distinct
lamivudine-resistant mutants during prolonged lamivudine therapy. Hepatology 31:1318–1326.
158. Yim, H. J., and A. S. Lok. 2006. Natural history of chronic hepatitis B virus
infection: what we knew in 1981 and what we know in 2005. Hepatology
43:S173–S181.
159. Yu, M. W., S. H. Yeh, P. J. Chen, Y. F. Liaw, C. L. Lin, C. J. Liu, W. L. Shih,
J. H. Kao, D. S. Chen, and C. J. Chen. 2005. Hepatitis B virus genotype and
DNA level and hepatocellular carcinoma: a prospective study in men.
J. Natl. Cancer Inst. 97:265–272.
160. Yuan, H. J., M. F. Yuen, D. Ka-Ho Wong, E. Sablon, and C. L. Lai. 2005.
The relationship between HBV-DNA levels and cirrhosis-related complications in Chinese with chronic hepatitis B. J. Viral Hepat. 12:373–379.
161. Yuen, L. K., A. Ayres, M. Littlejohn, D. Colledge, A. Edgely, W. J. Maskill,
S. A. Locarnini, and A. Bartholomeusz. 22 December 2006, posting date.
SEQHEPB: a sequence analysis program and relational database system for
chronic hepatitis B. Antiviral Res. doi:10.1016/j.antiviral.2006.11.014.
162. Yuen, M. F., D. K. Wong, E. Sablon, E. Tse, I. O. Ng, H. J. Yuan, C. W. Siu,
T. J. Sander, E. J. Bourne, J. G. Hall, L. D. Condreay, and C. L. Lai. 2004.
HBsAg seroclearance in chronic hepatitis B in the Chinese: virological,
histological, and clinical aspects. Hepatology 39:1694–1701.
163. Yuen, M. F., D. K. Wong, E. Sablon, H. J. Yuan, S. M. Sum, C. K. Hui, A. O.
Chan, B. C. Wang, and C. L. Lai. 2003. Hepatitis B virus genotypes B and
C do not affect the antiviral response to lamivudine. Antivir. Ther. 8:531–
534.
164. Yuen, M. F., D. K. Wong, S. S. Sum, H. J. Yuan, J. C. Yuen, A. O. Chan,
B. C. Wong, and C. L. Lai. 2005. Effect of lamivudine therapy on the serum
covalently closed-circular (ccc) DNA of chronic hepatitis B infection.
Am. J. Gastroenterol. 100:1099–1103.
165. Yuen, M. F., H. J. Yuan, C. K. Hui, D. K. Wong, W. M. Wong, A. O. Chan,
B. C. Wong, and C. L. Lai. 2003. A large population study of spontaneous
HBeAg seroconversion and acute exacerbation of chronic hepatitis B infection: implications for antiviral therapy. Gut 52:416–419.
166. Zacharakis, G. H., J. Koskinas, S. Kotsiou, M. Papoutselis, F. Tzara, N.
Vafeiadis, A. J. Archimandritis, and K. Papoutselis. 2005. Natural history
of chronic HBV infection: a cohort study with up to 12 years follow-up in
North Greece (part of the Interreg I-II/EC-project). J. Med. Virol. 77:173–
179.
167. Zollner, B., J. Petersen, E. Puchhammer-Stockl, J. Kletzmayr, M.
Sterneck, L. Fischer, M. Schroter, R. Laufs, and H. H. Feucht. 2004.
Viral features of lamivudine resistant hepatitis B genotypes A and D.
Hepatology 39:42–50.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 440–458
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00001-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Carbapenemases: the Versatile ␤-Lactamases
Anne Marie Queenan* and Karen Bush
Johnson & Johnson Pharmaceutical Research & Development, L.L.C., Raritan, New Jersey 08869
INTRODUCTION .......................................................................................................................................................440
CLASSIFICATION SCHEMES ................................................................................................................................440
MOLECULAR CLASS A CARBAPENEMASES ....................................................................................................441
Chromosomally Encoded Enzymes: SME, NMC, and IMI...............................................................................441
Plasmid-Encoded Enzymes: KPC and GES ........................................................................................................444
CLASS B METALLO-␤-LACTAMASES .................................................................................................................445
Recent Epidemiology ..............................................................................................................................................446
CLASS D SERINE-CARBAPENEMASES: THE OXA ␤-LACTAMASES ..........................................................448
DETECTION OF CARBAPENEMASES .................................................................................................................450
MICs .........................................................................................................................................................................450
Microbiological Tests with Inhibitors ..................................................................................................................450
Biochemical and Molecular Tests ........................................................................................................................452
CARBAPENEMASE ORIGINS AND TRANSMISSION.......................................................................................452
CONCLUDING REMARKS ......................................................................................................................................452
REFERENCES ............................................................................................................................................................453
fication of plasmid-encoded IMP-1, a metallo-␤-lactamase in
Pseudomonas aeruginosa (228), ARI-1 (OXA-23), a class D
carbapenemase in Acinetobacter baumannii (157, 191), and
KPC-1, a class A carbapenemase in Klebsiella pneumoniae
(245), has changed the patterns of carbapenemase dissemination. What was once considered to be a problem of clonal
spread has now become a global problem of interspecies dispersion. Because of the proliferation of new members of established carbapenemase families, it is even more important to
try to understand the properties of these enzymes, with all their
strengths and limitations. Several excellent carbapenemase reviews have appeared recently, including detailed compilations
of the kinetic characteristics of these enzymes (112, 150, 221,
225). Therefore, this review focuses on updated information on
the epidemiological and biochemical characteristics of both
metallo- and serine carbapenemases.
INTRODUCTION
Carbapenemases represent the most versatile family of
␤-lactamases, with a breadth of spectrum unrivaled by other
␤-lactam-hydrolyzing enzymes. Although known as “carbapenemases,” many of these enzymes recognize almost all hydrolyzable ␤-lactams, and most are resilient against inhibition by
all commercially viable ␤-lactamase inhibitors (114, 150, 225).
Some investigators have preferred the nomenclature “carbapenem-hydrolyzing enzymes” to the term “carbapenemases,”
suggesting that carbapenems are but one segment of their
substrate spectrum (182). However, the term carbapenemase
has become entrenched in the ␤-lactamase literature and is
used throughout this review.
Carbapenemases belong to two major molecular families,
distinguished by the hydrolytic mechanism at the active site.
The first carbapenemases described were from gram-positive
bacilli. Unlike other ␤-lactamases known at that time, these
enzymes were inhibited by EDTA, thereby establishing them
as metalloenzymes. Later work has shown that all metallocarbapenemases contain at least one zinc atom at the active
site that serves to facilitate hydrolysis of a bicyclic ␤-lactam
ring (46). In the mid- to late 1980s, another set of carbapenem-hydrolyzing enzymes emerged among the Enterobacteriaceae (134), but EDTA did not inhibit their activity
(183). Subsequent studies showed that these enzymes utilized serine at their active sites and were inactivated by the
␤-lactamase inhibitors clavulanic acid and tazobactam (183,
243).
Until the early 1990s, all carbapenemases were described as
species-specific, chromosomally encoded ␤-lactamases, each
with a well-defined set of characteristics. However, the identi-
CLASSIFICATION SCHEMES
Classification of ␤-lactamases can be defined according to
two properties, functional and molecular. In the early work
with ␤-lactamases, before genes were routinely cloned and
sequenced, a new ␤-lactamase was analyzed biochemically by
isolating the protein and determining its isoelectric point, followed by enzymatic studies to determine substrate hydrolysis
and inhibition characteristics (185, 202). The relative rates of
hydrolysis for a broad spectrum of ␤-lactam substrates, and
inhibitor profiles, allowed for the classification of the new
␤-lactamase. This functional classification process evolved
over many years into a widely accepted scheme currently
dividing the known ␤-lactamases into four major functional
groups (groups 1 to 4), with multiple subgroups under group
2 that are differentiated according to group-specific substrate or inhibitor profiles (22). In this functional classification scheme, carbapenemases are found primarily in groups
2f and 3.
Classification based on amino acid homology has resulted in
* Corresponding author. Mailing address: Johnson & Johnson Pharmaceutical Research & Development, L.L.C., Raritan, NJ 08869.
Phone: (908) 704-5515. Fax: (908) 707-3501. E-mail: aqueenan@prdus
.jnj.com.
440
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
VOL. 20, 2007
441
TABLE 1. Classification of class B metallo-␤-lactamases: subclass designations of representative metallo-␤-lactamases and consensus
sequences based on structural similarities to identified Zn2⫹ ligandsa
Ligand(s)b
␤-Lactamase
Substrate(s)
Zn1
116
Subclass B1 (BcII, IMP-1, CcrA,
VIM-2, SPM-1)
Subclass B2c (CphA, Sfh-1)
Subclass B3 (L1, FEZ-1, Gob-1,
CAU-1)
118
Zn2
196
120/121
221
263
Broad spectrum
His
His
His
Asp/(Arg/Cys)
Cys
His
Preferential hydrolysis of carbapenems
Preferential hydrolysis of cephalosporins
(Asn)
His/Gln
(His)
His
(His)
His
Asp/(Arg)
Asp/Hisd
Cys
(Ser)
His
His
a
Data are from references 46, 50, and 51.
Amino acids in parentheses do not appear to be active-site zinc ligands.
Zn1 ligand for subclass B2 is inhibitory to enzymatic activity. The amino acids indicated have not been confirmed crystallographically to bind this Zn2⫹ atom.
d
His121 replaces Cys221 as the second zinc ligand.
b
c
four major classes (5, 76, 84), which correlate well with the
functional scheme but lack the detail concerning the enzymatic
activity of the enzyme. Molecular classes A, C, and D include the ␤-lactamases with serine at their active site,
whereas molecular class B ␤-lactamases are all metalloenzymes with an active-site zinc. Carbapenemases, ␤-lactamases with catalytic efficiencies for carbapenem hydrolysis, resulting in elevated carbapenem MICs, include enzymes from
classes A, B, and D.
Functional classification schemes that included carbapenemases were first proposed by Bush in 1988 (21). A number of
subclassification schemes for the metallo-␤-lactamases have
subsequently been proposed over the past 10 years. Rasmussen
and Bush in 1997 suggested that the functional group 3 metalloenzymes (22) could be divided into three functional subgroups, based primarily on substrate specificities (182),
whereas molecular subclasses have been proposed by Frere
and colleagues for a number of years (46, 50, 51). In addition
to these proposals, other modifications have been suggested
for the classification of the metallo-␤-lactamases (60). These
enzymes are currently divided into three subclasses based on a
combination of structural features, zinc affinities for the two
binding sites, and hydrolysis characteristics. A consensus
scheme is shown in Table 1. Subclasses B1 and B3, divided by
amino acid homology, bind two zinc atoms for optimal hydrolysis, while enzymes in subclass B2 are inhibited when a second
zinc is bound. Subclass B2 also differs in hydrolysis spectrum,
as it preferentially hydrolyzes carbapenems, in contrast to the
broad hydrolysis spectrum observed for B1 and B3 enzymes
(46).
MOLECULAR CLASS A CARBAPENEMASES
Class A serine carbapenemases of functional group 2f have
appeared sporadically in clinical isolates since their first discovery over 20 years ago (134). These ␤-lactamases have been
detected in Enterobacter cloacae, Serratia marcescens, and Klebsiella spp. as single isolates or in small outbreaks (134, 149,
243). Bacteria expressing these enzymes are characterized by
reduced susceptibility to imipenem, but MICs can range from
mildly elevated (e.g., imipenem MICs of ⱕ4 ␮g/ml) to fully
resistant. These ␤-lactamases, therefore, may go unrecognized
following routine susceptibility testing.
Three major families of class A serine carbapenemases include the NMC/IMI, SME, and KPC enzymes. Their hydrolytic
mechanism requires an active-site serine at position 70 in the
Ambler numbering system for class A ␤-lactamases (6). All
have the ability to hydrolyze a broad variety of ␤-lactams,
including carbapenems, cephalosporins, penicillins, and aztreonam,
and all are inhibited by clavulanate and tazobactam, placing
them in the group 2f functional subgroup of ␤-lactamases. A
fourth member of this class, the GES ␤-lactamases, was
originally identified as an ESBL family, but over time variants were discovered that had low, but measurable, imipenem hydrolysis. This subgroup of GES enzymes is also
classified as functional group 2f carbapenemases. Table 2
shows the geographical and chronological detection of the
class A carbapenemases.
Chromosomally Encoded Enzymes: SME, NMC, and IMI
The antibiotic resistance profile of strains expressing the
chromosomal group 2f ␤-lactamases is distinctive: carbapenem resistance coupled with susceptibility to extendedspectrum cephalosporins. SME-1 (for “Serratia marcescens
enzyme”) was first detected in England from two S. marcescens isolates that were collected in 1982 (146, 243). The
SME-1 ␤-lactamase, along with the nearly identical SME-2
and SME-3, has been found sporadically throughout the
United States (49, 178, 179, 208). Infections caused by SMEproducing S. marcescens infections were found as single
incidents or small clusters of up to 19 isolates. SME-producing S. marcescens isolates from different geographical
locations are not identical, as defined by pulsed-field gel
electrophoresis (PFGE), although there may be some degree of clonal spread when several isolates are collected
from one location (178, 208).
The IMI (for “imipenem-hydrolyzing ␤-lactamase”) and
NMC-A (for “not metalloenzyme carbapenemase”) enzymes
have been detected in rare clinical isolates of E. cloacae in the
United States, France, and Argentina (149, 175, 181, 183).
NMC-A and IMI-1 have 97% amino acid identity and are
related to SME-1, with approximately 70% amino acid identity
(146, 183). They all contain the conserved active-site motifs
S-X-X-K, S-D-N, and K-T-G of the class A ␤-lactamases. In
addition, these carbapenemases have conserved cysteine
442
QUEENAN AND BUSH
CLIN. MICROBIOL. REV.
TABLE 2. Emergence of class A carbapenemases
␤-Lactamase
Yr
Location
No. of
isolates
Organism
Gene locationa
pIb
GenBank
accession no.
Reference(s)
SME-1
1982
1985
1999
London, United Kingdom
Minnesota
Illinois
S. marcescens
S. marcescens
S. marcescens
2
1
2
Chrom
Chrom
NR
9.7
9.5
8.5
U60295c
146, 199, 243
179, 199
49
SME-2
1992
1994–1999
California
Massachusetts
S. marcescens
S. marcescens
5
19
Chrom
Chrom
9.5
9.5
AF275256
179
179
SME-3
2003
Illinois
S. marcescens
2
Chrom
9.5
AY584237
178
IMI-1
1984
California
E. cloacae
2
Chrom
7.05
U50278
183
IMI-2
2001
Hangzhou, China
E. cloacae
1
Plasmid
8.1
AY780889
249
NMC-A
1990
2000
2003
Paris, France
Buenos Aires, Argentina
Washington
E. cloacae
E. cloacae
E. cloacae
1
1
1
Chrom
NR
NR
6.9
6.9
6.9
Z21956
AJ536087
143, 149
181
175
KPC-1
1996
North Carolina
K. pneumoniae
1
Plasmid
6.7
AF297554
245
KPC-2
1998–1999
Maryland
K. pneumoniae
4
Plasmid
6.9
AY034847
138
KPC-2
1998
Maryland
1
Plasmid
6.7
AF481906
137
1998
1997–2001
New York
New York
2002–2003
2003–2004
2004
2004
2005
2005
2005
2005
2006
2006
New York
New York
New York
Zhejiang, China
Paris, France
Medellin, Colombia
New York
Israel
Medellin, Colombia
Medellin, Colombia
Plasmid
NR
NR
Plasmid
NR
NR
NR
NR
NR
Plasmid
Plasmid
Plasmid
NR
Plasmid
Plasmid/Chrom
Plasmid
6.7
6.7
6.7
6.9
6.7
6.7
NR
NR
6.7
6.7
6.8
7.0
NR
6.7
6.8
6.8
246
13
Massachusetts
New York
1
18
1
4
1
1
29
95
59
1
1
2
3
4
3
1
AY210887
2001
2001–2003
Salmonella enterica
serotype Cubana
K. oxytoca
K. pneumoniae
K. oxytoca
Enterobacter spp.
E. cloacae
E. aerogenes
K. pneumoniae
K. pneumoniae
K. pneumoniae
K. pneumoniae
K. pneumoniae
K. pneumoniae
K. pneumoniae
E. coli
P. aeruginosa
C. freundii
KPC-3
2000–2001
2003
2004
New York
New York
New York
K. pneumoniae
E. cloacae
K. pneumoniae
24
1
3
Plasmid
NR
NR
6.5
6.7
6.7
AF395881
AY522950
233
14
16
KPC-4
2004
Scotland
Enterobacter spp.
NR
NR
AY700571
None
(unpublished)
GES-2
2000
2000
2004
South Africa
South Africa
South Africa
P. aeruginosa
P. aeruginosa
P. aeruginosa
1
8
51
Plasmid
Plasmid
NR
5.8
5.8
NR
AF326355
174
173
230
GES-4
2002
Japan
K. pneumoniae
1
Plasmid
6.9
AB11620
219, 220
GES-5
2004
2004
Athens, Greece
Korea
E. coli
K. pneumoniae
1
6
Plasmid
Plasmid
5.8
5.8
AY494717
218
86
GES-6
2004
Athens, Greece
K. pneumoniae
1
Plasmid
6.9
AY494718
218
1
74
14
DQ897687
DQ523564
15
17
16
229
145
217
118
147
216
216
a
Chrom, chromosome; NR, not reported.
NR, not reported.
Two sequences differing by a single amino acid, Z28968 and U60295, for the S. marcescens S6 carbapenemase are reported in the GenBank database. Structural
analysis and further sequencing confirmed U60295 as the correct sequence for the SME-1 enzyme (179, 199).
b
c
residues at positions 69 and 238 that form a disulfide bridge.
The genes for these three ␤-lactamases are all chromosomally located, with no evidence of mobile element association,
a fact that may have contributed to their rarity. More re-
cently, however, genes encoding IMI-2 ␤-lactamases were
found on plasmids in Enterobacter asburiae from United
States rivers and on a plasmid from an E. cloacae isolate
from China (9, 249).
VOL. 20, 2007
Substrate
Rel
kcat
(%)
185
28
92
4.4
90
956
NA
93
125
Km
(␮M)
15
9.3
11
2.7
0.052
0.30
NA
0.053
5.7
kcat/Km
2,000
36
89
10
0.0068
3.4
NA
0.3
51
kcat (s⫺1)
100
1.8
4.5
0.5
0.00034
0.17
NA
0.015
2.6
Rel kcat
(%)
1,070
64
170
26
270
190
NA
45
93
Km
(␮M)
1.9
0.56
0.52
0.38
0.000025
0.018
NA
0.0067
0.55
kcat/Km
530
63
31
3.6
0.49
17
12
0.95
66
kcat
(s⫺1)
100
12
5.8
0.68
0.092
3.2
2.3
0.18
12
Rel kcat
(%)
510
30
90
13
230
100
540
140
420
Km
(␮M)
1.0
2.1
0.34
0.28
0.0021
0.17
0.022
0.0068
0.16
kcat/Km
490
130
0.38
NA
2.5
17
NA
85
NDH
kcat
(s⫺1)
100
27
0.078
NA
0.51
3.4
NA
17
ND
Rel kcat
(%)
2,200
160
4.7
NA
1,500
700
NA
810
ND
Km
(␮M)
0.22
0.81
0.081
NA
0.0017
0.024
NA
0.11
ND
kcat/Km
TABLE 3. Steady-state kinetic parameters for representative class A carbapenemasesa
kcat
(s⫺1)
100
9.2
37
0.43
0.17
10
NA
0.18
25
GES-4
kcat/Km
2,820
260
1,040
12
4.7
286
NA
5.0
707
KPC-2
Km
(␮M)
1.3
1.1
0.51
0.68
ND
ND
NA
ND
0.42
IMI-1
Rel
kcat
(%)
770
17
202
13
ND
ND
NA
ND
260
NMC-A
kcat
(s⫺1)
100
1.9
11
0.91
⬍0.01
⬍0.10
NA
⬍0.02
11
SME-1
980
19
104
8.9
⬍0.07
⬍0.98
NA
⬍0.15
108
References: SME-1, 179; NMC-A, 124; IMI-1, 183; KPC-2, 246; GES-4, 219. Abbreviations: Rel kcat, kcat relative to that of cephaloridine; ND, not determinable; NA, no data available; NDH, no detectable hydrolysis.
Cephaloridine
Benzylpenicillin
Imipenem
Meropenem
Ceftazidime
Cefotaxime
Cefepime
Cefoxitin
Aztreonam
a
Biochemical characterization of purified SME, NMC, and
IMI enzymes revealed a broad hydrolysis spectrum that includes the penicillins, early cephalosporins, aztreonam, and
carbapenems (Tables 3 and 4). Imipenem hydrolysis was easily
measurable, with kcat values of ⬎30 s⫺1. Meropenem had
lower kcat and Km values than did imipenem. Cefoxitin and
extended-spectrum cephalosporins were inefficiently hydrolyzed, when hydrolysis could be detected at all, and cefotaxime
was hydrolyzed faster than ceftazidime (124, 179, 183).
These chromosomal ␤-lactamases can be induced in response to imipenem and cefoxitin. Sequencing of the regions
upstream of NMC-A, IMI-1, and SME-1 revealed the presence
of a divergently transcribed gene related to the LysR family of
DNA-binding transcriptional regulatory genes (143, 146, 183).
Deletions within the nmcR gene eliminated the inducibility of
NMC-A and reduced carbapenem MICs, defining a role for
this protein as a positive regulator of NMC-A expression (143).
The ImiR protein is 97% identical to NmcR, but an analysis of
its regulatory effects has not been published. SmeR is 69%
identical to NmcR but has weaker activity as a positive regulator of the blaSME-1 gene.
Two crystal structures of NMC-A, one native and the other
complexed with a penicillanic acid inhibitor, and a structure for
SME-1 all show that the overall structure and catalytic residues
are similar to those of other class A ␤-lactamases (139, 199,
201). For NMC-A, the structure of the enzyme did not change
conformation when the inhibitor was bound. The disulfide
bond between positions 69 and 238 is located near the active
site, a feature common among the class A carbapenemases.
This disulfide bond is necessary for hydrolytic activity, not just
for imipenem hydrolysis, suggesting that it is required to stabilize the enzyme structurally (123, 199).
The two most prominent distinctions between the class A
TEM-1 structure and NMC-A are a 1-Å alteration of the
position of Asn132, which enlarges the substrate-binding cavity, and a change in conformation of the S3 strand between
residues 237 and 240, which increases access to the active site.
However, in the crystal structure of SME-1, the position of
Asn132 was almost identical to the Asn132 residue position
of TEM-1 (199). The major difference in the SME-1 structure compared to TEM and NMC-A was crowding of Ser70
and Glu166 in the active-site cleft, leaving no room for a
catalytic water molecule. It is possible that conformational
rearrangements upon substrate binding may allow a catalytic
water molecule into this position. The structure of SME-1
complexed with a ␤-lactam molecule would test this hypothesis.
In structure/function studies using site-directed mutagenesis, the ability of the SME-1 ␤-lactamase to hydrolyze imipenem could not be attributed to a single amino acid residue
(122). A substitution of alanine for serine at position 237
reduced imipenem kcat values from 100 s⫺1 to 20 s⫺1; hydrolysis of cephalothin was also reduced fivefold, but the
benzylpenicillin kcat values remained unchanged (200). It
seems likely that the important conserved residues of the
group 2f carbapenemases together contribute to form an
active site that can accommodate and hydrolyze the carbapenems.
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
443
444
QUEENAN AND BUSH
CLIN. MICROBIOL. REV.
TABLE 4. Substrate and inhibition profiles of the carbapenemases
Hydrolysis profilea
Molecular
class
Functional
group
A
2f
B1
D
Inhibition profileb
Early
cephalosporins
Extendedspectrum
cephalosporins
Aztreonam
Carbapenems
EDTA
Clavulanic
acid
Reference(s)
Penicillins
NMC
IMI
SME
KPC
GES
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫾
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫾
⫺
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫹
⫹
124
183
179
4
174, 219
3
IMP
VIM
GIM
SPM
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫺
⫺
⫺
224
224
224
224
2d
OXA
⫹
⫹
⫾
⫺
⫾
⫺
⫾
225
Enzyme
a
Symbols: ⫹, strong hydrolysis (generally, kcat of ⬎2 s⫺1); ⫾, weak hydrolysis (generally, kcat of 0.5 to 2 s⫺1); ⫺, no measurable hydrolysis reported (generally, kcat
of ⬍0.5 s⫺1).
b
Symbols: ⫹, reported inhibition; ⫾, variable inhibition among ␤-lactamase family members; ⫺, no inhibition reported.
Plasmid-Encoded Enzymes: KPC and GES
Two characteristics separate the KPC (for “Klebsiella pneumoniae carbapenemase”) carbapenemases from the other
functional group 2f enzymes. First, the KPC enzymes are found
on transferable plasmids; second, their substrate hydrolysis
spectrum includes the aminothiazoleoxime cephalosporins,
such as cefotaxime. Although the KPC ␤-lactamases are predominantly found in K. pneumoniae, there have been reports of
these enzymes in Enterobacter spp. and in Salmonella spp. (14,
74, 137).
The first member of the KPC family was discovered through
the ICARE surveillance project in a K. pneumoniae clinical
isolate from North Carolina in 1996 (245). This isolate was
resistant to all ␤-lactams tested, but carbapenem MICs decreased in the presence of clavulanic acid. Carbapenemase
activity, first detected with a bioassay, was associated with a
large plasmid that encoded the KPC-1 ␤-lactamase.
The discovery of KPC-1 was quickly followed by several
reports of a single-amino-acid variant, KPC-2, along the east
coast of the United States (137, 138, 246). KPC-2 was first
identified in 2003 as the result of a point mutation in KPC-1
and appeared in four isolates with imipenem MICs of 2 to 8
␮g/ml from Baltimore, MD, from 1998 to 1999. The KPC-2producing gene resided on a transferable plasmid, and it was
noted that while all isolates exhibited reduced susceptibility to
imipenem, none were technically resistant according to approved CLSI (formerly NCCLS) breakpoints (138). KPC-2 was
then described in another Maryland site on a plasmid in Salmonella enterica (137). Genetic regions around this KPC-2
gene contained three open reading frames with sequence homology to transposases.
Reports of KPC-2 in the New York, NY, area began to
appear in 2004, with KPC-expressing K. pneumoniae currently
an alarming problem (13, 15, 17). This is especially disturbing
because New York has had large outbreaks of ESBL-producing klebsiellae (135, 177) for which carbapenems were considered to be one of the few treatment options (156). When
ribotyping was conducted on the KPC-2-producing strains, the
majority of the isolates were clonal, even when the surveillance
included multiple hospitals in the New York metropolitan
area. Notably, several of these reports described inconsistencies in recognizing some of these strains as carbapenem resistant, because carbapenem MICs were less than the approved
MIC breakpoints (13, 15, 16, 118).
Concurrent with the increasing reports of KPC-2, a singleamino-acid variant of KPC-2, KPC-3, was reported from a
2000 to 2001 Klebsiella pneumoniae outbreak in New York
(233). KPC-3 has also been detected in Enterobacter spp. (14),
where MICs for imipenem were also not consistently in the
resistant range. Kinetic analysis of the KPC-3 enzyme revealed
a profile similar to those of KPC-1 and KPC-2, with a slight
increase in the hydrolysis of ceftazidime (4).
After the rapid expansion of the KPC class of carbapenemases along the east coast of the United States, worldwide
reports began to appear. A report from France in 2005 documented KPC-2 in a K. pneumoniae strain from a patient who
had been in New York for medical treatment (145). KPC
carbapenemases have recently been detected in Scotland
(KPC-4 [GenBank accession no. AY700571]), Colombia (217),
Israel (147), and China (229). The first detection of KPC-2 on
a plasmid in P. aeruginosa has been reported; this represents a
disturbing development in the spread of these carbapenemases
(216).
KPC enzymes have the conserved active-site motifs S-XX-K, S-D-N, and K-T-G of the class A ␤-lactamases and have
the closest amino acid identity (⬃45%) to the SME carbapenemases. In addition, these ␤-lactamases have the conserved
C69 and C238 residues that form a disulfide bond described for
the SME and NMC/IMI enzymes. The structure of the KPC-2
␤-lactamase, compared to the SME-1 and NMC-A carbapenemases and the TEM-1 and SHV-1 noncarbapenemases, reveals characteristics conserved among the carbapenemases.
KPC-2, along with the other carbapenemases, had a decrease
in the size of the water pocket and had the catalytic serine in
a more shallow position of the active-site cleft (92). The combination of subtle active-site adjustments in the class A car-
VOL. 20, 2007
bapenemases is proposed to allow carbapenems access to the
catalytic site, resulting in the altered specificity of these enzymes.
KPC carbapenemases hydrolyze ␤-lactams of all classes,
with the most efficient hydrolysis observed for nitrocefin, cephalothin, cephaloridine, benzylpenicillin, ampicillin, and piperacillin (Tables 3 and 4). Imipenem and meropenem, as well as
cefotaxime and aztreonam, were hydrolyzed 10-fold-less efficiently than the penicillins and early cephalosporins. Weak but
measurable hydrolysis was observed for cefoxitin and ceftazidime, giving the KPC family a broad hydrolysis spectrum
that includes most ␤-lactam antibiotics.
Of the functional group 2f carbapenemases, the KPC family
has the greatest potential for spread due to its location on
plasmids, especially since it is most frequently found in K.
pneumoniae, an organism notorious for its ability to accumulate and transfer resistance determinants. In addition, the
clonal spread seen in several epidemics points to difficulties
with infection control for this organism (13, 15–17, 233). Most
worrisome, treatment of infections caused by these organisms
is extremely difficult because of their multidrug resistance,
which results in high mortality rates (15).
The GES/IBC family of ␤-lactamases is an infrequently encountered family that was first described in 2000 with reports
of IBC-1 (for “integron-borne cephalosporinase”) from an E.
cloacae isolate in Greece (53) and GES-1 (for “Guiana extended spectrum”) in a K. pneumoniae isolate from French
Guiana (168). These enzymes differ by only two amino acid
substitutions and possess the class A active site-motifs with the
cysteine residues at Ambler positions 69 and 238 that have
been found in the KPC, SME, and NMC/IMI families. Their
amino acid sequences show them to be distantly related to
these carbapenemases, with identities of 36% to KPC-2, 35%
to SME-1, and 31% to NMC-A (174).
The genes encoding the GES family of enzymes were located in integrons on plasmids. Because the enzymes had a
broad hydrolysis spectrum that included penicillins and extended-spectrum cephalosporins, they were initially classified as
extended-spectrum ␤-lactamases (53). Their hydrolysis spectrum was expanded in 2001 to include imipenem, with the
report of GES-2 in a clinical isolate of P. aeruginosa (174).
GES-2, from a multidrug-resistant P. aeruginosa isolate from
South Africa, had a single amino acid substitution of glycine to
asparagine at position 170. Imipenem hydrolysis by GES enzymes was slow, with hydrolytic rates of ⱕ0.004 s⫺1and 0.004
s⫺1 for GES-1 and GES-2, respectively. However, the hydrolytic efficiency for imipenem was 100-fold higher for GES-2,
due to a 100-fold decrease in the Km value. The GES-4 ␤-lactamase differed from GES-2 by three amino acids, one of
which was a serine at position 170. Carbapenem kcat values for
purified GES-4 were higher than those for GES-2, with imipenem hydrolyzed at a rate of 0.38 s⫺1 (219).
Nomenclature of the GES/IBC family has undergone several
revisions (105). A consensus nomenclature has been reached
whereby the IBC names have been converted to the GES
nomenclature (83, 105). At least nine GES variants have been
described, with GES-9 recently identified in a P. aeruginosa
isolate from France (164). Of these closely related enzymes,
GES-2, GES-4, GES-5, and GES-6 have substitutions of as-
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
445
paragine or serine at position 170, associated with imipenem
hydrolysis (105, 218).
Although rare, GES enzymes have been identified worldwide, with reports from Greece, France, Portugal, South Africa, French Guiana, Brazil, Argentina, Korea, and Japan (25,
33, 42, 86, 90, 155, 164, 168, 173, 186, 218–220). These enzymes
have been most frequently associated with single occurrences.
However, P. aeruginosa strains expressing GES-2 have caused
a small nosocomial outbreak in eight patients (173), and six
patients in Korea had infections caused by GES-5-producing
K. pneumoniae (86).
CLASS B METALLO-␤-LACTAMASES
The metallo-␤-lactamases have been thoroughly reviewed
recently (221, 224), and so this section serves as a summary and
epidemiological update. This class of ␤-lactamases is characterized by the ability to hydrolyze carbapenems and by its
resistance to the commercially available ␤-lactamase inhibitors
but susceptibility to inhibition by metal ion chelators. The
substrate spectrum is quite broad; in addition to the carbapenems, most of these enzymes hydrolyze cephalosporins and
penicillins but lack the ability to hydrolyze aztreonam. The
mechanism of hydrolysis is dependent on interaction of the
␤-lactams with zinc ions in the active site of the enzyme, resulting in the distinctive trait of their inhibition by EDTA, a
chelator of Zn2⫹ and other divalent cations.
The first metallo-␤-lactamases detected and studied were
chromosomal enzymes present in environmental and opportunistic pathogenic bacteria such as Bacillus cereus (98, 109),
Aeromonas spp. (78), and Stenotrophomonas maltophilia (188).
These chromosomal enzymes were usually found in bacteria
that also expressed at least one serine ␤-lactamase, with both
␤-lactamases inducible after exposure to ␤-lactams. Fortunately, with the exception of S. maltophilia, these bacteria have
not been frequently associated with serious nosocomial infections, as they are generally opportunistic pathogens, and the
chromosomal metallo-␤-lactamase genes are not easily transferred.
Early classification based on functional analyses of purified
proteins indicated that these ␤-lactamases were distinctive
from the groups of enzymes that had a serine-based hydrolytic
mechanism (21). Major distinctive properties included the requirement of Zn2⫹ for the efficient hydrolysis of ␤-lactams and
a lack of inhibition by clavulanic acid and tazobactam. A defining aspect of their substrate spectrum was the ability to
hydrolyze carbapenems (Table 4). Interestingly, not all of the
metallo-␤-lactamases readily hydrolyzed nitrocefin, the popular colorimetric indicator of ␤-lactamase activity (130). The
“hidden” carbapenemases of Aeromonas spp. hydrolyzed nitrocefin and other cephalosporins imperceptibly and could be
detected only by using a carbapenem bioassay or hydrolysis test
(64, 65, 196, 223, 241). Recently, the VIM-2 enzyme was shown
to share this property and was detected on IEF gels by an
imipenem hydrolysis detection method (171).
Since the initial identification of the metallo-␤-lactamases, a
considerable amount of sequencing work has demonstrated
high variability in primary sequences and in molecular structures. The first metallo-␤-lactamases for which an amino acid
sequence was determined was the BCII metallo-␤-lactamase
446
QUEENAN AND BUSH
from Bacillus cereus (77), the prototypical metallo-␤-lactamase
for many years. Extensive molecular characterization, including biochemical and crystallization studies, has also been completed with the CcrA (CfiA) chromosomal metallo-␤-lactamase that appears in a small percentage of Bacteroides fragilis
strains (32, 242). Amino acid sequence identities are as low as
23% across the metallo-␤-lactamases, including enzymes such
as CcrA, CphA, and L1 (Table 1) (182, 224). However, all of
the enzymes have conserved residues that bind zinc at two sites
(see “Classification Schemes,” above, and Table 1) and exhibit
a well-conserved active site, as demonstrated through sophisticated modeling analyses (127) and in the crystal structures
published to date (31, 32, 34, 44, 52, 141, 214).
In contrast to the chromosomal metallo-␤-lactamases,
whose presence is directly correlated with the prevalence of the
producing species, there has been a dramatic increase in the
detection and spread of the acquired or transferable families of
these metalloenzymes. The most common metallo-␤-lactamase
families include the VIM, IMP, GIM, and SIM enzymes, which
are located within a variety of integron structures, where they
have been incorporated as gene cassettes. When these integrons become associated with plasmids or transposons, transfer between bacteria is readily facilitated.
Transferable imipenem resistance was first detected in Japan, initially in a P. aeruginosa isolate, in 1990 (228), followed
by a second report of a transferable carbapenemase in B.
fragilis (11). The transferable B. fragilis enzyme was one of the
first characterized metallo-␤-lactamases, but this species has
not caused widespread clinical outbreaks in Japan. In contrast,
IMP-1 (for “active on imipenem”), located on a conjugative
plasmid in the P. aeruginosa clinical isolate (228), was found on
an integron in S. marcescens and other Enterobacteriaceae in
Japan (7, 72, 80, 195). This enzyme hydrolyzed imipenem,
penicillins, and extended-spectrum cephalosporins but not
aztreonam. The hydrolytic activity was inhibited by EDTA and
restored by the addition of Zn2⫹. The first member of the IMP
family found in Europe was in an A. baumannii isolate from
Italy, which produced a related enzyme, IMP-2, as the first
cassette on a class 1 integron (184). Since that time, the IMP
family has been found throughout the world, with the most
recent spread to the United States and Australia (62, 159). The
historical discovery of IMP-type ␤-lactamases is well documented in the recent review by Walsh et al. (224). Currently,
the IMP family members number up to 18 in the published literature, with 23 assigned IMP sequences listed on the ␤-lactamase
nomenclature website (http://www.lahey.org/Studies/ [updated 17
November 2006]).
Another prevalent family of integron-associated metallo-␤lactamases is composed of the VIM enzymes. VIM-1 (for “Verona integron-encoded metallo-␤-lactamase”) was first isolated in Verona, Italy, in 1997 (101), with the identification of
VIM-2 in France in 1996 subsequently reported (171). Both of
these enzymes were initially found in P. aeruginosa clinical
isolates and resided in class 1 integrons. The VIM family currently
consists of 14 members (http://www.lahey.org/Studies/ [updated
17 November 2006]), with occurrences mostly in P. aeruginosa
within multiple-integron cassette structures. VIM-2 has the
dubious distinction of being the most-reported metallo-␤-lactamase worldwide (224).
Identification of the SPM-1 metallo-␤-lactamase defined a
CLIN. MICROBIOL. REV.
new family with 35.5% amino acid identity to IMP-1 (206).
SPM-1 (for “Sao Paulo metallo-␤-lactamase”) was first isolated in a P. aeruginosa strain in Sao Paolo, Brazil. Since the
initial report, single clones of SPM-1-containing P. aeruginosa
have caused multiple hospital outbreaks with high mortality in
Brazil (126, 169, 251). Genetic analysis of regions around the
SPM-1 gene revealed that it was not part of an integron but
instead was associated with common regions that contain a
new type of transposable structure with potential recombinase
and promoter sequences (169, 206).
GIM-1 (for “German imipenemase”) was isolated in Germany in 2002 (26). GIM had approximately 30% homology to
VIM, 43% homology to IMPs, and 29% homology to SPM.
GIM-1 has characteristics similar to those of the other acquired metallo-␤-lactamases in that it was found in five clonal
P. aeruginosa isolates within a class 1 integron on a plasmid. At
this time, it has not been reported elsewhere in the world.
The latest family of acquired metallo-␤-lactamases to be
described comes from Korea. The enzyme SIM-1 (for “Seoul
imipenemase”) has the closest amino acid identity to the IMP
family (64 to 69%). SIM-1 was discovered in a large-scale
screen of 1,234 imipenem-resistant Pseudomonas sp. and
Acinetobacter sp. isolates, of which 211 (17%) were positive for
metallo-␤-lactamases. In this screening study, mostly VIM
(74%) and IMP (22%) alleles were identified; however, seven
putative metallo-␤-lactamase-producing A. baumannii isolates
were negative by PCR testing. Investigation with PCR primers
designed to amplify entire integrons revealed that they had the
novel SIM-1 metallo-␤-lactamase located within a class 1 integron (104). Two clonal groups, of four and three strains,
carried the same integron, suggesting independent acquisition
events.
Since their initial discoveries, SPM, GIM, and SIM metallo␤-lactamases have not spread beyond their countries of origin.
However, VIM and IMP continue to be detected worldwide,
with an overall trend of these two metallo-␤-lactamases
moving beyond P. aeruginosa and into the Enterobacteriaceae (Table 5).
Recent Epidemiology
Overall, worldwide susceptibility to carbapenems is 98%
among the Enterobacteriaceae, whereas imipenem susceptibility ranges from 60% to 83% for P. aeruginosa and A. baumannii
(2004 to 2005 surveys) (93, 209, 210). The current epidemiology of metallo-␤-lactamase production generally follows patterns of increasing occurrences that are country specific. Presumably this is due to multiple factors, including antibiotic
usage, dosing regimens, and local hospital practices concerning
isolation of patients with multiresistant pathogens. While outside the focus of this review, it should be noted that the loss of
the OprD porin in P. aeruginosa, not the acquisition of carbapenemases, is the most common mechanism associated with
imipenem resistance in this pathogen (113, 176).
In a recent survey from Korea of 15,960 gram-negative clinical isolates (247), metallo-␤-lactamases were found in 36 of
581 imipenem-resistant isolates. In P. aeruginosa, VIM-2-like
enzymes were the majority of metallo-␤-lactamases in this
sample; however, two strains tested positive by PCR for IMP1-like enzymes. For the Acinetobacter species, 26.5% (136 of
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
VOL. 20, 2007
447
TABLE 5. Worldwide emergence of metallo-␤-lactamases in the Enterobacteriaceae
Country
Isolation
datea
Publication
date
Australia
Australia
Australia
2002
2004
NA
2005
Brazil
China
Greece
Greece
Greece
Greece
Greece
Greece
France
Italy
2003
NA
2001
2001
2002
2003
2003–2005
2004–2005
2003–2004
2002
2005
2001
2003
2004
2003
2005
2006
2005
2006
2004
Japan
1993
1995
Japan
1994–1995
1996
Japan
Japan
NA
1991–1996
1998
1998
Japan
Japan
1996
1998–2000
2001
2003
Japan
2001–2002
2003
Portugal
Singapore
South Korea
South Korea
South Korea
NA
1996
2000
2000
2003–2004
2005
1999
2003
2002
2006
Spain
2003
2005
Taiwan
Taiwan
1998
1999–2000
2001
2002
Tunisia
Turkey
2005
Before 2002
2006
2005
Organism
Enzymeb
K. pneumoniae
E. coli
K. pneumoniae
E. cloacae
C. amalonaticus
K. pneumoniae
C. youngae
E. coli
E. coli
K. pneumoniae
E. cloacae
K. pneumoniae
K. pneumoniae
K. pneumoniae
K. pneumoniae
E. cloacae
S. marcescens
IMP-4
IMP-4
IMP-4
IMP-4
IMP-4
IMP-1
IMP-4
VIM-1
VIM-1
VIM-1
VIM-1
VIM-1
VIM-1
VIM-1
VIM-4
VIM-4
IMP-1-like
1
1
2
1
1
1
1
1
4 (clonal)
17
1
5 (clonal)
27 (clonal)
8 (clonal)
1
1
4
Plasmid
Plasmid
Plasmid
Plasmid
Plasmid
Chromosome
Plasmid
Plasmid
Plasmid
Plasmid
Chromosome
Plasmid
Plasmid
Plasmid
Plasmid
Plasmid
Multiple plasmids
K. pneumoniae
S. marcescens
S. flexneri
S. marcescens
C. freundii
S. marcescens
S. marcescens
C. freundii
P. vulgaris
S. marcescens
K. pneumoniae
E. coli
E. cloacae
C. freundii
K. oxytoca
P. rettgeri
M. morganii
E. aerogenes
K. oxytoca
K. pneumoniae
E. cloacae
S. marcescens
K. pneumoniae
E. cloacae
S. marcescens
K. pneumoniae
E. coli
K. pneumoniae
E. cloacae
C. freundii
K. pneumoniae
E. cloacae
IMP-1-like
IMP-1-like
IMP-3
IMP-1-like
IMP-1-like
IMP-6
IMP-1
IMP-1
IMP-1
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
IMP-1-like
VIM-2
IMP-1
VIM-2
VIM-2
VIM-2-like
VIM-2-like
VIM-2-like
VIM-1
VIM-1
IMP-8
IMP-8
VIM-2
VIM-4
VIM-5
1
9
1
13 (some clonal)
1
1
5
1
1
47
23
17
5
3
2
2
1
1
4 (clonal)
1
1
1
2
1
1
1
1
1
36 (mostly clonal)
1
20 (clonal)
1
Not tested
Not tested
Plasmid
Not tested
Not tested
Plasmid
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Not tested
Plasmid
Plasmid
Chromosome
Not tested
Not tested
Not tested
Not tested
Plasmid
Plasmid
Plasmid
Plasmid
Plasmid
Plasmid
Plasmid
No. of isolates
Location
Plasmid type
Not tested
Not tested
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Nonconjugative
Conjugative
Conjugative
Conjugative and
nonconjugative
Not tested
Not tested
Conjugative
Conjugative
Nonconjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Conjugative
Nonconjugative
Integron
type
Reference(s)
1
1
1
1
1
1
?
1
1
1
1
1
1
1
Not tested
Not tested
Not tested
172
172
43
43
43
110
63
136
193
54
48
117
79
91
120
120
80
3
3
1
Not
Not
1
Not
Not
Not
1
1
1
1
1
1
1
1
1
1
Not
1
1
Not
Not
Not
1
1
1
Not
Not
1
1
195
195
81, 152
72
72
244
235
8
8
197
197
197
197
197
197
197
197
197
30
95
87
250
250
250
250
207
207
238
237
237
97
47
tested
tested
tested
tested
tested
tested
tested
tested
tested
tested
tested
a
NA, not available.
b
IMP-1-like and VIM-2-like enzymes were detected by PCR or colony hybridization but were not sequenced.
513) of the imipenem-resistant strains carried metallo-␤-lactamases: 64% were VIM-2-like, 29% were IMP-1-like, and 7%
were SIM-like. Among the Enterobacteriaceae, resistance to
imipenem was 2% for K. pneumoniae and ⬍1% for E. cloacae
and S. marcescens, which tested positive by PCR for VIM-2.
IMP metallo-␤-lactamases continue to persist as the major
metalloenzymes found in Japan, both at a local (148) and a
country-wide (94) level. However, VIM-2-like genes have also
been detected in P. aeruginosa. IMP-1 and IMP-2-like enzymes
were found in Acinetobacter spp., as well as S. marcescens, P.
rettgeri, C. freundii, E. cloacae, and M. morganii. Among almost
20,000 clinical gram-negative isolates from 13 clinical laboratories, the overall rate of metallo-␤-lactamase detection was
0.5% in Japan. In these reports, there was as much as 2.6%
metallo-␤-lactamase detection in imipenem-resistant P. aeruginosa; S. marcescens had the highest rate of IMP gene detection
in Japan, at 3%. In a SENTRY surveillance study conducted in
Japan, 1.1% of the P. aeruginosa strains expressed metallo-␤-
lactamases (88); among these, IMP alleles were the only metallo-␤-lactamases detected.
The first metallo-␤-lactamase reported from China was
IMP-4, which was found on a plasmid in C. youngae and reported in a 2001 publication (63), followed by a report of
IMP-1 in a P. aeruginosa isolate (226). Recently, IMP-9 has
emerged in this country, as reported in a surveillance study that
included 11 hospitals (234). The IMP-9 genes were all on
identical integrons, and only two strains that came from the
same ward were related, based on random amplified polymorphic DNA typing. A very large plasmid (⬃450 kb) was shown
to carry the IMP-9 gene by conjugation experiments, suggesting that the spread of this IMP-containing integron was
through horizontal transfer.
The VIM-2 metallo-␤-lactamase was first reported in China
only in 2006 (227). This single P. aeruginosa isolate occurred in
the same hospital as the IMP-1 isolate (226). At this point, the
route for emergence of these enzymes is unknown, but further
448
QUEENAN AND BUSH
epidemiological analysis, sequencing of the integrons, and typing of the strains could answer questions about whether the
strains imported or acquired metallo-␤-lactamases independently.
In Taiwan, IMP-1 was reported in two A. baumannii isolates
that were unrelated by PFGE. In these isolates, the IMP-1
gene was on two different plasmids within class 1 integrons
(111). VIM-2 and VIM-3 have also been detected within integrons in multidrug-resistant P. aeruginosa (236).
In southern Europe, particularly in Italy, there has been
almost continuous detection of VIM and IMP metallo-␤-lactamases throughout many countries over the past decade. In
Italy, a recent SENTRY study for the years 2001 and 2002
found that 25 of 383 (6.5%) P. aeruginosa isolates from three
medical centers carried metallo-␤-lactamases (88). The majority of metallo-␤-lactamases identified were VIM-1, but IMP-13
was also detected. Some of the VIM-1-expressing isolates from
Rome and Catania carried the integron described in the original VIM-1 from Verona; differences in ribotypes demonstrated the mobility of this integron. Several unique integron
cassette arrangements were reported, including some strains
possessing as many as four integrons, thus leaving open the
possibility for more integron gene rearrangements (100). In
another study reported by Pagani et al., IMP-13 was responsible for a large clonal outbreak of at least 86 metallo-␤-lactamase-producing P. aeruginosa strains in southern Italy (154).
The integron, which was the same as the IMP-13 found in the
SENTRY study, was localized to the chromosome and not
transferable to P. aeruginosa or Escherichia coli by conjugation.
Another surveillance study of 506 P. aeruginosa isolates from a
single center in Varese showed 82% IPM susceptibility, but
with only four strains carrying metallo-␤-lactamases, (VIM-1
and VIM-2), demonstrating the regional variation in resistance
patterns due to these enzymes (121).
More frequent reports of metallo-␤-lactamases are now being published from other European countries, documenting
further detections of acquired carbapenem resistance. P.
aeruginosa isolates with integron-associated VIM alleles have
been reported in Germany (66), Turkey (10), Croatia (190),
Hungary (107, 108), and Poland (45).
Metallo-␤-lactamase outbreaks in South America are dominated by the SPM and VIM families. In a recent SENTRY
study of 183 P. aeruginosa isolates, 44.8% were imipenem resistant; of these, 36 isolates were positive for metallo-␤-lactamases. The majority of the isolates were positive for SPM-1like genes by PCR, (55.6%), followed by VIM-2-type (30.6%)
and IMP-1-like genes in three isolates (8.3%) (88, 187). While
SPM-1 has been confined to Brazil, other countries in South
America that have reported metallo-␤-lactamases are Argentina, Chile, and Venezuela (88), as well as Colombia, where
both VIM-2 and VIM-8 were found in P. aeruginosa (36, 217).
Emergence of metallo-␤-lactamase-mediated carbapenem
resistance has spread to the United States and Canada, with
reports of both VIM and IMP metallo-␤-lactamases in P.
aeruginosa. VIM-7 was isolated in Texas in 2001 from a single
strain that carried the integron on a conjugative plasmid (204).
More recently, VIM-2 has also been detected in Texas (1).
VIM-2 was also found in Chicago, IL, in an outbreak setting of
clonal P. aeruginosa involving 17 patients admitted from 2002
to 2004 (115), where the metallo-␤-lactamase was present on
CLIN. MICROBIOL. REV.
an integron. Metallo-␤-lactamases have also emerged as outbreaks of VIM-2- and IMP-7-producing P. aeruginosa in Canada (55, 163) and in a single P. aeruginosa isolate from the
southwestern United States that produced IMP-18 (62).
Australia has also reported detection of metallo-␤-lactamases. The first metalloenzyme that emerged on the Australian
continent was IMP-4, reported in 2004 in a single P. aeruginosa
clinical isolate (159) and in single K. pneumoniae and E. coli
isolates (172), followed by an outbreak of IMP-4-producing
gram-negative pathogens (158). Recently, an Aeromonas junii
isolate from Australia was found to have two carbapenemases:
a class D OXA-58 and an IMP-4 metallo-␤-lactamase (160).
Other areas of the world that have recently reported metallo␤-lactamases include the Middle East, where VIM-2 was the
first reported metallo-␤-lactamase. It was detected by PCR in
an imipenem-resistant P. aeruginosa isolate from Saudi Arabia
(58). Yong et al. recently reported the detection of metallo-␤lactamases from India by using an EDTA disk test (248), where
13 of 200 (7.5%) Pseudomonas sp. and Acinetobacter sp. isolates were positive for the production of metallo-␤-lactamases.
Although further analysis of these enzymes is not yet available,
awareness and early detection may prevent uncontrolled outbreaks due to these pathogens (59).
CLASS D SERINE-CARBAPENEMASES: THE
OXA ␤-LACTAMASES
OXA (for “oxacillin-hydrolyzing”) ␤-lactamases represented
one of the most prevalent plasmid-encoded ␤-lactamase families in the late 1970s and early 1980s (129, 132, 198). When the
molecular class D OXA ␤-lactamases were placed in a separate
molecular class from the other serine ␤-lactamases (76), they
had been identified mainly in the Enterobacteriaceae and P.
aeruginosa (23, 144) and were functionally described as penicillinases capable of hydrolyzing oxacillin and cloxacillin (21).
They were in general poorly inhibited by clavulanic acid and
EDTA and known to have a large amount of variability in
amino acid sequences (22). OXA-11, the first extended-spectrum variant of OXA-10 (previously known as PSE-2), was
described in 1993 (61). The extended-spectrum variants OXA11, OXA-15, OXA-18, and OXA-45 had hydrolysis rates for
ceftazidime that varied from 1% to 1,150% relative to the
hydrolysis rate of penicillin, but imipenem hydrolysis was not
detected (38, 61, 162, 205). Currently there have been 102
unique OXA sequences identified (http://www.lahey.org
/Studies/), of which 9 are extended spectrum ␤-lactamases and
at least 37 are considered to be carbapenemases (Table 6)
(225).
The first OXA ␤-lactamase with carbapenemase activity was
described by Paton et al. in 1993. The enzyme was purified
from a multidrug-resistant A. baumannii strain that was isolated in 1985 from a patient in Edinburgh, Scotland (157).
Biochemical characterization revealed a ␤-lactamase with a pI
value of 6.65 that was poorly inhibited by clavulanic acid and
EDTA (Table 4). Imipenem hydrolysis could not be measured
spectrophotometrically but was readily detected with a microbiological assay plate. The enzyme was designated ARI-1 (for
“Acinetobacter resistant to imipenem”) and was later demonstrated to reside on a large plasmid (191). Sequencing of the
ARI-1 enzyme revealed that it belonged to the OXA class D
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
VOL. 20, 2007
TABLE 6. Carbapenemase subgroups of the OXA family
of ␤-lactamases
Cluster
1
Enzyme
subfamily
2
OXA-23
(ARI-1)
OXA-24
3
OXA-51
4
5
6
7
8
9
OXA-58
OXA-55
OXA-48
OXA-50
OXA-60
OXA-62
Additional OXA member(s)
Reference
OXA-27, OXA-49
225
OXA-25, OXA-26, OXA-40,
OXA-72
OXA-64 to OXA-71, OXA-75 to
OXA-78, OXA-83, OXA-84,
OXA-86 to OXA-89, OXA-91,
OXA-92, OXA-94, OXA-95
None
OXA-SHE
OXA-54, OXA-SAR2
OXA-50a to OXA-50d, PoxB
OXA-60a to OXA-60d
None
225
213, 225
225
225
225
225
225
192
family of ␤-lactamases, and the enzyme was later renamed
OXA-23 (41). OXA-23 represented a new subset of the OXA
family, with the highest amino acid identity to OXA-5 and
OXA-10 at 36%. A recent review of the OXA ␤-lactamases
includes many additional details of these enzymes (225).
The vast majority of OXA carbapenemases have been discovered in the opportunistic gram-negative pathogen Acinetobacter baumannii. By 1998, carbapenem-hydrolyzing ␤-lactamases had been identified in Acinetobacter species clinical
isolates throughout the world (2). For example, OXA-23 has
been identified in outbreaks of carbapenem-resistant Acinetobacter in Brazil, the United Kingdom, Korea, and Tahiti (37,
85, 142, 211). OXA-24 and OXA-40, which differ by two amino
acids, were found in clonal Acinetobacter outbreaks in hospitals
from Spain and Portugal (12, 40, 119). OXA-40 was also the
first carbapenem-hydrolyzing oxacillinase reported in the
United States (116). Acinetobacter strains with OXA-23 and
OXA-58 carbapenemases caused multiple infections in military and civilian personnel serving in Iraq and Afghanistan
from 2003 to 2005 (75).
At the latest count, there are nine major subgroups of OXA
carbapenemases, based on amino acid homologies, as summarized in Table 6 (18, 167, 225). Subgroups 1, 2, and 3 are based
on the sequences of OXA-23, OXA-24, and OXA-51, respectively (213). OXA-51-like enzymes have been found in all A.
baumannii strains tested and may be a natural component of
the chromosome in a subpopulation of that species (69). OXA58, less that 50% identical to other members of the OXA
family, stands alone in subgroup 4 and has been found in
Acinetobacter spp. from France, Greece, Italy, Romania, Turkey, Argentina, and Kuwait (28, 68, 125, 170, 215). OXA-55
and OXA-SHE, both from Shewanella algae, form the fifth
group (71). The OXA-48 enzyme forms the sixth subgroup,
along with OXA-54 and additional oxacillinases found in the
environmental bacteria Shewanella spp. (165–167). In contrast
to the sharp increase in worldwide reports of OXA-expressing
Acinetobacter strains, OXA-48 was discovered in a clinical K.
pneumoniae isolate from Turkey (167). This OXA variant was
plasmid encoded and had less than 50% amino acid identity to
the other OXA members. This enzyme also had the highest
reported imipenem kcat value, 2 s⫺1, which represents the
449
highest hydrolysis rate of all of the published kinetic parameters for the OXA enzymes.
The OXA-50-like enzymes in P. aeruginosa form the seventh
group and include a set of enzymes that have been referred to
as the poxB enzymes. These PoxB oxacillinases have been
reported to be commonly present on the chromosomes of
many strains of P. aeruginosa (40 of 70 strains tested) (96) and
are thought to be part of the natural component of ␤-lactamases in that species, but they may not be expressed in all strains
and do not cause carbapenem resistance (imipenem MIC, ⱕ1
␮g/ml) (56, 96). Species-specific OXA enzymes include the
subgroup 8 OXA-60 family, considered to be a natural component of the genome of Ralstonia pickettii (57), and the subgroup 9 OXA-62, identified as a species-specific oxacillinase in
Pandoraea pnomenusa (192).
The OXA ␤-lactamases display a wide variety of amino acid
sequences. Among those with carbapenem-hydrolyzing activity, there is 40% to 70% amino acid identity between groups.
Within a group the identity is greater than or equal to 92.5%
(225). If OXA ␤-lactamases without carbapenem-hydrolyzing
activity are considered, amino acid identities can be as low as
18%, for example, when OXA-1 is compared with OXA-58
(170).
The molecular structures of the OXA ␤-lactamases have
been analyzed with the DBL numbering system (35), a classification based on the similarity of motifs around the active sites
of the class A enzymes (6). The catalytic serine residue lies in
the S-T-F-K tetrad at positions 70 to 73 (102), where the serine
and lysine are conserved in both class A and class D enzymes,
as well as in penicillin-binding proteins. The Y-G-N motif at
positions 144 to 146 and the K-T-G at DBL 216 to 218 are
highly conserved among the serine-based ␤-lactamases. The
carbapenem-hydrolyzing OXA subgroups 1 and 2 share a substitution of F for Y in the Y-G-N motif, but this is not necessary for imipenem hydrolysis, as the subgroup 3 enzymes and
OXA-58 retain the Y-G-N at this position.
The first crystal structure of the class D carbapenemases
to appear in the literature was that of OXA-24, which was
compared to the noncarbapenemase OXA-10 (189). Two
amino acids, Tyr-112 and Met-223, make access to the active
site smaller and more hydrophobic, allowing favorable interactions with carbapenems. These residues are found in
other subgroups of OXA carbapenemases, suggesting that
the altered active-site access is an important contributing
factor to the carbapenem-hydrolyzing activity among these
enzymes.
The catalytic mechanism of the OXA ␤-lactamases shares
features with other serine carbapenemases. Substrate and enzyme form a covalent acyl intermediate at the catalytic serine,
which is subsequently deacylated to yield the inactivated antibiotic hydrolyzed at the C-N bond of the ␤-lactam ring. In
addition, CO2 may influence the kinetics of some OXA enzymes, due to carboxylation at lysine 70 (Lys 73 in the DBL
scheme) in these class D enzymes. This carbamate activates the
catalytic serine side chain so that the acyl intermediate can
form (131, 153). To ensure that this modification occurs in
studies with isolated enzymes, some researchers add 10 mM
NaHCO3 to their reactions (57, 69, 192).
OXA enzymes are difficult to purify due to low yield (3) and
difficult to characterize biochemically due to low hydrolysis
450
QUEENAN AND BUSH
rates and biphasic kinetics for some substrates. The OXA
carbapenemases that have been characterized biochemically
have measurable hydrolytic activity against the penicillins,
some cephalosporins, and imipenem (225). In general, imipenem hydrolysis, which is faster than meropenem hydrolysis,
is slow, with the highest kcat values for the group 6 OXA-54
and OXA-48 enzymes at 1 s⫺1 and 2 s⫺1, respectively. The Km
values for imipenem are also low, ranging from 2 to 20 ␮M,
indicating that the OXA enzymes have very high affinity for
these substrates. In contrast, extended-spectrum cephalosporins are not measurably hydrolyzed by the OXA carbapenemases or are hydrolyzed very poorly (225).
The hydrolysis of carbapenems by the class D oxacillinase
family is weak, but Heritier et al. (70) demonstrated that plasmid-encoded OXA-23 and OXA-58 enzymes contributed to
carbapenem resistance in A. baumannii after transformation of
the OXA plasmids into carbapenem-susceptible A. baumannii
strains. In addition, when a chromosomally located OXA-40
gene was inactivated, susceptibility to carbapenems was observed. Efflux by an overexpressed AdeABC pump was also
shown to contribute to carbapenem resistance.
DETECTION OF CARBAPENEMASES
MICs
Detection of carbapenemase activity in a clinical isolate can
be challenging for a clinical microbiology laboratory. The first
cause for suspicion that a carbapenemase is involved in a
clinical infection is an elevated carbapenem MIC. Among P.
aeruginosa strains with VIM, IMP, GIM, SIM, and SPM metallo-␤-lactamases, imipenem MICs have been reported in the
range of 8 to ⬎128 ␮g/ml (26, 101, 104, 126, 171, 204, 228).
However, when the genes for these enzymes were transferred
into E. coli, the observed imipenem MIC was usually much
lower, sometimes as low as 0.5 ␮g/ml. This demonstrates the
presence of other mechanisms contributing to the carbapenem
resistance in P. aeruginosa, such as intrinsic impermeability,
possibly coupled with an efflux mechanism. This effect of lowlevel transferable resistance has also been observed in K. pneumoniae and A. baumannii with metallo-␤-lactamases (39, 184),
as well as with OXA carbapenemases (12, 170, 192). Many
OXA carbapenemases have been found in A. baumannii,
where MICs for imipenem are usually higher than 8 ␮g/ml, but
E. coli cells expressing these enzymes have imipenem MICs of
ⱕ2 ␮g/ml (225).
Elevated carbapenem MICs are generally predictive of carbapenemase production in the Enterobacteriaceae, but full clinical resistance is not always seen. In a set of 19 K. pneumoniae
isolates with imipenem MICs in the susceptible range of 1 to 4
␮g/ml, a metallo-␤-lactamase was suggested on the basis of
disk testing with imipenem in the presence and absence of
EDTA and was then confirmed by PCR as VIM-1 (161). A
collection of five related K. pneumoniae strains with the VIM-1
gene demonstrated imipenem MICs ranging from 2 to 64
␮g/ml (susceptible to high-level resistance) (117). Decreased
permeability due to the absence of the outer membrane porin
OmpK36 was a contributing factor in the most resistant isolate,
with an imipenem MIC of 64 ␮g/ml.
The KPC serine carbapenemases also have been reported to
CLIN. MICROBIOL. REV.
be difficult to detect (14, 16, 138). They are often associated
with imipenem MICs as low as 2 ␮g/ml (138), and a low
inoculum has resulted in susceptible MICs by broth microdilution (15). To document inconsistencies in the detection of
KPC-producing K. pneumoniae according to the testing
method, Tenover et al. tested 15 characterized imipenem- and
meropenem-nonsusceptible KPC-producing isolates for imipenem and meropenem resistance using CLSI broth microdilution, Etest, MicroScan WalkAway, BD Phoenix Sensititre
Autoreader, VITEK, and VITEK2. The automated systems
reported carbapenem susceptibility in this collection of isolates
ranging from 6.7% to 87%, depending on the system used
(203). Day-to-day variation was also noted. In addition to the
variable results with the automated systems, Etest results were
inconsistent due to colonies present in the zones of inhibition.
The failure of automated systems to consistently detect
KPC-producing isolates indicates the need for improved methodology. One possibility is to screen isolates for resistance to
ertapenem, which had the highest sensitivity for detecting
KPC-expressing isolates (16). However, the specificity may be
reduced due to resistance from other mechanisms, such as
AmpC or ESBL production coupled with porin loss (N. Woodford, J. Dallow, R. Hill, M. F. Ralepou, R. Pike, M. Ward, M.
Warner, and D. Livermore, presented at the 46th Interscience
Conference on Antimicrobial Agents and Chemotherapy, San
Francisco, CA, 27 to 30 September 2006).
The NMC and IMI serine carbapenemases in E. cloacae are
associated with imipenem MICs of 16 to 32 ␮g/ml, with ceftazidime MICs often 2 ␮g/ml (149, 183). In S. marcescens, the
SME family of ␤-lactamases should be suspected if an isolate
displays this pattern of high-level imipenem resistance associated with ceftazidime susceptibility.
Microbiological Tests with Inhibitors
The disk approximation test with EDTA or 2-mercaptoproionic acid is often used as a screen for metallo-␤-lactamase
producers (8, 248). In this test, the zone of inhibition around a
␤-lactam disk is altered by the action of the inhibitor on the
metallo-␤-lactamase in the test organism. Imipenem, ceftazidime, and cefepime have been used for this test. The sensitivity
with the imipenem-EDTA disk method was 100% for Pseudomonas spp. and 95.7% for Acinetobacter spp. (248). In one
study that compared different combinations of antibiotics and
inhibitors, imipenem-EDTA combinations were the most sensitive for the detection of metallo-␤-lactamase-producing
Pseudomonas and A. baumannii, while ceftazidime-clavulanate
with EDTA was the most accurate for K. pneumoniae and
cefepime-clavulanate with EDTA was the most accurate for E.
cloacae and C. freundii, with an overall sensitivity for this
method of 86.7% (239).
Etest strips for metallo-␤-lactamase testing are also available as imipenem and imipenem-EDTA combinations (AB
BIODISK, Solna, Sweden). A positive test for a metallo-␤lactamase is interpreted as a threefold-or-greater decrease in
the imipenem MIC in the presence of EDTA. This test strip
produced a sensitivity of 94% and a specificity of 95% when
examined with a set of 138 characterized metallo-␤-lactamase
producers (222). However, false-negative results have been
reported for the Etest when an isolate had an imipenem MIC
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
VOL. 20, 2007
451
TABLE 7. PCR primers for the detection of ␤-lactamasesa
Enzyme family
Class A carbapenemases
NMC
SME
IMI
KPC
GES
Class D oxacillinases
Subgroup 1 (OXA-23)
Subgroup 2 (OXA-24)
Subgroup 3 (OXA-69)
Subgroup 4 (OXA-58)
Subgroup 5 (Shewanella
OXA-55)
Subgroup 6 (OXA-48)
Subgroup 7 (OXA-50)
Subgroup 8 (OXA-60)
Multiplex PCR for OXAs in
A. baumannii
Primer sequence (5⬘–3⬘)
NMC1*
NMC4
IRS-5
IRS-6
IMI-A
IMI-B
KPC forward
KPC reverse
GES-C
GES-D
GCATTGATATACCTTTAGCAGAGA
CGGTGATAAAATCACACTGAGCATA
AGATAGTAAATTTTATAG
CTCTAACGCTAATAG
ATAGCCATCCTTGTTTAGCTC
TCTGCGATTACTTTATCCTC
ATGTCACTGTATCGCCGTCT
TTTTCAGAGCCTTACTGCCC
GTTTTGCAATGTGCTCAACG
TGCCATAGCAATAGGCGTAG
Z21956
P5
P6
Forward
Reverse
OXA-69A
AAGCATGATGAGCGCAAAG
AAAAGGCCCATTTATCTCAAA
GTACTAATCAAAGTTGTGAA
TTCCCCTAACATGAATTTGT
CTAATAATTGATCTACTCAAG
AJ132105
OXA-69B
Pre-OXA58prom⫹
PreOXA-58B
OXA-55/1
CCAGTGGATGGATGGATAGATTATC
TTATCAAAATCCAATCGGC
OXA-55/2
OXA-48A
OXA-48B
S
AS
OXA-60 A
OXA-60 B
AGCTGTTCCTGCTTGAGCAC
TTGGTGGCATCGATTATCGG
GAGCACTTCTTTTGTGATGGC
AATCCGGCGCTCATCCATC
GGTCGGCGACTGAGGCGG
AAAGGAGTTGTCTCATGCTGTCTCG
AACCTACAGGCGCGCGTCTCAC
GGTG
OXA-51-like
TAATGCTTTGATCGGCCTTG
OXA-23-like
OXA-24-like
OXA-58-like
Class B metalloenzymes
IMP-1
IMP-2
VIM-1
VIM-2
SPM-1
GIM-1
SIM-1
Integron PCR
GenBank
accession
no.
Primerb
Z28968
U50278
Fragment
size (bp)
Entire
coding
regionc
Reference
68–191
2225–2201
5–22
1142–1128
1291–1310
2108–2089
131–150
1023–1004
176–195
527–546
2,158
Yes
181
1,138
Yes
179
No
9
785–803
1850–1830
Nucleotide positions
(in GenBank)
818
893
Yes*
13
371
No
230
1,066
Yes
41
AY859527
1023
Primers external to
GenBank sequence
975
Yes
Yes
69
AY570763
72–90
934
Yes
68
Yes
71
744
No
167
869
Yes
56
AF297554
AF326355
3
TAACCTCAAACTTCTAATTC
CATCTACCTTTAAAATTCCC
AY343493
AY236073
1005–986
Primers external to
GenBank sequence
969–917
2218–2237
2961–2941
AE004091
AF525303
2757–2782
3605–3579
353
TGGATTGCACTTCATCTTGG
GATCGGATTGGAGAACCAGA
ATTTCTGACCGCATTTCCAT
GGTTAGTTGGCCCCCTTAAA
AGTTGAGCGAAAAGGGGATT
AAGTATTGGGGCTTGTGCTG
CCCCTCTGCGCTCTACATAC
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
SPM-1F
SPM-1R
GIM-1F
GIM-1R
SIM1-F
SIM1-R
TGAGCAAGTTATCTGTATTC
TTAGTTGCTTGGTTTTGATG
GGCAGTCGCCCTAAAACAAA
TAGTTACTTGGCTGTGATGG
TTATGGAGCAGCAACCGATGT
CAAAAGTCCCGCTCCAACGA
AAAGTTATGCCGCACTCACC
TGCAACTTCATGTTATGCCG
CCTACAATCTAACGGCGACC
TCGCCGTGTCCAGGTATAAC
AGAACCTTGACCGAACGCAG
ACTCATGACTCCTCACGAGG
TACAAGGGATTCGGCATCG
TAATGGCCTGTTCCCATGTG
5⬘ CS
3⬘ CS
GGCATCCAAGCAGCAAG
AAGCAGACTTGACCTGA
57
Yes
232
501
246
599
AJ492820
AJ620678
AY887066
M73819
514–533
1163–1143
837–856
1584–1565
620–638
1190–1171
1190–1206
740
Yes*
240
737
Yes
240
920
Yes
240
865
Yes
240
650
No
26
748
No
26
571
No
104
Variable
106
Some primers are outside the coding regions and amplify the entire ␤-lactamase gene, as indicated; others are internal fragments for diagnostic purposes.
*, NMC primers also amplify NMC-R. Where primers are designated “forward” and “reverse,” they were not given names in the referenced study.
“Yes” indicates that entire coding region is amplified; “No” indicates that only a part of the coding region is amplified. *, primers cover the extreme ends of the
protein.
a
b
c
of ⬍4 ␮g/ml (222, 239). It has also been observed that EDTA
alone has inhibitory action against some bacteria due to permeabilization of the outer membrane and can lead to falsepositive results (27). Etest metallo-␤-lactamase detection tests
have also yielded false-positive results with OXA-23-producing
A. baumannii (194).
Carbapenem inactivation assays can be a fast, sensitive
method for initial characterization of carbapenem-resistant
isolates. The cloverleaf test is a microbiological assay of carbapenemase activity where suspensions of whole cells or
and/or an extract of the suspect isolate are tested against imipenem on an agar plate (73). Altered growth of an indicator
strain around an imipenem disk is a positive result. One advantage of this test is that enzymes that have very weak car-
452
QUEENAN AND BUSH
bapenemase activity, such as OXA-23 (73) or GES-5 and
GES-6 (218), can be detected by this method.
Biochemical and Molecular Tests
Isoelectric focusing (IEF) separates proteins by charge, and
detection of ␤-lactamases is accomplished with the chromogenic cephalosporin nitrocefin (130). Overlay of the gel with
EDTA, clavulanic acid, or aztreonam can detect sensitivity of
the enzymes to these potential inhibitors, indicating class B, A,
or C ␤-lactamases, respectively. Although IEF results cannot
identify a specific ␤-lactamase, information about isoelectric
point and inhibition characteristics can be obtained by this
method. IEF is especially valuable for the detection of multiple
␤-lactamases present in an isolate.
IEF can also be combined with a bioassay to detect the
presence of carbapenemases by using an overlay of agar with
imipenem and a second overlay with a susceptible indicator
organism (103, 192, 241). Growth over an enzyme band indicates a potential carbapenemase. This procedure is especially
useful when working with carbapenemases that have poor hydrolysis rates with nitrocefin, such as the metallo-␤-lactamases
from Aeromonas spp. (241).
Imipenem hydrolysis can most reliably be detected with a
spectrophotometric measurement using crude cell extracts or
purified ␤-lactamases (101). If the carbapenemase is a metalloenzyme, a brief incubation with EDTA prior to initiation of
the reaction will result in a lower hydrolysis rate. Very weak
carbapenemases cannot be detected by this method unless
large amounts of extracts are used.
When the presence of a carbapenemase is suspected, PCR is
the fastest way to determine which family of ␤-lactamase is
present. Table 7 lists a selection of published primers that have
been used with standard PCR technology to detect all of the
families and subgroups of carbapenemases known at this time.
Some laboratories have used colony blot hybridizations to
efficiently screen large numbers of clinical isolates for carbapenemase genes (121, 240). Hybridization techniques are
also used with a Southern blot to determine whether the
carbapenemase gene resides on a plasmid or is chromosomal (116).
Ultimately, the identification of the ␤-lactamase gene requires sequencing of the entire coding region. Cloning of the
region around the ␤-lactamase is usually accomplished with a
“shotgun” approach, but a clever degenerate PCR method has
also been used successfully to amplify 5⬘ and 3⬘ areas surrounding OXA-51 (19). Characterization of a new ␤-lactamase is not
complete until both a molecular sequence is obtained and a
functional analysis of the hydrolysis and inhibition profiles is
performed with purified protein.
CLIN. MICROBIOL. REV.
capable of degrading these ␤-lactams would be produced by
environmental organisms such as Bacillus cereus and Bacillus
anthracis, bacteria with well-characterized metallo-␤-lactamases that would provide a selective advantage for growth of
these environmental species (98, 128). These chromosomal
carbapenemases may have evolved initially as a mechanism for
bacteria to protect themselves from external threats to their
cell wall (20), but in addition these ␤-lactamases may also play
a role in the regulation of cell wall synthesis (151). As described in this review and its many supporting references, the
problem of carbapenemase-mediated resistance intensified
once genes for these enzymes became associated with acquired
genetic determinants. Transmission of carbapenemase genes
may occur readily when the gene is located within mobile
elements such as plasmids and integrons (82, 133).
Investigators looking for prospective sources of carbapenemase genes have been able to find several in environmental
species. The class A carbapenemase SFC-1 was described in an
environmental isolate of Serratia fonticola (67). Several of the
OXA carbapenemase genes such as OXA-50 and its variants in
P. aeruginosa (56, 96), OXA-51-like enzymes in A. baumannii
(69, 213), OXA-62 in Pandoraea pnomenusa (192), and
OXA-54 and OXA-55 in Shewanella spp. (71, 165) appear to
be natural components of their respective bacterial chromosomes. In the case of the OXA genes in A. baumannii, insertion
sequences of the ISAba1 type, carrying strong promoters, have
been detected upstream of the chromosomal oxacillinase, resulting in increased expression and concomitant carbapenemase resistance (212). Transmission of carbapenemase genes
is accelerated when the gene is located within mobile elements
such as plasmids and integrons.
In addition to the finding of novel carbapenemases in environmental isolates, enzymes first detected in the clinic are now
being found in environmental bacteria. The VIM-2 carbapenemase was found in a Pseudomonas pseudoalcaligenes strain
from a hospital wastewater system (180); further examination
found two P. aeruginosa strains with this gene. In another
interesting study, bacteriophages carrying ␤-lactamase genes
for OXA-type ␤-lactamases were isolated from sewage, suggesting another vector for transfer of these genes between
organisms (140).
While it is not hard to imagine carbapenemase-producing
strains finding their way into the sewage system, the discovery
of IMI-2 carbapenemases on plasmids in rare E. asburiae isolates from U.S. rivers is harder to explain, although the location of sampling in relation to population centers was not
reported (9). It is likely that the circulation of carbapenemase
genes proceeds in two directions: environmental sources may
provide genetic material as a source of these enzymes, and
clinical strains may disperse this information both within the
hospital setting and into the surrounding environment.
CARBAPENEMASE ORIGINS AND TRANSMISSION
Carbapenem antibiotic design was inspired by the natural
product thienamycin, produced by the soil organism Streptomyces cattleya (89). In fact, carbapenems and olivanic acids
were some of the most potent naturally occurring ␤-lactams to
be identified from diverse sources in early natural product
screening programs (24). Because of the prevalence of these
molecules in the soil, it is only logical to expect that enzymes
CONCLUDING REMARKS
Carbapenemase-producing pathogens cause infections that
are difficult to treat and have high mortality rates, due to their
appearance in multidrug-resistant pathogens such as K. pneumoniae, P. aeruginosa, and Acinetobacter spp. (15, 29, 126). The
first descriptions of these enzymes as species-specific chromosomal carbapenemases have more recently been followed by
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
VOL. 20, 2007
the appearance of carbapenemase genes that are easily transferred on mobile elements among species. While considered by
some to be relatively rare, reports of their occurrence in outbreak settings have steadily increased. Awareness of their entry
into a hospital environment is the first step that clinical microbiologists can take to address this problem. Care in detection
is needed, because high carbapenem MICs are not always
evident. Evaluation of effective antibiotic options and rigorous
infection control measures will help in the fight against carbapenemase-producing organisms.
REFERENCES
1. Aboufaycal, H., H. S. Sader, K. Rolston, L. M. Deshpande, M. Toleman, G.
Bodey, I. Raad, and R. N. Jones. 2007. blaVIM-2 and blaVIM-7 carbapenemase-producing Pseudomonas aeruginosa isolates detected in a tertiary
care medical center in the United States: report from the MYSTIC program. J. Clin. Microbiol. 45:614–615.
2. Afzal-Shah, M., and D. M. Livermore. 1998. Worldwide emergence of
carbapenem-resistant Acinetobacter spp. J. Antimicrob. Chemother. 41:
576–577.
3. Afzal-Shah, M., N. Woodford, and D. M. Livermore. 2001. Characterization
of OXA-25, OXA-26, and OXA-27, molecular class D ␤-lactamases associated with carbapenem resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 45:583–588.
4. Alba, J., Y. Ishii, K. Thomson, S. Moland Ellen, and K. Yamaguchi. 2005.
Kinetics study of KPC-3, a plasmid-encoded class A carbapenem-hydrolyzing ␤-lactamase. Antimicrob. Agents Chemother. 49:4760–4762.
5. Ambler, R. P. 1980. The structure of ␤-lactamases. Philos. Trans. R. Soc.
Lond. B 289:321–331.
6. Ambler, R. P., A. F. W. Coulson, J. M. Frere, J. M. Ghuysen, B. Joris, M.
Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard
numbering scheme for the class A ␤-lactamases. Biochem. J. 276:269–270.
7. Arakawa, Y., M. Murakami, K. Suzuki, H. Ito, R. Wacharotayankun, S.
Ohsuka, N. Kato, and M. Ohta. 1995. A novel integron-like element carrying
the metallo-␤-lactamase gene blaIMP. Antimicrob. Agents Chemother.
39:1612–1615.
8. Arakawa, Y., N. Shibata, K. Shibayama, H. Kurokawa, T. Yagi, H. Fujiwara,
and M. Goto. 2000. Convenient test for screening metallo-␤-lactamase-producing gram-negative bacteria by using thiol compounds. J. Clin. Microbiol. 38:
40–43.
9. Aubron, C., L. Poirel, J. Ash Ronald, and P. Nordmann. 2005. Carbapenemase-producing Enterobacteriaceae, U.S. rivers. Emerg. Infect. Dis. 11:
260–264.
10. Bahar, G., A. Mazzariol, R. Koncan, A. Mert, R. Fontana, G. M. Rossolini,
and G. Cornaglia. 2004. Detection of VIM-5 metallo-␤-lactamase in a
Pseudomonas aeruginosa clinical isolate from Turkey. J. Antimicrob. Chemother. 54:282–283.
11. Bandoh, K., K. Watanabe, Y. Muto, Y. Tanaka, N. Kato, and K. Ueno. 1992.
Conjugal transfer of imipenem resistance in Bacteroides fragilis. J. Antibiot.
(Tokyo) 45:542–547.
12. Bou, G., A. Oliver, and J. Martinez-Beltran. 2000. OXA-24, a novel class D
␤-lactamase with carbapenemase activity in an Acinetobacter baumannii
clinical strain. Antimicrob. Agents Chemother. 44:1556–1561.
13. Bradford, P. A., S. Bratu, C. Urban, M. Visalli, N. Mariano, D. Landman,
J. J. Rahal, S. Brooks, S. Cebular, and J. Quale. 2004. Emergence of
carbapenem-resistant Klebsiella species possessing the class A carbapenemhydrolyzing KPC-2 and inhibitor-resistant TEM-30 ␤-lactamases in New
York City. Clin. Infect. Dis. 39:55–60.
14. Bratu, S., D. Landman, M. Alam, E. Tolentino, and J. Quale. 2005. Detection of KPC carbapenem-hydrolyzing enzymes in Enterobacter spp. from
Brooklyn, New York. Antimicrob. Agents Chemother. 49:776–778.
15. Bratu, S., D. Landman, R. Haag, R. Recco, A. Eramo, M. Alam, and J.
Quale. 2005. Rapid spread of carbapenem-resistant Klebsiella pneumoniae
in New York City: a new threat to our antibiotic armamentarium. Arch.
Intern. Med. 165:1430–1435.
16. Bratu, S., M. Mooty, S. Nichani, D. Landman, C. Gullans, B. Pettinato, U.
Karumudi, P. Tolaney, and J. Quale. 2005. Emergence of KPC-possessing
Klebsiella pneumoniae in Brooklyn, New York: Epidemiology and recommendations for detection. Antimicrob. Agents Chemother. 49:3018–3020.
17. Bratu, S., P. Tolaney, U. Karumudi, J. Quale, M. Mooty, S. Nichani, and D.
Landman. 2005. Carbapenemase-producing Klebsiella pneumoniae in
Brooklyn, N.Y.: molecular epidemiology and in vitro activity of polymyxin
B and other agents. J. Antimicrob. Chemother. 56:128–132.
18. Brown, S., and S. Amyes. 2006. OXA ␤-lactamases in Acinetobacter: the
story so far. J. Antimicrob. Chemother. 57:1–3.
19. Brown, S., H. K. Young, and S. G. B. Amyes. 2005. Characterisation of
OXA-51, a novel class D carbapenemase found in genetically unrelated
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
453
clinical strains of Acinetobacter baumannii from Argentina. Clin. Microbiol.
Infect. 11:15–23.
Bush, K. 1997. The evoution of ␤-lactamases, p. 152–166. In D. J. Chadwick
and J. Goode (ed.), Antibiotic resistance: origins, evolution, selection and
spread, vol. 207. John Wiley & Sons, Chichester, United Kingdom.
Bush, K. 1988. Recent developments in ␤-lactamase research and their
implications for the future. Rev. Infect. Dis. 10:681–690; 739–743.
Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification
scheme for ␤-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211–1233.
Bush, K., and R. B. Sykes. 1987. Characterization and epidemiology of
␤-lactamases. Elsevier Science Publishers BV, Philadelphia, PA.
Butterworth, D., M. Cole, G. Hanscomb, and G. N. Rolinson. 1979. Olivanic
acids, a family of ␤-lactam antibiotics with ␤-lactamase inhibitory properties produced by Streptomyces species. I. Detection, properties and fermentation studies. J. Antibiot. 32:287–294.
Castanheira, M., R. E. Mendes, T. R. Walsh, A. C. Gales, and R. N. Jones.
2004. Emergence of the extended-spectrum ␤-lactamase GES-1 in a
Pseudomonas aeruginosa strain from Brazil: report from the SENTRY
antimicrobial surveillance program. Antimicrob. Agents Chemother. 48:
2344–2345.
Castanheira, M., M. A. Toleman, R. N. Jones, F. J. Schmidt, and T. R.
Walsh. 2004. Molecular characterization of a ␤-lactamase gene, blaGIM-1,
encoding a new subclass of metallo-␤-lactamase. Antimicrob. Agents Chemother. 48:4654–4661.
Chu, Y. W., T. K. M. Cheung, J. Y. W. Ngan, and K. M. Kam. 2005. EDTA
susceptibility leading to false detection of metallo-␤-lactamase in Pseudomonas aeruginosa by Etest and an imipenem-EDTA disk method. Int. J.
Antimicrob. Agents 26:340–341.
Coelho, J., N. Woodford, M. Afzal-Shah, and D. Livermore. 2006. Occurrence of OXA-58-like carbapenemases in Acinetobacter spp. collected over
10 years in three continents. Antimicrob. Agents Chemother. 50:756–758.
Coelho, J. M., J. F. Turton, M. E. Kaufmann, J. Glover, N. Woodford, M.
Warner, M.-F. Palepou, R. Pike, T. L. Pitt, B. C. Patel, and D. M. Livermore. 2006. Occurrence of carbapenem-resistant Acinetobacter baumannii
clones at multiple hospitals in London and southeast England. J. Clin.
Microbiol. 44:3623–3627.
Conceicao, T., A. Brizio, A. Duarte, and R. Barros. 2005. First isolation of
blaVIM-2 in Klebsiella oxytoca clinical isolates from Portugal. Antimicrob.
Agents Chemother. 49:476.
Concha, N. O., C. A. Janson, P. Rowling, S. Pearson, C. A. Cheever, B. P.
Clarke, C. Lewis, M. Galleni, J. M. Frere, D. J. Payne, J. H. Bateson, and
S. S. Abdel-Meguid. 2000. Crystal structure of the IMP-1 metallo ␤-lactamase from Pseudomonas aeruginosa and its complex with a mercaptocarboxylate inhibitor: binding determinants of a potent, broad-spectrum inhibitor. Biochemistry 39:4288–4298.
Concha, N. O., B. A. Rasmussen, K. Bush, and O. Herzberg. 1996. Crystal
structure of the wide-spectrum binuclear zinc ␤-lactamase from Bacteroides
fragilis. Structure 4:823–836.
Correia, M., F. Boavida, F. Grosso, M. J. Salgado, L. M. Lito, J. M.
Cristino, S. Mendo, and A. Duarte. 2003. Molecular characterization of a
new class 3 integron in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 47:2838–2843.
Costello, A. L., N. P. Sharma, K.-W. Yang, M. W. Crowder, and D. L.
Tierney. 2006. X-ray absorption spectroscopy of the zinc-binding sites in the
class B2 metallo-␤-lactamase ImiS from Aeromonas veronii bv. sobria. Biochemistry 45:13650–13658.
Couture, F., J. Lachapelle, and R. C. Levesque. 1992. Phylogeny of LCR-1
and OXA-5 with class A and class D ␤-lactamases. Mol. Microbiol. 6:1693–
1705.
Crespo, M. P., N. Woodford, A. Sinclair, M. E. Kaufmann, J. Turton, J.
Glover, J. D. Velez, C. R. Castaneda, M. Recalde, and D. M. Livermore.
2004. Outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-8, a novel metallo-␤-lactamase, in a tertiary care center in Cali,
Colombia. J. Clin. Microbiol. 42:5094–5101.
Dalla-Costa, L. M., J. M. Coelho, H. A. P. H. M. Souza, M. E. S. Castro,
C. J. N. Stier, K. L. Bragagnolo, A. Rea-Neto, S. R. Penteado-Filho, D. M.
Livermore, and N. Woodford. 2003. Outbreak of carbapenem-resistant
Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil.
J. Clin. Microbiol. 41:3403–3406.
Danel, F., L. M. C. Hall, D. Gur, and D. M. Livermore. 1997. OXA-15, an
extended-spectrum variant of OXA-2 ␤-lactamase, isolated from a Pseudomonas aeruginosa strain. Antimicrob. Agents Chemother. 41:785–790.
Da Silva, G. J., M. Correia, C. Vital, G. Ribeiro, J. C. Sousa, R. Leitao, L.
Peixe, and A. Duarte. 2002. Molecular characterization of blaIMP-5, a new
integron-borne metallo-␤-lactamase gene from an Acinetobacter baumannii
nosocomial isolate in Portugal. FEMS Microbiol. Lett. 215:33–39.
Da Silva, G. J., S. Quinteira, E. Bertolo, J. C. Sousa, L. Gallego, A. Duarte,
and L. Peixe. 2004. Long-term dissemination of an OXA-40 carbapenemase-producing Acinetobacter baumannii clone in the Iberian Peninsula. J.
Antimicrob. Chemother. 54:255–258.
Donald, H. M., W. Scaife, S. G. Amyes, and H. K. Young. 2000. Sequence
454
42.
43.
44.
45.
46.
47.
48.
49.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
analysis of ARI-1, a novel OXA ␤-lactamase, responsible for imipenem
resistance in Acinetobacter baumannii 6B92. Antimicrob. Agents Chemother. 44:196–199.
Duarte, A., F. Boavida, F. Grosso, M. Correia, L. M. Lito, J. M. Cristino,
and M. J. Salgado. 2003. Outbreak of GES-1 ␤-lactamase-producing multidrug-resistant Klebsiella pneumoniae in a university hospital in Lisbon,
Portugal. Antimicrob. Agents Chemother. 47:1481–1482.
Espedido, B., J. Iredell, L. Thomas, and A. Zelynski. 2005. Wide dissemination of a carbapenemase plasmid among gram-negative bacteria: implications of the variable phenotype. J. Clin. Microbiol. 43:4918–4919.
Fabiane, S. M., M. K. Sohi, T. Wan, D. J. Payne, J. H. Bateson, T. Mitchell,
and B. J. Sutton. 1998. Crystal structure of the zinc-dependent ␤-lactamase
from Bacillus cereus at 1.9 Å resolution: binuclear active site with features
of a mononuclear enzyme. Biochemistry 37:12404–12411.
Fiett, J., A. Baraniak, A. Mrowka, M. Fleischer, Z. Drulis-Kawa, L. Naumiuk, A. Samet, W. Hryniewicz, and M. Gniadkowski. 2006. Molecular
epidemiology of acquired-metallo-␤-lactamase-producing bacteria in Poland. Antimicrob. Agents Chemother. 50:880–886.
Frere, J. M., M. Galleni, K. Bush, and O. Dideberg. 2005. Is it necessary to
change the classification of ␤-lactamases? J. Antimicrob. Chemother. 55:
1051–1053.
Gacar, G. G., K. Midilli, F. Kolayli, K. Ergen, S. Gundes, S. Hosoglu, A.
Karadenizli, and H. Vahaboglu. 2005. Genetic and enzymatic properties of
metallo-␤-lactamase VIM-5 from a clinical isolate of Enterobacter cloacae.
Antimicrob. Agents Chemother. 49:4400–4403.
Galani, I., M. Souli, Z. Chryssouli, K. Orlandou, and H. Giamarellou. 2005.
Characterization of a new integron containing blaVIM-1 and aac(6⬘)-IIc in
an Enterobacter cloacae clinical isolate from Greece. J. Antimicrob. Chemother. 55:634–638.
Gales, A. C., D. J. Biedenbach, P. Winokur, D. M. Hacek, M. A. Pfaller, and
R. N. Jones. 2001. Carbapenem-resistant Serratia marcescens isolates producing Bush group 2f ␤-lactamase (SME-1) in the United States: results
from the MYSTIC Programme. Diagn. Microbiol. Infect. Dis. 39:125–127.
Galleni, M., J. Lamotte-Brasseur, G. M. Rossolini, J. Spencer, O. Dideberg,
and J. M. Frere. 2001. Standard numbering scheme for class B ␤-lactamases. Antimicrob. Agents Chemother. 45:660–663.
Garau, G., I. Garcia-Saez, C. Bebrone, C. Anne, P. Mercuri, M. Galleni,
J.-M. Frere, and O. Dideberg. 2004. Update of the standard numbering
scheme for class B ␤-lactamases. Antimicrob. Agents Chemother. 48:2347–
2349.
Garcia-Saez, I., J. Hopkins, C. Papamicael, N. Franceschini, G. Amicosante, G. M. Rossolini, M. Galleni, J.-M. Frere, and O. Dideberg. 2003. The
1.5-Å structure of Chryseobacterium meningosepticum zinc ␤-lactamase in
complex with the inhibitor, D-captopril. J. Biol. Chem. 278:23868–23873.
Giakkoupi, P., L. S. Tzouvelekis, A. Tsakris, V. Loukova, D. Sofianou, and
E. Tzelepi. 2000. IBC-1, a novel integron-associated class A ␤-lactamase
with extended-spectrum properties produced by an Enterobacter cloacae
clinical strain. Antimicrob. Agents Chemother. 44:2247–2253.
Giakkoupi, P., A. Xanthaki, M. Kanelopoulou, A. Vlahaki, V. Miriagou,
S. Kontou, E. Papafraggas, H. Malamou-Lada, L. S. Tzouvelekis, N. J.
Legakis, and A. C. Vatopoulos. 2003. VIM-1 metallo-␤-lactamase-producing Klebsiella pneumoniae strains in Greek hospitals. J. Clin. Microbiol.
41:3893–3896.
Gibb, A. P., C. Tribuddharat, R. A. Moore, T. J. Louie, W. Krulicki, D. M.
Livermore, M.-F. I. Palepou, and N. Woodford. 2002. Nosocomial outbreak
of carbapenem-resistant Pseudomonas aeruginosa with a new blaIMP allele,
blaIMP-7. Antimicrob. Agents Chemother. 46:255–258.
Girlich, D., T. Naas, and P. Nordmann. 2004. Biochemical characterization
of the naturally occurring oxacillinase OXA-50 of Pseudomonas aeruginosa.
Antimicrob. Agents Chemother. 48:2043–2048.
Girlich, D., T. Naas, and P. Nordmann. 2004. OXA-60, a chromosomal,
inducible, and imipenem-hydrolyzing class D ␤-lactamase from Ralstonia
pickettii. Antimicrob. Agents Chemother. 48:4217–4225.
Guerin, F., C. Henegar, G. Spiridon, O. Launay, D. Salmon-Ceron, and C.
Poyart. 2005. Bacterial prostatitis due to Pseudomonas aeruginosa harboring the blaVIM-2 metallo-␤-lactamase gene from Saudi Arabia. J. Antimicrob. Chemother. 56:601–602.
Gupta, V., P. Datta, and J. Chander. 2006. Prevalence of metallo-␤-lactamase (MBL) producing Pseudomonas spp. and Acinetobacter spp. in a
tertiary care hospital in India. J. Infect. 52:311–314.
Hall, B. G., and M. Barlow. 2005. Revised Ambler classification of ␤-lactamases. J. Antimicrob. Chemother. 55:1050–1051.
Hall, L. M. C., D. M. Livermore, D. Gur, M. Akova, and H. E. Akalin. 1993.
OXA-11, an extended-spectrum variant of OXA-10 (PSE-2) ␤-lactamase
from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 37:1637–
1644.
Hanson, N. D., A. Hossain, L. Buck, S. Moland Ellen, and S. Thomson
Kenneth. 2006. First occurrence of a Pseudomonas aeruginosa isolate in the
United States producing an IMP metallo-␤-lactamase, IMP-18. Antimicrob.
Agents Chemother. 50:2272–2273.
Hawkey, P. M., J. Xiong, H. Ye, H. Li, and F. H. M’Zali. 2001. Occurrence
of a new metallo-␤-lactamase IMP-4 carried on a conjugative plasmid in
CLIN. MICROBIOL. REV.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
Citrobacter youngae from the People’s Republic of China. FEMS Microbiol.
Lett. 194:53–57.
Hayes, M. V., C. J. Thomson, and S. G. B. Amyes. 1996. The “hidden”
carbapenemase of Aeromonas hydrophila. J. Antimicrob. Chemother. 37:
33–44.
Hayes, M. V., C. J. Thomson, and S. G. B. Amyes. 1994. Three ␤-lactamases
isolated from Aeromonas salmonicida, including a carbapenemase not detectable by conventional methods. Eur. J. Clin. Microbiol. Infect. Dis.
13:805–811.
Henrichfreise, B., I. Wiegand, K. J. Sherwood, and B. Wiedemann. 2005.
Detection of VIM-2 metallo-␤-lactamase in Pseudomonas aeruginosa from
Germany. Antimicrob. Agents Chemother. 49:1668–1669.
Henriques, I., A. Moura, A. Alves, M. J. Saavedra, and A. Correia. 2004.
Molecular characterization of a carbapenem-hydrolyzing class A ␤-lactamase, SFC-1, from Serratia fonticola UTAD54. Antimicrob. Agents Chemother. 48:2321–2324.
Heritier, C., A. Dubouix, L. Poirel, N. Marty, and P. Nordmann. 2005. A
nosocomial outbreak of Acinetobacter baumannii isolates expressing the
carbapenem-hydrolysing oxacillinase OXA-58. J. Antimicrob. Chemother.
55:115–118.
Heritier, C., L. Poirel, P.-E. Fournier, J.-M. Claverie, D. Raoult, and P.
Nordmann. 2005. Characterization of the naturally occurring oxacillinase of
Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:4174–4179.
Heritier, C., L. Poirel, T. Lambert, and P. Nordmann. 2005. Contribution
of acquired carbapenem-hydrolyzing oxacillinases to carbapenem resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:
3198–3202.
Heritier, C., L. Poirel, and P. Nordmann. 2004. Genetic and biochemical
characterization of a chromosome-encoded carbapenem-hydrolyzing Ambler class D ␤-lactamase from Shewanella algae. Antimicrob. Agents Chemother. 48:1670–1675.
Hirakata, Y., K. Izumikawa, T. Yamaguchi, H. Takemura, H. Tanaka, R.
Yoshida, J. Matsuda, M. Nakano, K. Tomono, S. Maesaki, M. Kaku, Y.
Yamada, S. Kamihira, and S. Kohno. 1998. Rapid detection and evaluation
of clinical characteristics of emerging multiple-drug-resistant gram-negative
rods carrying the metallo-␤-lactamase gene blaIMP. Antimicrob. Agents
Chemother. 42:2006–2011.
Hornstein, M., C. Sautjeau-Rostoker, J. Peduzzi, A. Vessieres, L. T. Hong,
M. Barthelemy, M. Scavizzi, and R. Labia. 1997. Oxacillin-hydrolyzing
␤-lactamase involved in resistance to imipenem in Acinetobacter baumannii.
FEMS Microbiol. Lett. 153:333–339.
Hossain, A., M. J. Ferraro, R. M. Pino, R. B. Dew III, E. S. Moland, T. J.
Lockhart, K. S. Thomson, R. V. Goering, and N. D. Hanson. 2004. Plasmidmediated carbapenem-hydrolyzing enzyme KPC-2 in an Enterobacter sp.
Antimicrob. Agents Chemother. 48:4438–4440.
Hujer, K. M., A. M. Hujer, E. A. Hulten, S. Bajaksouzian, J. M. Adams,
C. J. Donskey, D. J. Ecker, C. Massire, M. W. Eshoo, R. Sampath, J. M.
Thomson, P. N. Rather, D. W. Craft, J. T. Fishbain, A. J. Ewell, M. R.
Jacobs, D. L. Paterson, and R. A. Bonomo. 2006. Analysis of antibiotic
resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center.
Antimicrob. Agents Chemother. 50:4114–4123.
Huovinen, P., S. Huovinen, and G. A. Jacoby. 1988. Sequence of PSE-2
␤-lactamase. Antimicrob. Agents Chemother. 32:134–136.
Hussain, M., A. Carlino, M. J. Madonna, and J. O. Lampen. 1985. Cloning
and sequencing of the metallothioprotein ␤-lactamase II gene of Bacillus
cereus 569/H in Escherichia coli. J. Bacteriol. 164:223–229.
Iaconis, J. P., and C. C. Sanders. 1990. Purification and characterization of
inducible ␤-lactamases in Aeromonas spp. Antimicrob. Agents Chemother.
34:44–51.
Ikonomidis, A., D. Tokatlidou, I. Kristo, D. Sofianou, A. Tsakris, P.
Mantzana, S. Pournaras, and A. N. Maniatis. 2005. Outbreaks in distinct
regions due to a single Klebsiella pneumoniae clone carrying a blaVIM-1
metallo-␤-lactamase gene. J. Clin. Microbiol. 43:5344–5347.
Ito, H., Y. Arakawa, S. Ohsuka, R. Wacharotayankun, N. Kato, and M.
Ohta. 1995. Plasmid-mediated dissemination of the metallo-␤-lactamase
gene blaIMP among clinically isolated strains of Serratia marcescens. Antimicrob. Agents Chemother. 39:824–829.
Iyobe, S., H. Kusadokoro, J. Ozaki, N. Matsumura, S. Minami, S. Haruta,
T. Sawai, and K. O’Hara. 2000. Amino acid substitutions in a variant of
IMP-1 metallo-␤-lactamase. Antimicrob. Agents Chemother. 44:2023–
2027.
Jacoby, G., and K. Bush. 2005. ␤-Lactam resistance in the 21st century, p.
53–65. In D. G. White, M. N. Alekshun, and P. F. McDermott (ed.),
Frontiers in antimicrobial resistance: a tribute to Stuart B. Levy. ASM
Press, Washington, DC.
Jacoby, G. A. 2006. ␤-Lactamase nomenclature. Antimicrob. Agents Chemother. 50:1123–1129.
Jaurin, B., and T. Grundstrom. 1981. ampC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of ␤-lactamases
of the penicillinase type. Proc. Natl. Acad. Sci. USA 78:4897–4901.
Jeon, B.-C., S. H. Jeong, I. K. Bae, S. B. Kwon, K. Lee, D. Young, J. H. Lee,
cmr.asm.orgm
at UNIV OF ARKANSAS on July 30, 2007
50.
QUEENAN AND BUSH
VOL. 20, 2007
86.
87.
88.
89.
90.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
455
integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191.
Libisch, B., M. Gacs, K. Csiszar, M. Muzslay, L. Rokusz, and M. Fuezi.
2004. Isolation of an integron-borne blaVIM-4 type metallo-␤-lactamase
gene from a carbapenem-resistant Pseudomonas aeruginosa clinical isolate
in Hungary. Antimicrob. Agents Chemother. 48:3576–3578.
Libisch, B., M. Muzslay, M. Gacs, J. Minarovits, M. Knausz, J. Watine, G.
Ternak, E. Kenez, I. Kustos, L. Rokusz, K. Szeles, B. Balogh, and M. Fuzi.
2006. Molecular epidemiology of VIM-4 metallo-␤-lactamase-producing
Pseudomonas sp. isolates in Hungary. Antimicrob. Agents Chemother. 50:
4220–4223.
Lim, H. M., J. J. Pene, and R. W. Shaw. 1988. Cloning, nucleotide sequence,
and expression of the Bacillus cereus 5/B/6 ␤-lactamase II structural gene. J.
Bacteriol. 170:2873–2878.
Lincopan, N., J. A. McCulloch, C. Reinert, V. C. Cassettari, A. C. Gales,
and E. M. Mamizuka. 2005. First isolation of metallo-␤-lactamase-producing multiresistant Klebsiella pneumoniae from a patient in Brazil. J. Clin.
Microbiol. 43:516–519.
Liu, S. Y., J. Y. Lin, C. Chu, L. H. Su, T. Y. Lin, and C. H. Chiu. 2006.
Integron-associated imipenem resistance in Acinetobacter baumannii isolated from a regional hospital in Taiwan. Int. J. Antimicrob. Agents. 27:
81–84.
Livermore, D. M. 2002. The impact of carbapenemases on antimicrobial
development and therapy. Curr. Opin. Investig. Drugs 3:218–224.
Livermore, D. M. 2001. Of Pseudomonas, porins, pumps and carbapenems.
J. Antimicrob. Chemother. 47:247–250.
Livermore, D. M., and N. Woodford. 2006. The ␤-lactamase threat in
Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol. 14:
413–420.
Lolans, K., A. M. Queenan, K. Bush, A. Sahud, and J. P. Quinn. 2005. First
nosocomial outbreak of Pseudomonas aeruginosa producing an integronborne metallo-␤-lactamase (VIM-2) in the United States. Antimicrob.
Agents Chemother. 49:3538–3540.
Lolans, K., T. W. Rice, L. S. Munoz-Price, and J. P. Quinn. 2006. Multicity
outbreak of carbapenem-resistant Acinetobacter baumannii isolates producing the carbapenemase OXA-40. Antimicrob. Agents Chemother. 50:2941–
2945.
Loli, A., L. S. Tzouvelekis, E. Tzelepi, A. Carattoli, A. C. Vatopoulos, P. T.
Tassios, and V. Miriagou. 2006. Sources of diversity of carbapenem resistance levels in Klebsiella pneumoniae carrying blaVIM-1. J. Antimicrob. Chemother. 58:669–672.
Lomaestro, B. M., E. H. Tobin, W. Shang, and T. Gootz. 2006. The spread
of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae to upstate New York. Clin. Infect. Dis. 43:e26–28.
Lopez-Otsoa, F., L. Gallego, K. J. Towner, L. Tysall, N. Woodford, and
D. M. Livermore. 2002. Endemic carbapenem resistance associated with
OXA-40 carbapenemase among Acinetobacter baumannii isolates from a
hospital in northern Spain. J. Clin. Microbiol. 40:4741–4743.
Luzzaro, F., J.-D. Docquier, C. Colinon, A. Endimiani, G. Lombardi, G.
Amicosante, G. M. Rossolini, and A. Toniolo. 2004. Emergence in Klebsiella
pneumoniae and Enterobacter cloacae clinical isolates of the VIM-4 metallo␤-lactamase encoded by a conjugative plasmid. Antimicrob. Agents Chemother. 48:648–650.
Luzzaro, F., A. Endimiani, J.-D. Docquier, C. Mugnaioli, M. Bonsignori, G.
Amicosante, G. M. Rossolini, and A. Toniolo. 2004. Prevalence and characterization of metallo-␤-lactamases in clinical isolates of Pseudomonas
aeruginosa. Diagn. Microbiol. Infect. Dis. 48:131–135.
Majiduddin, F. K., and T. Palzkill. 2005. Amino acid residues that contribute to substrate specificity of class A ␤-lactamase SME-1. Antimicrob.
Agents Chemother. 49:3421–3427.
Majiduddin, F. K., and T. Palzkill. 2003. Amino acid sequence requirements at residues 69 and 238 for the SME-1 ␤-lactamase to confer resistance to ␤-lactam antibiotics. Antimicrob. Agents Chemother. 47:1062–
1067.
Mariotte-Boyer, S., M. H. Nicolas-Chanoine, and R. Labia. 1996. A kinetic
study of NMC-A ␤-lactamase, an Ambler class A carbapenemase also
hydrolyzing cephamycins. FEMS Microbiol. Lett. 143:29–33.
Marque, S., L. Poirel, C. Heritier, S. Brisse, M. D. Blasco, R. Filip, G.
Coman, T. Naas, and P. Nordmann. 2005. Regional occurrence of plasmidmediated carbapenem-hydrolyzing oxacillinase OXA-58 in Acinetobacter
spp. in Europe. J. Clin. Microbiol. 43:4885–4888.
Marra, A. R., C. A. P. Pereira, A. C. Gales, L. C. Menezes, R. G. R. Cal,
J. M. A. de Souza, M. B. Edmond, C. Faro, and S. B. Wey. 2006. Bloodstream infections with metallo-␤-lactamase-producing Pseudomonas aeruginosa: epidemiology, microbiology, and clinical outcomes. Antimicrob.
Agents Chemother. 50:388–390.
Massova, I., and S. Mobashery. 1998. Kinship and diversification of bacterial penicillin-binding proteins and ␤-lactamases. Antimicrob. Agents Chemother. 42:1–17.
Materon, I. C., A. M. Queenan, T. M. Koehler, K. Bush, and T. Palzkill.
2003. Biochemical characterization of ␤-lactamases Bla1 and Bla2 from
Bacillus anthracis. Antimicrob. Agents Chemother. 47:2040–2042.
Downloaded from cmr.asm.org at UNIV OF ARKANSAS on July 30, 2007
91.
J. S. Song, and S. H. Lee. 2005. Investigation of a nosocomial outbreak of
imipenem-resistant Acinetobacter baumannii producing the OXA-23 ␤-lactamase in Korea. J. Clin. Microbiol. 43:2241–2245.
Jeong, S. H., I. K. Bae, D. Kim, S. G. Hong, J. S. Song, J. H. Lee, and S. H.
Lee. 2005. First outbreak of Klebsiella pneumoniae clinical isolates producing GES-5 and SHV-12 extended-spectrum ␤-lactamases in Korea. Antimicrob. Agents Chemother. 49:4809–4810.
Jeong, S. H., K. Lee, Y. Chong, J. H. Yum, S. H. Lee, H. J. Choi, J. M. Kim,
K. H. Park, B. H. Han, S. W. Lee, and T. S. Jeong. 2003. Characterization
of a new integron containing VIM-2, a metallo-␤-lactamase gene cassette,
in a clinical isolate of Enterobacter cloacae. J. Antimicrob. Chemother.
51:397–400.
Jones, R. N., D. J. Biedenbach, H. S. Sader, T. R. Fritsche, M. A. Toleman,
and T. R. Walsh. 2005. Emerging epidemic of metallo-␤-lactamase-mediated resistances. Diagn. Microbiol. Infect. Dis. 51:77–84.
Kahan, J. S., F. M. Kahan, R. Goegelman, S. A. Currie, M. Jackson, E. O.
Stapley, T. W. Miller, A. K. Miller, D. Hendlin, S. Mochales, S. Hernandez,
H. B. Woodruff, and J. Birnbaum. 1979. Thienamycin, a new ␤-lactam
antibiotic. I. Discovery, taxonomy, isolation and physical properties. J. Antibiot. 32:1–12.
Kartali, G., E. Tzelepi, S. Pournaras, C. Kontopoulou, F. Kontos, D. Sofianou, A. N. Maniatis, and A. Tsakris. 2002. Outbreak of infections caused
by Enterobacter cloacae producing the integron-associated ␤-lactamase
IBC-1 in a neonatal intensive care unit of a Greek hospital. Antimicrob.
Agents Chemother. 46:1577–1580.
Kassis-Chikhani, N., D. Decre, V. Gautier, B. Burghoffer, F. Saliba, D.
Mathieu, D. Samuel, D. Castaing, J.-C. Petit, E. Dussaix, and G. Arlet.
2006. First outbreak of multidrug-resistant Klebsiella pneumoniae carrying
blaVIM-1 and blaSHV-5 in a French university hospital. J. Antimicrob. Chemother. 57:142–145.
Ke, W., C. R. Bethel, J. M. Thomson, R. A. Bonomo, and F. van den Akker.
2007. Crystal structure of KPC-2: insights into carbapenemase activity in
class A ␤-lactamases. Biochemistry 46:5732–5740.
Kiffer, C. R. V., C. Mendes, J. L. Kuti, and D. P. Nicolau. 2004. Pharmacodynamic comparisons of antimicrobials against nosocomial isolates of
Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii and
Pseudomonas aeruginosa from the MYSTIC surveillance program: the
OPTAMA Program, South America 2002. Diagn. Microbiol. Infect. Dis.
49:109–116.
Kimura, S., J. Alba, K. Shiroto, R. Sano, Y. Niki, S. Maesaki, K. Akizawa,
M. Kaku, Y. Watanuki, Y. Ishii, and K. Yamaguchi. 2005. Clonal diversity
of metallo-␤-lactamase-possessing Pseudomonas aeruginosa in geographically diverse regions of Japan. J. Clin. Microbiol. 43:458–461.
Koh, T. H., G. S. Babini, N. Woodford, L. H. Sng, L. M. Hall, and D. M.
Livermore. 1999. Carbapenem-hydrolysing IMP-1 ␤-lactamase in Klebsiella
pneumoniae from Singapore. Lancet 353:2162.
Kong, K.-F., S. R. Jayawardena, A. Del Puerto, L. Wiehlmann, U. Laabs, B.
Tummler, and K. Mathee. 2005. Characterization of poxB, a chromosomalencoded Pseudomonas aeruginosa oxacillinase. Gene 358:82–92.
Ktari, S., G. Arlet, B. Mnif, V. Gautier, F. Mahjoubi, M. Ben Jmeaa, M.
Bouaziz, and A. Hammami. 2006. Emergence of multidrug-resistant Klebsiella pneumoniae isolates producing VIM-4 metallo-␤-lactamase, CTXM-15 extended-spectrum ␤-lactamase, and CMY-4 AmpC ␤-lactamase in a
Tunisian university hospital. Antimicrob. Agents Chemother. 50:4198–
4201.
Kuwabara, S., and E. P. Abraham. 1967. Some properties of two extracellular ␤-lactamases from Bacillus cereus 569/H. Biochem. J. 103:27C–30C.
Reference deleted.
Lagatolla, C., E. A. Tonin, C. Monti-Bragadin, L. Dolzani, F. Gombac, C.
Bearzi, E. Edalucci, F. Gionechetti, and G. M. Rossolini. 2004. Endemic
carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-␤lactamase determinants in European hospital. Emerg. Infect. Dis. 10:535–
538.
Lauretti, L., M. L. Riccio, A. Mazzariol, G. Cornaglia, G. Amicosante, R.
Fontana, and G. M. Rossolini. 1999. Cloning and characterization of
blaVIM, a new integron-borne metallo-␤-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob. Agents Chemother. 43:1584–
1590.
Ledent, P., X. Raquet, B. Joris, J. Van Beeumen, and J. M. Frere. 1993. A
comparative study of class-D ␤-lactamases. Biochem. J. 292:555–562.
Lee, K., J. B. Lim, J. H. Yum, D. Yong, Y. Chong, J. M. Kim, and D. M.
Livermore. 2002. blaVIM-2 cassette-containing novel integrons in metallo␤-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida
isolates disseminated in a Korean hospital. Antimicrob. Agents Chemother.
46:1053–1058.
Lee, K., J. H. Yum, D. Yong, H. M. Lee, H. D. Kim, J.-D. Docquier, G. M.
Rossolini, and Y. Chong. 2005. Novel acquired metallo-␤-lactamase gene,
blaSIM-1, in a class 1 integron from Acinetobacter baumannii clinical isolates
from Korea. Antimicrob. Agents Chemother. 49:4485–4491.
Lee, S. H., and S. H. Jeong. 2005. Nomenclature of GES-type extendedspectrum ␤-lactamases. Antimicrob. Agents Chemother. 49:2148.
Levesque, C., L. Piche, C. Larose, and P. H. Roy. 1995. PCR mapping of
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
456
QUEENAN AND BUSH
154.
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
173.
174.
Strynadka. 2000. Crystal structure of the class D ␤-lactamase OXA-10. Nat.
Struct. Biol. 7:918–925.
Pagani, L., C. Colinon, R. Migliavacca, M. Labonia, J.-D. Docquier, E.
Nucleo, M. Spalla, M. Li Bergoli, and G. M. Rossolini. 2005. Nosocomial
outbreak caused by multidrug-resistant Pseudomonas aeruginosa producing
IMP-13 metallo-␤-lactamase. J. Clin. Microbiol. 43:3824–3828.
Pasteran, F., D. Faccone, A. Petroni, M. Rapoport, M. Galas, M. Vazquez,
and A. Procopio. 2005. Novel variant (blaVIM-11) of the metallo-␤-lactamase
blaVIM family in a GES-1 extended-spectrum-␤-lactamase-producing
Pseudomonas aeruginosa clinical isolate in Argentina. Antimicrob. Agents
Chemother. 49:474–475.
Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum ␤-lactamases:
a clinical update. Clin. Microbiol. Rev. 18:657–686.
Paton, R., R. S. Miles, J. Hood, and S. G. B. Amyes. 1993. ARI 1: ␤-lactamase-mediated imipenem resistance in Acinetobacter baumannii. Int. J.
Antimicrob. Agents 2:81–87.
Peleg, A. Y., C. Frankiin, J. M. Bell, and D. W. Spelman. 2005. Dissemination of the metallo-␤-lactamase gene blaIMP-4 among Gram-negative
pathogens in a clinical setting in Australia. Clin. Infect. Dis. 41:1549–1556.
Peleg, A. Y., C. Franklin, J. Bell, and D. W. Spelman. 2004. Emergence of
IMP-4 metallo-␤-lactamase in a clinical isolate from Australia. J. Antimicrob. Chemother. 54:699–700.
Peleg, A. Y., C. Franklin, L. J. Walters, J. M. Bell, and D. W. Spelman.
2006. OXA-58 and IMP-4 carbapenem-hydrolyzing ␤-lactamases in an
Acinetobacter junii blood culture isolate from Australia. Antimicrob. Agents
Chemother. 50:399–400.
Petropoulou, D., K. Tzanetou, V. P. Syriopoulou, G. L. Daikos, G. Ganteris,
and E. Malamou-Lada. 2006. Evaluation of imipenem/imipenem ⫹ EDTA
disk method for detection of metallo-␤-lactamase-producing Klebsiella
pneumoniae isolated from blood cultures. Microb. Drug Resist. 12:39–43.
Philippon, L. N., T. Naas, A.-T. Bouthors, V. Barakett, and P. Nordmann.
1997. OXA-18, a class D clavulanic acid-inhibited extended-spectrum ␤-lactamase from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 41:
2188–2195.
Pitout, J. D. D., B. L. Chow, D. B. Gregson, K. B. Laupland, S. Elsayed, and
D. L. Church. 2007. Molecular epidemiology of metallo-␤-lactamase-producing Pseudomonas aeruginosa in the Calgary Health Region: emergence
of VIM-2-producing isolates. J. Clin. Microbiol. 45:294–298.
Poirel, L., L. Brinas, N. Fortineau, and P. Nordmann. 2005. Integronencoded GES-type extended-spectrum ␤-lactamase with increased activity
toward aztreonam in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 49:3593–3597.
Poirel, L., C. Heritier, and P. Nordmann. 2004. Chromosome-encoded
Ambler class D ␤-lactamase of Shewanella oneidensis as a progenitor of
carbapenem-hydrolyzing oxacillinase. Antimicrob. Agents Chemother. 48:
348–351.
Poirel, L., C. Heritier, and P. Nordmann. 2005. Genetic and biochemical
characterization of the chromosome-encoded class B ␤-lactamases from
Shewanella livingstonensis (SLB-1) and Shewanella frigidimarina (SFB-1). J.
Antimicrob. Chemother. 55:680–685.
Poirel, L., C. Heritier, V. Toluen, and P. Nordmann. 2004. Emergence of
oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 48:15–22.
Poirel, L., I. Le Thomas, T. Naas, A. Karim, and P. Nordmann. 2000.
Biochemical sequence analyses of GES-1, a novel class A extended-spectrum ␤-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae.
Antimicrob. Agents Chemother. 44:622–632.
Poirel, L., M. Magalhaes, M. Lopes, and P. Nordmann. 2004. Molecular
analysis of metallo-␤-lactamase gene blaSPM-1-surrounding sequences from
disseminated Pseudomonas aeruginosa isolates in Recife, Brazil. Antimicrob. Agents Chemother. 48:1406–1409.
Poirel, L., S. Marque, C. Heritier, C. Segonds, G. Chabanon, and P.
Nordmann. 2005. OXA-58, a novel class D ␤-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:202–208.
Poirel, L., T. Naas, D. Nicolas, L. Collet, S. Bellais, J.-D. Cavallo, and P.
Nordmann. 2000. Characterization of VIM-2, a carbapenem-hydrolyzing
metallo-␤-lactamase and its plasmid- and integron-borne gene from a
Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 44:891–897.
Poirel, L., J. N. Pham, L. Cabanne, B. J. Gatus, S. M. Bell, and P. Nordmann.
2004. Carbapenem-hydrolysing metallo-␤-lactamases from Klebsiella pneumoniae and Escherichia coli isolated in Australia. Pathology (Philadelphia)
36:366–367.
Poirel, L., G. F. Weldhagen, C. De Champs, and P. Nordmann. 2002. A
nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the
extended-spectrum ␤-lactamase GES-2 in South Africa. J. Antimicrob.
Chemother. 49:561–565.
Poirel, L., G. F. Weldhagen, T. Naas, C. De Champs, M. G. Dove, and P.
Nordmann. 2001. GES-2, a class A ␤-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrob. Agents Chemother. 45:2598–2603.
Downloaded from cmr.asm.org at UNIV OF ARKANSAS on July 30, 2007
129. Matthew, M. 1979. Plasmid mediated ␤-lactamases of gram-negative bacteria: properties and distribution. J. Antimicrob. Chemother. 5:349–358.
130. Matthew, M., A. M. Harris, M. J. Marshall, and G. W. Ross. 1975. The use
of analytical isoelectric focusing for detection and identification of ␤-lactamases. J. Gen. Microbiol. 88:169–178.
131. Maveyraud, L., D. Golemi-Kotra, A. Ishiwata, O. Meroueh, S. Mobashery,
and J.-P. Samama. 2002. High-resolution X-ray structure of an acyl-enzyme
species for the class D OXA-10 ␤-lactamase. J. Am. Chem. Soc. 124:2461–
2465.
132. Medeiros, A. A. 1984. ␤-Lactamases. Br. Med. Bull. 40:18–27.
133. Medeiros, A. A. 1997. Evolution and dissemination of ␤-lactamases accelerated by generations of ␤-lactam antibiotics. Clinic. Infect. Dis. 24:S19–
S45.
134. Medeiros, A. A., and R. S. Hare. 1986. ␤-Lactamase-mediated resistance to
penems and carbapenems amongst Enterobacteriaceae, abstr. 116. 26th Intersci. Conf. Antimicrob. Agents Chemother. American Society for Microbiology, Washington, DC.
135. Meyer, K. S., C. Urban, J. A. Eagan, B. J. Berger, and J. J. Rahal. 1993.
Nosocomial outbreak of Klebsiella infection resistant to late-generation
cephalosporins. Ann. Intern. Med. 119:353–358.
136. Miriagou, V., E. Tzelepi, D. Gianneli, and L. S. Tzouvelekis. 2003. Escherichia coli with a self-transferable, multiresistant plasmid coding for metallo␤-lactamase VIM-1. Antimicrob. Agents Chemother. 47:395–397.
137. Miriagou, V., L. S. Tzouvelekis, S. Rossiter, E. Tzelepi, F. J. Angulo, and
J. M. Whichard. 2003. Imipenem resistance in a Salmonella clinical strain
due to plasmid-mediated class A carbapenemase KPC-2. Antimicrob.
Agents Chemother. 47:1297–1300.
138. Moland, E. S., N. D. Hanson, V. L. Herrera, J. A. Black, T. J. Lockhart, A.
Hossain, J. A. Johnson, R. V. Goering, and K. S. Thomson. 2003. Plasmidmediated, carbapenem-hydrolysing ␤-lactamase, KPC-2, in Klebsiella pneumoniae isolates. J. Antimicrob. Chemother. 51:711–714.
139. Mourey, L., K. Miyashita, P. Swaren, A. Bulychev, J.-P. Samama, and S.
Mobashery. 1998. Inhibition of the NMC-A ␤-lactamase by a penicillanic
acid derivative and the structural bases for the increase in substrate profile
of this antibiotic resistance enzyme. J. Am. Chem. Soc. 120:9382–9383.
140. Muniesa, M., A. Garcia, E. Miro, B. Mirelis, G. Prats, J. Jofre, and F.
Navarro. 2004. Bacteriophages and diffusion of ␤-lactamase genes. Emerg.
Infect. Dis. 10:1134–1137.
141. Murphy, T. A., L. E. Catto, S. E. Halford, A. T. Hadfield, W. Minor, T. R.
Walsh, and J. Spencer. 2006. Crystal structure of Pseudomonas aeruginosa
SPM-1 provides insights into variable zinc affinity of metallo-␤-lactamases.
J. Mol. Biol. 357:890–903.
142. Naas, T., M. Levy, C. Hirschauer, H. Marchandin, and P. Nordmann. 2005.
Outbreak of carbapenem-resistant Acinetobacter baumannii producing the
carbapenemase OXA-23 in a tertiary care hospital of Papeete, French
Polynesia. J. Clin. Microbiol. 43:4826–4829.
143. Naas, T., and P. Nordmann. 1994. Analysis of a carbapenem-hydrolyzing
class A ␤-lactamase from Enterobacter cloacae and of its LysR-type regulatory protein. Proc. Natl. Acad. Sci. USA 91:7693–7697.
144. Naas, T., and P. Nordmann. 1999. OXA-type ␤-lactamases. Curr. Pharm.
Des. 5:865–879.
145. Naas, T., P. Nordmann, G. Vedel, and C. Poyart. 2005. Plasmid-mediated
carbapenem-hydrolyzing ␤-lactamase KPC in a Klebsiella pneumoniae isolate from France. Antimicrob. Agents Chemother. 49:4423–4424.
146. Naas, T., L. Vandel, W. Sougakoff, D. M. Livermore, and P. Nordmann.
1994. Cloning and sequence analysis of the gene for a carbapenem-hydrolyzing class A ␤-lactamase, Sme-1, from Serratia marcescens S6. Antimicrob.
Agents Chemother. 38:1262–1270.
147. Navon-Venezia, S., I. Chmelnitsky, A. Leavitt, M. J. Schwaber, D. Schwartz,
and Y. Carmeli. 2006. Plasmid-mediated imipenem-hydrolyzing enzyme
KPC-2 among multiple carbapenem-resistant Escherichia coli clones in Israel. Antimicrob. Agents Chemother. 50:3098–3101.
148. Nishio, H., M. Komatsu, N. Shibata, K. Shimakawa, N. Sueyoshi, T. Ura,
K. Satoh, M. Toyokawa, T. Nakamura, Y. Wada, T. Orita, T. Kofuku, K.
Yamasaki, M. Sakamoto, S. Kinoshita, M. Aihara, and Y. Arakawa. 2004.
Metallo-␤-lactamase-producing gram-negative bacilli: laboratory-based
surveillance in cooperation with 13 clinical laboratories in the Kinki region
of Japan. J. Clin. Microbiol. 42:5256–5263.
149. Nordmann, P., S. Mariotte, T. Naas, R. Labia, and M.-H. Nicolas. 1993.
Biochemical properties of a carbapenem-hydrolyzing ␤-lactamase for Enterobacter cloacae and cloning of the gene into Escherichia coli. Antimicrob.
Agents Chemother. 37:939–946.
150. Nordmann, P., and L. Poirel. 2002. Emerging carbapenemases in Gramnegative aerobes. Clin. Microbiol. Infect. 8:321–331.
151. Normark, S. 1995. ␤-Lactamase induction in gram-negative bacteria is
intimately linked to peptidoglycan recycling. Microb. Drug Resist. Mech.
Epidemiol. Dis. 1:111–114.
152. O’Hara, K., S. Haruta, T. Sawai, M. Tsunoda, and S. Iyobe. 1998. Novel
metallo ␤-lactamase mediated by a Shigella flexneri plasmid. FEMS Microbiol. Lett. 162:201–206.
153. Paetzel, M., F. Danel, L. de Castro, S. C. Mosimann, M. G. Page, and N. C.
CLIN. MICROBIOL. REV.
VOL. 20, 2007
198.
199.
200.
201.
202.
203.
204.
205.
206.
207.
208.
209.
210.
211.
212.
213.
214.
215.
216.
217.
457
for metallo-␤-lactamases and integrases carried by gram-negative bacteria
isolated in Japan, with focus on the class 3 integron. J. Clin. Microbiol.
41:5407–5413.
Simpson, I. N., P. B. Harper, and C. H. O’Callaghan. 1980. Principal
␤-lactamases responsible for resistance to ␤-lactam antibiotics in urinary
tract infections. Antimicrob. Agents Chemother. 17:929–936.
Sougakoff, W., G. L’Hermite, L. Pernot, T. Naas, V. Guillet, P. Nordmann,
V. Jarlier, and J. Delettre. 2002. Structure of the imipenem-hydrolyzing
class A ␤-lactamase SME-1 from Serratia marcescens. Acta Crystallogr. D
58:267–274.
Sougakoff, W., T. Naas, P. Nordmann, E. Collatz, and V. Jarlier. 1999. Role
of Ser-237 in the substrate specificity of the carbapenem-hydrolyzing class
A ␤-lactamase Sme-1. Biochim. Biophys. Acta 1433:153–158.
Swaren, P., L. Maveyraud, X. Raquet, S. Cabantous, C. Duez, J.-D. Pedelacq,
S. Mariotte-Boyer, L. Mourey, R. Labia, M.-H. Nicolas-Chanoine, P. Nordmann, J.-M. Frere, and J.-P. Samama. 1998. X-ray analysis of the NMC-A
␤-lactamase at 1.64-Å resolution, a class A carbapenemase with broad substrate specificity. J. Biol. Chem. 273:26714–26721.
Sykes, R. B., and M. Matthew. 1976. The ␤-lactamases of Gram-negative
bacteria and their role in resistance to ␤-lactam antibiotics. J. Antimicrob.
Chemother. 2:115–157.
Tenover, F. C., R. K. Kalsi, P. P. Williams, R. B. Carey, S. Stocker, D.
Lonsway, J. K. Rasheed, J. W. Biddle, J. E. McGowan, Jr., and B. Hanna.
2006. Carbapenem resistance in Klebsiella pneumoniae not detected by
automated susceptibility testing. Emerg. Infect. Dis. 12:1209–1213.
Toleman, M. A., K. Rolston, R. N. Jones, and T. R. Walsh. 2004. blaVIM-7,
an evolutionarily distinct metallo-␤-lactamase gene in a Pseudomonas
aeruginosa isolate from the United States. Antimicrob. Agents Chemother.
48:329–332.
Toleman, M. A., K. Rolston, R. N. Jones, and T. R. Walsh. 2003. Molecular
and biochemical characterization of OXA-45, an extended-spectrum class
2d⬘ ␤-lactamase in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 47:2859–2863.
Toleman, M. A., A. M. Simm, T. A. Murphy, A. C. Gales, D. J. Biedenbach,
R. N. Jones, and T. R. Walsh. 2002. Molecular characterization of SPM-1,
a novel metallo-␤-lactamase isolated in Latin America: report from the
SENTRY antimicrobial surveillance programme. J. Antimicrob. Chemother. 50:673–679.
Tortola, M. T., S. Lavilla, E. Miro, J. J. Gonzalez, N. Larrosa, M. Sabate,
F. Navarro, and G. Prats. 2005. First detection of a carbapenem-hydrolyzing metalloenzyme in two Enterobacteriaceae isolates in Spain. Antimicrob.
Agents Chemother. 49:3492–3494.
Troillet, N., Y. Carmeli, L. Venkataraman, P. DeGirolami, and M. H.
Samore. 1999. Epidemiological analysis of imipenem-resistant Serratia
marcescens in hospitalized patients. J. Hosp. Infect. 42:37–43.
Turner, P. J. 2004. Susceptibility of meropenem and comparators tested
against 30,634 Enterobacteriaceae isolated in the MYSTIC Programme
(1997–2003). Diagn. Microbiol. Infect. Dis. 50:291–293.
Turner, P. J. 2005. Trends in antimicrobial susceptibilities among bacterial
pathogens isolated from patients hospitalized in European medical centers:
6-year report of the MYSTIC Surveillance Study (1997–2002). Diagn. Microbiol. Infect. Dis. 51:281–289.
Turton, J. F., M. E. Kaufmann, J. Glover, J. M. Coelho, M. Warner, R.
Pike, and T. L. Pitt. 2005. Detection and typing of integrons in epidemic
strains of Acinetobacter baumannii found in the United Kingdom. J. Clin.
Microbiol. 43:3074–3082.
Turton, J. F., M. E. Ward, N. Woodford, M. E. Kaufmann, R. Pike, D. M.
Livermore, and T. L. Pitt. 2006. The role of ISAba1 in expression of OXA
carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett.
258:72–77.
Turton, J. F., N. Woodford, J. Glover, S. Yarde, M. E. Kaufmann, and T. L.
Pitt. 2006. Identification of Acinetobacter baumannii by detection of the
blaOXA-51-like carbapenemase gene intrinsic to this species. J. Clin. Microbiol. 44:2974–2976.
Ullah, J. H., T. R. Walsh, I. A. Taylor, D. C. Emery, C. S. Verma, S. J.
Gamblin, and J. Spencer. 1998. The crystal structure of the L1 metallo-␤lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution. J. Mol.
Biol. 284:125–136.
Vahaboglu, H., F. Budak, M. Kasap, G. Gacar, S. Torol, A. Karadenizli, F.
Kolayli, and C. Eroglu. 2006. High prevalence of OXA-51-type class D
␤-lactamases among ceftazidime-resistant clinical isolates of Acinetobacter
spp.: co-existence with OXA-58 in multiple centres. J. Antimicrob. Chemother. 58:537–542.
Villegas, M. V., K. Lolans, A. Correa, J. N. Kattan, J. A. Lopez, J. P. Quinn,
and the Colombian Nosocomial Resistance Study Group. 2007. First identification of Pseudomonas aeruginosa isolates producing a KPC-type carbapenem-hydrolyzing ␤-lactamase. Antimicrob. Agents Chemother. 51:1553–
1555.
Villegas, M. V., K. Lolans, O. M. del Rosario, C. J. Suarez, A. Correa, A. M.
Queenan, and J. P. Quinn. 2006. First detection of metallo-␤-lactamase
VIM-2 in Pseudomonas aeruginosa isolates from Colombia. Antimicrob.
Agents Chemother. 50:226–229.
Downloaded from cmr.asm.org at UNIV OF ARKANSAS on July 30, 2007
175. Pottumarthy, S., E. S. Moland, S. Jeretschko, S. R. Swanzy, K. S. Thomson,
and T. R. Fritsche. 2003. NmcA carbapenem-hydrolyzing enzyme in Enterobacter cloacae in North America. Emerg. Infect. Dis. 9:999–1002.
176. Quale, J., S. Bratu, J. Gupta, and D. Landman. 2006. Interplay of efflux
system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 50:
1633–1641.
177. Quale, J. M., D. Landman, P. A. Bradford, M. Visalli, J. Ravishankar, C.
Flores, D. Mayorga, K. Vangala, and A. Adedeji. 2002. Molecular epidemiology of a citywide outbreak of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae infection. Clin. Infect. Dis. 35:834–841.
178. Queenan, A. M., W. Shang, P. Schreckenberger, K. Lolans, K. Bush, and J.
Quinn. 2006. SME-3, a novel member of the Serratia marcescens SME
family of carbapenem-hydrolyzing ␤-lactamases. Antimicrob. Agents Chemother. 50:3485–3487.
179. Queenan, A. M., C. Torres-Viera, H. S. Gold, Y. Carmeli, G. M. Eliopoulos,
R. C. Moellering, Jr., J. P. Quinn, J. Hindler, A. A. Medeiros, and K. Bush.
2000. SME-type carbapenem-hydrolyzing class A ␤-lactamases from geographically diverse Serratia marcescens strains. Antimicrob. Agents Chemother. 44:3035–3039.
180. Quinteira, S., and H. F. Luisa-Peixe. 2005. First isolation of blaVIM-2 in an
environmental isolate of Pseudomonas pseudoalcaligenes. Antimicrob.
Agents Chemother. 49:2140–2141.
181. Radice, M., P. Power, G. Gutkind, K. Fernandez, C. Vay, A. Famiglietti, N.
Ricover, and J. Ayala. 2004. First class A carbapenemase isolated from
Enterobacteriaceae in Argentina. Antimicrob. Agents Chemother. 48:1068–
1069.
182. Rasmussen, B. A., and K. Bush. 1997. Carbapenem-hydrolyzing ␤-lactamases. Antimicrob. Agents Chemother. 41:223–232.
183. Rasmussen, B. A., K. Bush, D. Keeney, Y. Yang, R. Hare, C. O’Gara, and
A. A. Medeiros. 1996. Characterization of IMI-1 ␤-lactamase, a class A
carbapenem-hydrolyzing enzyme from Enterobacter cloacae. Antimicrob.
Agents Chemother. 40:2080–2086.
184. Riccio, M. L., N. Franceschini, L. Boschi, B. Caravelli, G. Cornaglia, R.
Fontana, G. Amicosante, and G. M. Rossolini. 2000. Characterization of
the metallo-␤-lactamase determinant of Acinetobacter baumannii AC-54/97
reveals the existence of blaIMP allelic variants carried by gene cassettes of
different phylogeny. Antimicrob. Agents Chemother. 44:1229–1235.
185. Richmond, M. H., and R. B. Sykes. 1973. The ␤-lactamases of Gramnegative bacteria and their possible physiological role, p. 31–88. In A. H.
Rose and D. W. Tempest (ed.), Advances in microbial physiology, vol. 9.
Academic Press, New York, NY.
186. Ryoo, N. H., E.-C. Kim, S. G. Hong, Y. J. Park, K. Lee, I. K. Bae, E. H. Song,
and S. H. Jeong. 2005. Dissemination of SHV-12 and CTX-M-type extendedspectrum ␤-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. J. Antimicrob. Chemother. 56:698–702.
187. Sader, H. S., A. O. Reis, S. Silbert, and A. C. Gales. 2005. IMPs, VIMs and
SPMs: the diversity of metallo-␤-lactamases produced by carbapenem-resistant Pseudomonas aeruginosa in a Brazilian hospital. Clin. Microbiol.
Infect. 11:73–76.
188. Saino, Y., F. Kobayashi, M. Inoue, and S. Mitsuhashi. 1982. Purification
and properties of inducible penicillin ␤-lactamase isolated from Pseudomonas maltophilia. Antimicrob. Agents Chemother. 22:564–570.
189. Santillana, E., A. Beceiro, G. Bou, and A. Romero. 2007. Crystal structure
of the carbapenemase OXA-24 reveals insights into the mechanism of
carbapenem hydrolysis. Proc. Natl. Acad. Sci. USA 104:5354–5359.
190. Sardelic, S., L. Pallecchi, V. Punda-Polic, and G. M. Rossolini. 2003. Carbapenem-resistant Pseudomonas aeruginosa-carrying VIM-2 metallo-␤-lactamase determinants, Croatia. Emerg. Infect. Dis. 9:1022–1023.
191. Scaife, W., H.-K. Young, R. H. Paton, and S. G. B. Amyes. 1995. Transferable imipenem-resistance in Acinetobacter species from a clinical source. J.
Antimicrob. Chemother. 36:585–586.
192. Schneider, I., A. M. Queenan, and A. Bauernfeind. 2006. Novel carbapenem-hydrolyzing oxacillinase OXA-62 from Pandoraea pnomenusa. Antimicrob. Agents Chemother. 50:1330–1335.
193. Scoulica, E. V., I. K. Neonakis, A. I. Gikas, and Y. J. Tselentis. 2004. Spread
of blaVIM-1-producing E. coli in a university hospital in Greece. Genetic
analysis of the integron carrying the blaVIM-1 metallo-␤-lactamase gene.
Diagn. Microbiol. Infect. Dis. 48:167–172.
194. Segal, H., and B. G. Elisha. 2005. Use of Etest MBL strips for the detection
of carbapenemases in Acinetobacter baumannii. J. Antimicrob. Chemother.
56:598.
195. Senda, K., Y. Arakawa, S. Ichiyama, K. Nakashima, H. Ito, S. Ohsuka, K.
Shimokata, N. Kato, and M. Ohta. 1996. PCR detection of metallo-␤lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum
␤-lactams. J. Clin. Microbiol. 34:2909–2913.
196. Shannon, K., A. King, and I. Phillips. 1986. ␤-Lactamases with high activity
against imipenem and Sch 34343 from Aeromonas hydrophila. J. Antimicrob. Chemother. 17:45–50.
197. Shibata, N., Y. Doi, K. Yamane, T. Yagi, H. Kurokawa, K. Shibayama, H.
Kato, K. Kai, and Y. Arakawa. 2003. PCR typing of genetic determinants
CARBAPENEMASES: THE VERSATILE ␤-LACTAMASES
458
QUEENAN AND BUSH
218. Vourli, S., P. Giakkoupi, V. Miriagou, E. Tzelepi, A. C. Vatopoulos, and
L. S. Tzouvelekis. 2004. Novel GES/IBC extended-spectrum ␤-lactamase
variants with carbapenemase activity in clinical Enterobacteria. FEMS Microbiol. Lett. 234:209–213.
219. Wachino, J.-I., Y. Doi, K. Yamane, N. Shibata, T. Yagi, T. Kubota, and Y.
Arakawa. 2004. Molecular characterization of a cephamycin-hydrolyzing
and inhibitor-resistant class A ␤-lactamase, GES-4, possessing a single
G170S substitution in the omega-loop. Antimicrob. Agents Chemother.
48:2905–2910.
220. Wachino, J.-I., Y. Doi, K. Yamane, N. Shibata, T. Yagi, T. Kubota, H. Ito,
and Y. Arakawa. 2004. Nosocomial spread of ceftazidime-resistant Klebsiella pneumoniae strains producing a novel class A ␤-lactamase, GES-3, in
a neonatal intensive care unit in Japan. Antimicrob. Agents Chemother.
48:1960–1967.
221. Walsh, T. R. 2005. The emergence and implications of metallo-␤-lactamases in Gram-negative bacteria. Clin. Microbiol. Infect. 11:2–9.
222. Walsh, T. R., A. Bolmstrom, A. Qwarnstrom, and A. Gales. 2002. Evaluation of a new Etest for detecting metallo-␤-lactamases in routine clinical
testing. J. Clin. Microbiol. 40:2755–2759.
223. Walsh, T. R., D. J. Payne, A. P. MacGowan, and P. M. Bennett. 1995. A
clinical isolate of Aeromonas sobria with three chromosomally mediated
inducible ␤-lactamases: a cephalosporinase, a penicillinase and a third
enzyme displaying carbapenemase activity. J. Antimicrob. Chemother. 37:
423–431.
224. Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo␤-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306–325.
225. Walther-Rasmussen, J., and N. Hoiby. 2006. OXA-type carbapenemases. J.
Antimicrob. Chemother. 57:373–383.
226. Wang, C.-X., and Z.-H. Mi. 2004. IMP-1 metallo-␤-lactamase-producing
Pseudomonas aeruginosa in a university hospital in the People’s Republic of
China. J. Antimicrob. Chemother. 54:1159–1160.
227. Wang, C., J. Wang, and Z. Mi. 2006. Pseudomonas aeruginosa producing
VIM-2 metallo-␤-lactamases and carrying two aminoglycoside-modifying
enzymes in China. J. Hosp. Infect. 62:522–524.
228. Watanabe, M., S. Iyobe, M. Inoue, and S. Mitsuhashi. 1991. Transferable
imipenem resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 35:147–151.
229. Wei, Z.-Q., X.-X. Du, Y.-S. Yu, P. Shen, Y.-G. Chen, and L.-J. Li. 2007.
Plasmid-mediated KPC-2 in a Klebsiella pneumoniae isolate from China.
Antimicrob. Agents Chemother. 51:763–765.
230. Weldhagen, G. F., and A. Prinsloo. 2004. Molecular detection of GES-2
extended spectrum ␤-lactamase producing Pseudomonas aeruginosa in Pretoria, South Africa. Int. J. Antimicrob. Agents 24:35–38.
231. Reference deleted.
232. Woodford, N., M. J. Ellington, J. M. Coelho, J. F. Turton, M. E. Ward, S.
Brown, S. G. B. Amyes, and D. M. Livermore. 2006. Multiplex PCR for
genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int. J.
Antimicrob. Agents 27:351–353.
233. Woodford, N., P. M. Tierno, Jr., K. Young, L. Tysall, M.-F. I. Palepou, E.
Ward, R. E. Painter, D. F. Suber, D. Shungu, L. L. Silver, K. Inglima, J.
Kornblum, and D. M. Livermore. 2004. Outbreak of Klebsiella pneumoniae
producing a new carbapenem-hydrolyzing class A ␤-lactamase, KPC-3, in a
New York medical center. Antimicrob. Agents Chemother. 48:4793–4799.
234. Xiong, J., M. F. Hynes, H. Ye, H. Chen, Y. Yang, F. M’Zali, and P. M.
Hawkey. 2006. blaIMP-9 and its association with large plasmids carried by
Pseudomonas aeruginosa isolates from the People’s Republic of China.
Antimicrob. Agents Chemother. 50:355–358.
235. Yamasaki, K., M. Komatsu, T. Yamashita, K. Shimakawa, T. Ura, H.
Nishio, K. Satoh, R. Washidu, S. Kinoshita, and M. Aihara. 2003. Production of CTX-M-3 extended-spectrum ␤-lactamase and IMP-1 metallo ␤-lactamase by five Gram-negative bacilli: survey of clinical isolates from seven
laboratories collected in 1998 and 2000, in the Kinki region of Japan. J.
Antimicrob. Chemother. 51:631–638.
CLIN. MICROBIOL. REV.
236. Yan, J.-J., P.-R. Hsueh, J.-J. Lu, F.-Y. Chang, W.-C. Ko, and J.-J. Wu. 2006.
Characterization of acquired ␤-lactamases and their genetic support in
multidrug-resistant Pseudomonas aeruginosa isolates in Taiwan: the prevalence of unusual integrons. J. Antimicrob. Chemother. 58:530–536.
237. Yan, J.-J., W.-C. Ko, C.-L. Chuang, and J.-J. Wu. 2002. Metallo-␤-lactamase-producing Enterobacteriaceae isolates in a university hospital in Taiwan: prevalence of IMP-8 in Enterobacter cloacae and first identification of
VIM-2 in Citrobacter freundii. J. Antimicrob. Chemother. 50:503–511.
238. Yan, J.-J., W.-C. Ko, and J.-J. Wu. 2001. Identification of a plasmid encoding SHV-12, TEM-1, and a variant of IMP-2 metallo-␤-lactamase, IMP-8,
from a clinical isolate of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45:2368–2371.
239. Yan, J.-J., J.-J. Wu, S.-H. Tsai, and C.-L. Chuang. 2004. Comparison of the
double-disk, combined disk, and Etest methods for detecting metallo-␤lactamases in gram-negative bacilli. Diagn. Microbiol. Infect. Dis. 49:5–11.
240. Yan, J. J., P. R. Hsueh, W. C. Ko, K. T. Luh, S. H. Tsai, H. M. Wu, and J. J.
Wu. 2001. Metallo-␤-lactamases in clinical Pseudomonas isolates in Taiwan
and identification of VIM-3, a novel variant of the VIM-2 enzyme. Antimicrob. Agents Chemother. 45:2224–2228.
241. Yang, Y., and K. Bush. 1996. Biochemical characterization of the carbapenem-hydrolyzing ␤-lactamase AsbM1 from Aeromonas sobria AER 14M: a
member of a novel subgroup of metallo-␤-lactamases. FEMS Microbiol.
Lett. 137:193–200.
242. Yang, Y., B. A. Rasmussen, and K. Bush. 1992. Biochemical characterization of the metallo-␤-lactamase CcrA from Bacteroides fragilis TAL3636.
Antimicrob. Agents Chemother. 36:1155–1157.
243. Yang, Y., P. Wu, and D. M. Livermore. 1990. Biochemical characterization
of a ␤-lactamase that hydrolyzes penems and carbapenems from two Serratia marcescens isolates. Antimicrob. Agents Chemother. 34:755–758.
244. Yano, H., A. Kuga, R. Okamoto, H. Kitasato, T. Kobayashi, and M. Inoue.
2001. Plasmid-encoded metallo-␤-lactamase (IMP-6) conferring resistance
to carbapenems, especially meropenem. Antimicrob. Agents Chemother.
45:1343–1348.
245. Yigit, H., A. M. Queenan, G. J. Anderson, A. Domenech-Sanchez, J. W.
Biddle, C. D. Steward, S. Alberti, K. Bush, and F. C. Tenover. 2001. Novel
carbapenem-hydrolyzing ␤-lactamase, KPC-1, from a carbapenem-resistant
strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45:1151–
1161.
246. Yigit, H., A. M. Queenan, K. Rasheed, J. W. Biddle, A. Domenech-Sanchez,
S. Alberti, K. Bush, and F. C. Tenover. 2003. Carbapenem-resistant strain
of Klebsiella oxytoca harboring carbapenem-hydrolyzing ␤-lactamase
KPC-2. Antimicrob. Agents Chemother. 47:3881–3889.
247. Yong, D., S. Choi Yeoung, H. Roh Kyoung, K. Kim Chang, H. Park Youn,
H. Yum Jong, K. Lee, and Y. Chong. 2006. Increasing prevalence and
diversity of metallo-␤-lactamases in Pseudomonas spp., Acinetobacter spp.,
and Enterobacteriaceae from Korea. Antimicrob. Agents Chemother. 50:
1884–1886.
248. Yong, D., K. Lee, J. H. Yum, H. B. Shin, G. M. Rossolini, and Y. Chong.
2002. Imipenem-EDTA disk method for differentiation of metallo-␤-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter
spp. J. Clin. Microbiol. 40:3798–3801.
249. Yu, Y.-S., X.-X. Du, Z.-H. Zhou, Y.-G. Chen, and L.-J. Li. 2006. First
isolation of blaIMI-2 in an Enterobacter cloacae clinical isolate from China.
Antimicrob. Agents Chemother. 50:1610–1611.
250. Yum, J. H., D. Yong, K. Lee, H.-S. Kim, and Y. Chong. 2002. A new integron
carrying VIM-2 metallo-␤-lactamase gene cassette in a Serratia marcescens
isolate. Diagn. Microbiol. Infect. Dis. 42:217–219.
251. Zavascki, A. P., P. B. Gaspareto, A. F. Martins, A. L. Goncalves, and A. L.
Barth. 2005. Outbreak of carbapenem-resistant Pseudomonas aeruginosa
producing SPM-1 metallo-␤-lactamase in a teaching hospital in southern
Brazil. J. Antimicrob. Chemother. 56:1148–1151.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 459–477
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00039-06
Vol. 20, No. 3
Atmospheric Movement of Microorganisms in Clouds of Desert Dust
and Implications for Human Health
Dale W. Griffin*
U.S. Geological Survey, St. Petersburg, Florida 33701
INTRODUCTION .......................................................................................................................................................459
OCCURRENCE...........................................................................................................................................................461
Bacteria ....................................................................................................................................................................461
Fungi.........................................................................................................................................................................465
Viruses ......................................................................................................................................................................465
PATHOGENS ..............................................................................................................................................................466
Bacteria ....................................................................................................................................................................466
Fungi.........................................................................................................................................................................466
Viruses ......................................................................................................................................................................467
Unknown Agents .....................................................................................................................................................469
DETECTION ...............................................................................................................................................................470
Collection .................................................................................................................................................................470
Identification............................................................................................................................................................471
CONCLUSIONS AND PERSPECTIVES.................................................................................................................472
ACKNOWLEDGMENT..............................................................................................................................................472
REFERENCES ............................................................................................................................................................472
The larger deserts on the planet, which include the Sahara
and Sahel regions of North Africa and the Gobi, Takla Makan,
and Badain Jaran deserts of Asia, are the primary sources of
mobilized desert top soils that move great distances through
the atmosphere each year (Fig. 1). The current estimate for the
annual quantity of desert dust that makes regional or global
airborne migrations is 0.5 to 5.0 billion tons (184). While it is
believed that the Sahara and Sahel regions of North Africa
have been and are the dominant sources of dust in the atmosphere (50 to 75% of the current estimate), there has been
increased Asian dust activity over the last 20 years that has
been attributed to climate change and desertification (73, 166,
191, 265). Between 1975 and 1987, the desertification rate in
China was ⬃2,100 km2 year⫺1 (266). Other regions of known
dust storm activity include the arid regions of the continental
United States (the Great Basin), Central America, South
America (Salar de Uyuni), Central Australia, South Africa
(Etosha and Mkgadikgadi basins), and the Middle East (244).
In general, high-energy wind conditions in arid regions can
result in the mobilization of significant quantities of soils into
the atmosphere, and large dust storm events are capable of
continent-wide, transoceanic, and global dispersion (68, 193).
Dust emanates from North Africa year-round and at times
throughout the year impacts air quality in Africa, the Middle
East, Europe, Asia, the Caribbean, and the Americas (Fig. 2).
Dust source areas in the Sahara and Sahel, primary latitudinal
transport routes, and the influence of climate and climate
systems (North Atlantic Oscillation and El Niño, etc.) on year-
* Present address: U.S. Geological Survey, 2010 Levy Ave., Tallahassee, FL 32310. Phone: (850) 942-9500, ext. 3062. Fax: (850) 9429521. E-mail: [email protected].
459
c
to-year dust flux have been previously reported (73, 74, 156,
166, 189, 191, 192, 212, 224, 235).
Dust storm activity in the deserts of Asia is seasonal, with the
majority of atmospheric transport occurring during the spring
(February to May) (258). Although Asian dust generation is
seasonal, significant quantities are generated and can be dispersed universally in the Northern Hemisphere. A large Asian
dust event in 1990 moved across the Pacific, the North American continent, and the Atlantic Ocean and was later identified
in the French Alps via isotopic analysis of deposited particulate
matter (84). A large dust event impacting the west coast of
North America in 1998 reduced solar radiation levels by 30 to
40% and left a chemical fingerprint of deposited dust extending inland to the state of Minnesota (100).
Asian dust storms can take from 7 to 9 days to cross the
Pacific Ocean. Dust storms moving off the west coast of Africa
can take from 3 to 5 days to reach the Caribbean and Americas. As Fig. 1 illustrates, continuous transmission off the North
African deserts can result in prolonged exposure of individuals
living at considerable distances (the Caribbean and Americas)
from the source of particulates. Using a handheld laser particle
counter, I recorded a background particulate load of 2.6 ⫻ 106
airborne particles m⫺3 at a location south of Tampa Bay,
Florida, on 15 July 2005. During an African dust event that
occurred from 25 to 28 July 2005, the particle count in the
same region south of Tampa Bay on 25 July was 26.1 ⫻ 106
particles m⫺3. Ninety-nine percent of the particles were within
a size range of ⬎0.3 ␮m to ⬍1.0 ␮m, the sub-2.5-␮m fraction
that can penetrate deep into the lung environment (Fig. 1C is
an image of that dust event period). These data demonstrate
the ability of dust storms to impact air quality at significant
distances from their sources (Tampa Bay is ⬎6,500 km west of
the coast of North Africa). A higher risk to human health
would obviously be associated with populations closer to dust
INTRODUCTION
460
GRIFFIN
CLIN. MICROBIOL. REV.
FIG. 1. African and Asian dust storms. Stars identify dust cloud source regions, and arrows identify dust clouds and the general direction of
movement. (A) NASA image, via the moderate-resolution imaging spectroradiometer (MODIS) aboard the Terra satellite, of a dust storm blowing
over the Sea of Japan on 1 April 2002. (Image courtesy of Jacques Descloitres, MODIS Land Rapid Response Team, NASA/Goddard Space Flight
Center.) (B) NASA image, via MODIS, of a dust storm blowing out of Africa over the Mediterranean Sea in the direction of Turkey. The black
spot in the tongue of dust is the Troödos mountain range of Cyprus, which protrudes through the top of the dust cloud. The image was taken on
25 February 2006. (Courtesy of Jeff Schmaltz, MODIS Land Rapid Response Team, NASA/Goddard Space Flight Center.) (C) NASA SeaViewing Wide Field-of-View Sensor (SeaWiFS) image of a large dust cloud blowing across the Atlantic. The image was taken on 19 July 2005 and
is courtesy of the SeaWiFS Project, NASA/Goddard Space Flight Center, and ORBIMAGE. This dust cloud impacted the air quality in Florida.
Airborne particle measurements taken by the author with a handheld laser particle counter south of Tampa Bay, FL, went from 2.6 ⫻ 106 m⫺3
on 15 July 2005 (normal clear atmosphere) to 26.1 ⫻ 106 m⫺3 on 25 July 2005 (dust conditions). Over 90% of the particles ranged from ⬎0.3 to
0.5 ␮m in size.
source regions, as this excerpt regarding the American Dust
Bowl period illustrates:
It is stated by some authorities that man breathes,
on an average, approximately 25 pounds of air daily.
Nelson’s “Loose Leaf Living Medicine” says that a
normal individual inhales 30.5 cubic inches of air at
each breath and breathes 17 times per minute. Then
with an average of 0.0368 g of dust per cubic foot of
air over a period of ten hours (the average duration
of the dust storms) the straining apparatus of the
respiratory system is confronted with a very large
task. From above figures it can be computed that an
individual breathes 6.6240 g of dust during an average dust storm (18).
Every human breath taken is laden with particulate matter,
and human evolution produced the most obvious and familiar
front line of defense, nose hair. Less obvious are the mucus
glands that line our airways. These glands function to trap and
aid in the expulsion of particulates via secretion, ciliated transport, and ingestion or cough. Of particular concern are particles of ⬍10 ␮m in size that can penetrate into the lungs and
those of ⬍2.5 ␮m that may penetrate into deep lung tissue and
the subepithelial environment. These very small particles cause
adverse health effects via oxidative stress (47, 52, 263). The
deposition rate of ultrafine particles (⬍100 nm) in the lungs
has been shown to increase as particle size decreases and to
increase with exercise versus resting (46). Health studies conducted in urban and suburban environments have demonstrated mortality risk with exposure to particulate matter and
have attributed this risk to anthropogenic particulates generated through automotive and industrial combustion versus
those of crustal origin (130, 210). Several studies conducted to
investigate the role of dust storms that consist of concentrated
crustal particulates have shown an associated allergic, asthma,
and silicosis/pulmonary fibrosis risk (36, 127, 173, 180, 202,
259). Areas impacted by desert dust storms, such as communities in the Middle East and the Caribbean, are known to have
some of the highest incidences of asthma on the planet (8, 16,
96). On the Caribbean island of Barbados, the incidence of
asthma increased 17-fold between 1973 and 1996, a period that
coincided with increased flux of African dust to the area of the
island (97, 188). Gyan et al. recently demonstrated a link between African dust and pediatric respiratory stress on the
southern Caribbean island of Trinidad (85). Allergens commonly associated with dust storms include fungal spores, plant
and grass pollens, anthropogenic emissions, and organic detritus (62, 103, 125).
Desert dust cloud toxicity may be influenced by anthropogenic material as a result of particulate/pollutant aerosoliza-
VOL. 20, 2007
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
461
FIG. 2. Primary sources of desert dust and their atmospheric pathways. (1) During summer in the Northern Hemisphere (approximately June
through October), African desert dust is transported across the Atlantic to the northern Caribbean and North America. (2) During winter in the
Northern Hemisphere (approximately November through May), African desert dust is transported across the Atlantic to the southern Caribbean
and South America. (3) The Asian dust season typically lasts from late February to late April. (4) Large Asian dust events can travel significant
distances in the Northern Hemisphere. Yellow lines show Asian desert dust atmospheric routes, orange lines show African dust routes, brown lines
show routes of other desert dust sources, and broken black lines depict wind patterns. (Base map image courtesy of NASA’s Geospatial
Interoperability Office, GSFC [http://viewer.digitalearth.gov/].)
tion during cloud formation or cloud capture during downwind
transport (adsorption of pesticides, herbicides, and industrial
emissions, etc.). Inherent toxicity is due to differences in native
soil elemental composition (metals and naturally occurring or
synthetic radioisotopes, etc.), atmospheric chemical alteration,
size fractionation, and extreme particulate load (5, 44, 88, 131,
174, 176, 263). Toxic metals such as arsenic and mercury have
been shown to occur in airborne desert dust in downwind
environments at concentrations higher than regional crustal
concentrations (93). In addition to the presence of these toxic
metals, dust can indirectly impact human health by spurring
toxic algal blooms in coastal environments (i.e., red tides, in
which marine organisms utilize dust components such as iron
as a nutrient in nutrient-depleted waters) (93, 138, 243). Dust
clouds may contain high concentrations of organics composed
of plant detritus and microorganisms (80, 108) and may pick up
additional biological loads (fungal spores, bacteria, viruses,
and pollen, etc.) as the clouds move through and sandblast
downwind terrestrial environments and/or over aquatic environments through the adhesion of microbe-laden fine aquatic
sprays to dust particles. All of these potential dust cloud constituents may negatively influence human health in regional
and downwind environments, with the greatest risk factors
being frequency of exposure, concentration of and composition
of particulates, and immunological status. Dust-borne microorganisms in particular can directly impact human health via
pathogenesis, exposure of sensitive individuals to cellular components (pollen and fungal allergens and lipopolysaccharide
[LPS], etc.), and the development of sensitivities (i.e., asthma)
through prolonged exposure. Dust-borne dispersion of microorganisms may also play a significant role in the biogeographical
distribution of both pathogenic and nonpathogenic species, as
long-range atmospheric transport routes and concentrations
shift through time due to climatic and geologic change (148,
163).
OCCURRENCE
Reflecting on the whole of this, I conclude that the
germs float through the atmosphere in groups or
clouds, and that now and then a cloud specifically
different from the prevalent ones is wafted through
the air. The touching of a nutritive fluid by a Bacteria
cloud would naturally have a different effect from the
touching of it by the sterile air between two clouds.
But, as in the case of a mottled sky, the various
portions of the landscape are successively visited by
shade, so, in the long run, are the various tubes of our
tray touched by the Bacterial clouds, the final fertilization or infection of them all being the consequence
(236).
Bacteria
Desert topsoils are laden with viable and diverse prokaryote
communities (29, 32, 53, 124, 177). Globally, a gram of topsoil
contains ⬃107 (forest) to 109 (arid and other soil types) prokaryotes (247). These populations are believed to consist of
⬃10,000 bacterial types with ⬃0.1% of the total population
composing ⬃99.9% of the diversity (67, 233, 234). Studies that
have examined the number of culturable prokaryotes in desert
soils have reported concentrations ranging from 0 to ⬃107
gram⫺1 (126, 144, 169).
Dominant phyla found in soils, as determined by their prevalence in sequence libraries, include the Proteobacteria, Acidobacteria, and Actinobacteria (110). Although this community
462
GRIFFIN
CLIN. MICROBIOL. REV.
TABLE 1. Genera of bacteria and fungi found in dust storm samples where identified to at least the genus levela
Bacterial genus/genera
Fungal genera
Method of identification
(bacterial/fungal)
Location (reference)
Dust source region
Arthrobacter, Bacillus,
Cryptococcus, Flavimonas,
Kurthia, Neisseria, Paenibacillus,
Pseudomonas, Ralstonia, and
Staphylococcus
Alternaria, Cryptococcus, Mortierella,
Penicillium, Phoma, Rhodotorula,
and Stemphylium
Fatty acid methyl esters and
16S rRNA gene
sequencing/26S rRNA
gene sequencing
Kuwait (141)
Middle East
Bacillus, Pseudomonas, and
Staphylococcus
Alternaria, Aspergillus, Botrytis,
Cladosporium, Mortierella, Mucor,
Penicillium, Pythium Ulocladium,
and Verticillium
Microscope/microscope
Saudi Arabia (126)
Saudi Arabia
Arthrobacter, Corynebacterium,
Microbacterium, Nocardioides,
Planococcus, Saccharothrix, and
Streptomyces
Alternaria, Cladosporium,
Microsporum, and Penicillium
16S rRNA gene sequencing/
microscope and 18S
rRNA gene sequencing
Turkey (82)
Sahara
Arthrobacter, Agrococcus, Bacillus,
Curtobacterium, Duganella,
Kocuria, Massilia, and
Microbacterium
Acremonium, Alternaria,
Cladosporium, Fusarium,
Microsporum, Penicillium, and
Trichophyton
16S rRNA gene sequencing/
microscope and 18S
rRNA gene sequencing
Turkey (82)
Middle East
ND
Alternaria, Aspergillus, Cladosporium,
Coleophoma, Fusarium, Libertella,
Lophiostoma, Penicillium, Phoma,
and Zygosporium
NA/microscope
Israel (207)
Sahara
Acinetobacter, Agrococcus,
Arthrobacter, Aureobacterium,
Bacillus, Corynebacterium,
Deinococcus, Dietzia, Gordonia,
Kocuria, Microbacterium,
Micrococcus, Paenibacillus,
Paracoccus, Planococcus,
Rhodococcus, Saccharococcus,
Staphylococcus, Streptomyces,
and Zoogloea
Cladosporium, Alternaria, and
Aspergillus
16S rRNA gene sequencing/
18S rRNA gene
sequencing
Mali, Africa (117)
Sahara/Sahel
Actinomyces, Bacillus,
Brevibacterium, Cellulomonas,
Frigoribacterium, Gordonia,
Kocuria, Lechevalieria,
Leifsonia, Lentzea,
Novosphingobium,
Pseudomonas, and
Staphylococcus
Alternaria, Cladosporium,
Dendryphion, Lojkania,
Lithothelium, Massaria, Myriangium,
Neotestudina, Penicillium, Phoma,
Setosphaeria, Stachybotrys,
Trichophyton, and Ulocladium
16S rRNA gene sequencing/
18S rRNA gene
sequencing
Tropical mid-Atlantic
ridge (83)
Sahara/Sahel
Actinosynnema, Afipia, Agrococcus,
Ancylobacter, Arthrobacter,
Bacillus, Bosea, Curtobacterium,
Frankiaceae, Fulvimaria,
Hymenobacter, Kocuria,
Kineococcus, Mesorhizobium,
Nocardioides, Paracoccus,
Propionibacterium,
Pseudomonas, Rhizobium,
Saccharothrix, Sphingomonas,
Sinorhizobium, Streptomyces,
and Taxeobacter
Acremonium, Aspergillus,
Aureobasidium, Bipolaris,
Chromelosporium, Chrysosporium,
Cladosporium, Coccodinium,
Cochliobolus, Geotrichum,
Gibberella, Microsporum,
Monocillium, Nigrospora,
Oidiodendron, Paecilomyces,
Penicillium, Pleospora, Rhizomucor,
Scytalidium, and Trichophyton
16S rRNA gene sequencing/
18S rRNA gene
sequencing
U.S. Virgin Islands
(78, 79)
Sahara/Sahel
Bacillus
ND
Microscope/NA
Sweden (20)
North of the Black Sea
Bacillus
Mycelia sterilia (unidentified imperfect
fungi with no known spore stage,
48% of isolates), Alternaria,
Arthrinium, Aspergillus,
Cladosporium, Curvularia,
Neurospora, Penicillium, and
Periconium
Microscope/microscope
Barbados (190)
Sahara/Sahel
ND
Fusarium, Aspergillus, Penicillium, and
Basipetospora
NA/microscope
Korea (261)
Gobi/Takla Makan
ND
Penicillium, Aspergillus, Nigrospora,
Arthrinium, Curvularia, Stemphylium
Cercospora, and Pithomyces
NA/microscope
Korea (256)
Gobi/Takla Makan
Continued on facing page
VOL. 20, 2007
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
463
TABLE 1—Continued
Bacterial genus/genera
ND
a
Fungal genera
Alternaria, Arthrinium, Aspergillus,
Botrytis, Cercospora, Cladosporium,
Curvularia, Drechslera, Fusarium,
Ganoderma, Nigrospora, Papulara,
Penicillium, Periconia, Pithomyces,
Stemphylium, and Ulocladium
Method of identification
(bacterial/fungal)
Location (reference)
Dust source region
NA/microscope
Taiwan (92)
Gobi/Takla Makan
All studies listed were culture based. ND, no data; NA, not applicable.
composition is determined by a number of factors, including
pH, temperature, elemental composition, and nutrient and
moisture content, members of other phyla also occur less frequently (67, 110). Pigments produced by desert soil taxa such
as Nostoc sp. and Scytonema sp. are believed to provide UV
shielding compared to less-pigmented community members
(21). Novel or rare actinomycetes (Citricoccus alkalitolerans,
Jiangella gansuensis, and species of Nocardiopsis and Saccharothrix) have been isolated from a number of desert soil samples collected in the deserts of both Africa and Asia (216, 267).
Similar to the potential hazards of life in the soil, atmospheric
sources of stress to airborne microorganisms include UV damage, desiccation (drying by wind), temperature (both low and
high temperatures depending on the tolerance range of an
organism), and atmospheric chemistry (humidity levels dependent on tolerance and oxygen radicals, etc.) (54, 76, 158).
Dust-borne transport of microorganisms, particularly over
aquatic environments, should be enhanced due to tolerable
humidity levels and attenuation of UV by the particle load of
the various dust clouds (78). NASA research has shown that
the particle load of large dust clouds can attenuate UV by
more than 50% (91).
Table 1 lists the genera identified in dust storm microbiology
studies as described below. While it would be interesting to
compare and contrast the diversity of isolates identified in each
study, it should be noted that some relied on microscopy for
identification while others employed molecular methods. It
should also be emphasized that all were culture-based studies
and few utilized like assays (i.e., collection and culture media,
etc.), which restricts the comparison of data.
Desert dust research in Kuwait, which focused on “military
personnel health protection,” identified 147 bacterial CFU,
which included representatives from 10 genera, by gas chromatographic analysis of fatty acid methyl esters and 16S rRNA
gene sequencing in settled dust (141). Seven genera were isolated from the atmosphere over Erdemli, Turkey, during Saharan dust events in March 2002, with the most prevalent being
species of Streptomyces (82). During a dust event of Middle
East origin that impacted the same location in October 2002,
species from eight genera were recovered, with the most prevalent belonging to the genus Kocuria (82). In Bamako, Mali,
Africa, Kellogg et al. identified a small subset of the observed
(n ⫽ 94 [by 16S rRNA gene sequencing]) airborne bacterial
isolates collected during four dust events and one nondust
event. These isolates were composed of 20 genera, and Bacillus
sp. represented 38% of the isolates, followed by Kocuria sp.
(12.8%), Planococcus sp.(8.5%), Saccharococcus sp. (7.4%),
and Micrococcus sp. (6.4%) (117). Twenty-five bacterial iso-
lates collected from the atmosphere over the mid-Atlantic
ridge (⬃15°N, 45°W) during periods of elevated African desert
dust concentrations consisted of 13 genera, with those dominant being Bacillus (32%), Gordonia (12%), and Staphylococcus (8%) (83). When African dust was visibly present in the
northern Caribbean air, a subset of isolates from various samples was identified by 16S rRNA gene sequences as consisting
of 25 genera (78, 79). The most dominant genera detected in
these samples were Microbacterium (14.4%), Sphingomonas
(7.2%), Bacillus (6.5%), and Streptomyces (4.0%). Eleven of
the isolates (closest GenBank neighbor) had previously been
identified in marine environments, demonstrating that aerosolized marine spray may adhere to dust particles as the clouds
move over marine environments (78, 79). The few other dust
storm-related studies devoted to the prevalence of bacteria in
atmospheric samples were based on the presence of spores (in
aerobic culture; i.e., species of Bacillus were identified) or
other cellular morphologies (19, 126, 190) or on only reported
CFU (39).
Concentrations of bacteria observed during dust storms are
noted in Table 2. Between April and November 1934, 30 flights
were conducted at altitudes of 0 to 7,772 m in the vicinity of
Boston, MA, to collect air samples for microbial analysis (187).
Flight 4 recovered samples at altitudes of 457 to 7,772 m at a
time when visibility was hampered by dust transported within
air masses from over the tropical Atlantic (area of the Sargasso
Sea). These samples resulted in the growth of 16 to 266 bacteria (overall average of the five samples, 144) and 11 to 43
fungi (overall average of five samples, 23) m⫺3 of air (187).
These CFU counts were by far the highest combined (bacterial
and fungal) counts for all of the flights (for the other 29 flights,
there were 137 samples yielding 0 to 138 bacterial CFU, average 14, and 0 to 267 fungal CFU, average 11). Flight 4 was the
only flight of the 30 to be affected by Transatlantic dust (187).
In Kansas, in 1935, numbers of bacteria on nutrient agar settle
plates exposed to dust storms ranged from 2,880 to 42,735 m⫺2
min⫺1 (23). Images of a clear-day petri dish and a dust storm
petri dish (both plates exposed to the atmosphere for 1.5 min.)
showed fewer than 10 colonies isolated on the clear day and
overgrowth on the dust storm plate (23). Atmospheric samples
collected by plane from three altitudes (365, 1,280, and 2,500
m) over Junction, TX, demonstrated that the highest concentrations of bacterial and fungal isolates occurred when dust
generated by frontal activity was present (66). Graph-based
data showed ⬎1,544 combined CFU m⫺3 at the 365-m altitude
versus ⬍450 combined CFU m⫺3 at each of the three altitudes
during normal/no-dust conditions. The lowest CFU collections
(⬍100 at each altitude) followed frontal precipitation events
464
GRIFFIN
CLIN. MICROBIOL. REV.
TABLE 2. Concentrations of culturable bacteria and fungi and fungal spores in dust storms
Sample site
(reference)
Dust storm source
Sampling methoda
Concnb (bacterial CFU m⫺3) (avg)
Background
Boston, MA (187)
Air mass from
over the
Sargasso Sea
Kansas (23)
Kansas
Junction, TX (66)
Texas
Saudi Arabia
(126)
Saudi Arabia
Mali (117)
Sahara/Sahel
Israel (207)
Sahara
Turkey (82)
Sahara/region
Tropical midAtlantic (15°N,
45°W) (83)
U.S. Virgin
Islands (78)
U.S. Virgin
Islands (79)
Barbados (190)
Sahara/Sahel
Sahara/Sahel
Korea (39)
Taiwan (92)
Taiwan (256)
Gobi/Takla Mahan
Gobi/Takla Mahan
Gobi/Takla Mahan
Sahara/Sahel
Sahara/Sahel
Oil-saturated lens
paper from a
plane; altitudes,
0–7,620 m
For background, 1.5
min; for dust
storms, 5- to 15-s
exposures of
nutrient agar
settle plates
Exposure of nutrient
agar plates from a
plane; altitudes,
365–2,500 m
Dust plate trap
followed by a
dilution method
(also 6-h nutrient
agar settle plate
counts)
⬍1 h, low-flow
rate; MF
25 min, 28.3 liters
min⫺1; Andersen
sampler
⬍1 h, low-flow
rate; MF
⬍1–12 h, low-flow
rate; MF
⬍1 h, low-flow
rate; MF
⬍1 h, low-flow
rate; MF
⬃24 h, low-flow
rate; MF
Andersen sampler
Spore trap
Spore trap
0–138 (14)
Dust
16–266 (144)
Photograph of one plate
with less than 10
colonies
⬍450 (avg) combined
bacterial and fungal
CFU; NS
2,880–42,735
⬎1,544 (avg) combined
bacterial and fungal
CFU; NS
1,892 ⫾ 325 (100⫻
increase over
background)
ND
200–1,100 (537)
720–15,700 (6,194)
Concnc (fungal CFU m⫺3) (avg)
Background
0–267 (11)
Dust
11–43 (23)
ND
ND
See bacterial concn
See bacterial concn
ND
869 ⫾ 75 (40⫻
increase over
background)
0–130 (62)
80–370 (195)
31–115 (73)
205–226 (215)
79–108 (93)
694–995 (844)
0–41* (3)
0–59† (6)
0–291* (25)
NA
0–24 (1)‡
NA
0–100 (12)
90–350 (203)
0–60 (15)
30–60 (48)
1–100 (13)
0–353 (80)
0–57 (13)
0–90 (31)
0–(⬃10) (NS)
0–(⬃20) (NS)
0–(⬃4) (NS)
0–(⬃16) (NS)
225–8,212 (1,642)
ND
ND
100–8,510 (1,702)
4,839
28,683
336–6,992 (1,398)
6,078
29,038
105–1,930 (386)
ND
ND
0–703† (66)
0–27 (3)‡
Low-flow rate, ⬍20 liters min⫺1; MF, membrane filtration.
Values for the Kansas study are bacterial cells per square meter per min. NA, not applicable due to some level of dust always being present; ND, no data; NS, not
specified (graph-based data); *, dust concentration below 12 ␮g m⫺3; †, dust concentration at or above 12 ␮g m⫺3; ‡, dust concentration above 6 ␮g m⫺3 at 10 m above
sea level.
c
Values for the Taiwan studies are mean numbers of spores per cubic meter. NA, not applicable due to some level of dust always being present; ND, no data; NS,
not specified (graph-based data); *, dust concentration below 12 ␮g m⫺3; †, dust concentration at or above 12 ␮g m⫺3; ‡, dust concentration above 6 ␮g m⫺3 at 10 m
above sea level.
a
b
(66). In Saudi Arabia, an increase of 100% over background
levels was observed during dust storms with a settle plate
technique. Kellogg et al. (117) reported background levels of
200 to 1,100 bacterial CFU m⫺3 in the atmosphere over Bamako, Mali, Africa, and dust condition levels ranging from 720
to 15,700 bacterial CFU m⫺3. During two Saharan dust events
impacting Israel’s atmosphere (January and April 2004), airborne bacteria averaged 844 CFU m⫺3, versus a 2-day background average of 93 CFU m⫺3, and ratios of total CFU
(bacteria and fungi) for dust days versus non-dust days were
similar to those reported by Griffin et al. in the Caribbean
(207). At Erdemli, Turkey, dust event bacterial concentrations
ranged from 0 to 59 CFU m⫺3 (average, 6), versus background
concentrations of 0 to 41 CFU m⫺3 (average, 3) (82). In the
northern Caribbean (⬃18°N), normal background concentrations of bacteria in air samples collected over the islands and
open water averaged 13.6 CFU m⫺3 (28 samples) (79). The
same study noted an increase in airborne bacterial CFU (average, 80.1 CFU m⫺3 [15 samples]) when African desert dust
was visibly present in the atmosphere, with the higher concen-
trations (average, 143.1 CFU m⫺3; n, 8) occurring during late
July and early August (79). Dust-borne microbial concentrations in the early summer (May, June, and early July) were not
distinguishable above normal background levels in this Caribbean research site (79). To determine if bacteria and fungi
being transported to the Caribbean in the early summer
months of May and June could be detected in air samples at a
site closer to the continent of Africa, a study was conducted
over the mid-Atlantic ridge at 15°N over a 6-week period (22
May to 30 June 2003). Results showed that bacterial CFU
ranged from 0.1 CFU to 23.7 CFU m⫺3 when culturable bacteria were recovered from the air samples (12 of 85 samples)
(83). The U.S. Navy’s Naval Aerosol Analysis and Prediction
System, an atmospheric model that can determine airborne
aerosol concentrations at various altitudes on a global scale
(94, 114, 196, 209), demonstrated that most of the microorganisms recovered in the mid-Atlantic study were recovered during periods of elevated aerosol (dust) concentrations (83). On
the island of Barbados, at ⬃13.1°N in the southern Caribbean,
African desert dust-borne bacterial CFU (morphological iden-
VOL. 20, 2007
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
465
tifications were via spore staining, and almost all were identified as Bacillus sp.) ranged from 0.0 to approximately 20.0 CFU
m⫺3, with the highest concentrations occurring primarily during the summer (190). During Asian dust events impacting air
quality in Taejon, Korea, the bacterial CFU concentration
increased on average 4.3 times over that observed under normal atmospheric conditions (39).
(78, 79, 82, 117). Concentrations of fungal CFU and spores
observed during dust storms at various geographical locations are noted in Table 2. In all cases, with the exception of
the data reported by Choi et al. (39) (Table 2), the presence
of desert dust in the atmosphere resulted in an increase in
the concentration of culturable fungi or fungal spores relative to background or clear atmospheric conditions.
Fungi
Viruses
The total number of fungal species has been estimated at
1.5 ⫻ 106, with approximately 7.4 ⫻ 104 to 1.2 ⫻ 105 having
been identified (89). The number of fungi typically found in a
gram of topsoil is approximately 106 (225). One of the genetic
advantages that fungi have over many other microorganisms is
that they are capable of producing spores. Spores enhance
survival during transport and periods of prolonged environmental stress. Fungal spores are egg-like vesicles covered with
a thin layer of hydrophobic proteins that provide protection
from physical stresses such as UV exposure and desiccation
(56). Viable fungi recovered from extreme altitudes in the
atmosphere have demonstrated the ability to survive harsh
conditions (77, 142, 143, 153, 200, 242). Mycological studies
conducted in desert environments have demonstrated that diverse communities exist in desert topsoils worldwide (1, 2, 9,
165, 218). An early review of outdoor airborne concentrations
of fungal spores reported that the highest concentrations typically occur in temperate and tropical regions (106 spores m⫺3
of air) and the lowest in desert environments (400 spores m⫺3
of air) (129).
In a survey of airborne fungi in the eastern and western
deserts of Egypt, 44 genera and 102 species (Aspergillus was
the dominant genus) were recovered, with the areas of highest fungal concentrations and diversity corresponding to
increases in vegetative cover and anthropogenic activity
(107). The most prevalent fungal genera in airborne dust
samples collected from the atmosphere of Taif, Saudi Arabia, were (31 genera and 70 species) Aspergillus, Drechslera,
Fusarium, Mucor, Penicillium, Phoma, and Stachybotrys, and
it was noted that genus prevalence was dependent on the
nutrient medium used (3). A similar study conducted in
Egypt identified 27 genera (64 species), and again, prevalence was determined by the nutrient medium employed (4).
While most studies have shown that desert environments
harbor diverse mycological communities, fungi such as Coccidioides immitis and Coccidioides posadasii are known to be
restricted geographically (the Americas in this case) (90). In
contrast to microbial studies of soil or air environments, far
fewer studies have been devoted to dust-borne transport of
microorganisms. Table 1 lists those fungal genera found in
dust storm studies where dust-associated isolates were identified to at least the genus level. Several studies, while identifying bacterial and or fungal isolates, did not distinguish
those recovered during clear versus dust conditions and thus
are not included in Table 1 (66, 187). As can be seen from
Table 1, the dust-associated fungal community is diverse,
and the true extent of diversity is probably much greater
given that some of the more recent studies, which used
molecular methods for identification, identified only a small
fraction of the cultured isolates due to budget constraints
Viral abundance in soil has been shown to occur at a
concentration of ⬃108 per gram (198, 252). Certain desert
soil characteristics (high temperatures, elemental composition [the ability of viruses to adsorb to soil particulates], soil
chemistry [pH], and moisture content) are known to impact
viral survival and thus community composition and concentration (260). Poliovirus and bacteriophage MS2 survival in
seeded desert soil samples was limited in the summer
months when temperatures of ⬃33.0°C and a decrease in
soil moisture content (from 40% to ⬍5%) were recorded (in
comparison to winter survival) (222). Low pH, low moisture,
and high concentrations of clay, cations, and total dissolved
solids have been shown to enhance virus survival by increasing adsorption of viruses to other soil constituents (99, 215,
260). As in soil, milder temperatures and moderate to high
humidity (50 to 80%, depending on the virus type) favor
viral survival in aerosols, with atmospheric transport over
open bodies of water (higher humidity versus that of overland environments) favoring long-range dispersion and infection (70, 104, 217). Bacteriophages that integrate their
genome into the host genome (prophage) may be more apt
to survive long-range atmospheric transport than are virulent phages (phages that directly replicate and lyse host cells
following infection and therefore do not benefit from the
shielding potential of a host cell). The scientific community
has yet to address this topic of research. Since prophages are
persistent in environmental bacterial populations and are
important vectors of bacterial virulence factors (and other
genomic material), these organisms may play an unforeseen
role in the global dispersion of prokaryotic genomic information through long-range atmospheric dispersion (30,
146). Viral transmission in aerosols (influenza viruses and
rhinoviruses, etc.) has been reviewed, and most of the documented cases have been limited to short-range laboratory
tests (animal and human hosts) or indoor studies in hospitals (206). Data referencing long-range transmission of infectious viruses have been obtained only with aerosol models (no field detection of the aerosolized virus) (206).
Several papers have hypothesized transoceanic movement
of viruses through the atmosphere based on favorable atmospheric conditions (i.e., wind patterns, mild temperatures) and incidence of disease (81, 87). One research
project that used a direct-count assay (use of a nucleic acid
stain to count microorganisms via epifluorescence microscopy) to
tabulate the number of virus-like particles in U.S. Virgin Island
atmospheric samples reported a background concentration of
1.8 ⫻ 104 m⫺3 and an African dust event concentration of 2.13 ⫻
105 m⫺3 (78). In summary, little research has been conducted to
address the naturally occurring populations of desert soil viral
communities, those viruses introduced by humans and other an-
466
GRIFFIN
CLIN. MICROBIOL. REV.
imals, or occurrence and survival issues associated with airborne
desert soils.
PATHOGENS
Bacteria
Culture-based dust-borne microbiological studies have established that a diverse bacterial community can move through
the atmosphere in clouds of desert dust, but no study has
demonstrated the movement of a prokaryote pathogen and
linked it to the occurrence of disease. The closest known associations of dust storms and human disease of microbial origin are the outbreaks of meningitis (primarily due to Neisseria
meningitidis infection) that occur within the “meningitis belt”
of North Africa (223). These outbreaks occur frequently in the
Sahel region of North Africa between (and within) the months
of February and May and affect as many as 200,000 individuals
annually (160, 223). The conditions during this period are
characterized as dry with frequent dust storms. Outbreaks usually cease with the onset of the wet season (160, 161). Dust
storms are believed to promote infection via dust particles
causing abrasions of the nasopharyngeal mucosa upon inhalation, allowing Neisseria meningitidis cells residing in the mucosa
access to underlying tissue and blood, thus initiating infection
(161). An additional and complementary hypothesis argues
that cells of Neisseria meningitidis associated with the inhaled
dust particulates are an alternate route of infection (80).
Five viable isolates of Neisseria meningitidis recently identified in settled-dust samples from Kuwait demonstrate that dust
can serve as a carrier for the pathogen (141). Other pathogens
were also identified in this project (141), including Staphylococcus aureus (wide range of infections), Bacillus circulans,
(opportunistic), Bacillus licheniformis (opportunistic, peritonitis), Pantoea agglomerans (opportunistic, peritonitis), Ralstonia
paucula, (opportunistic, septicemia, peritonitis, abscess, and
tenosynovitis), and Cryptococcus albidus (opportunistic, disseminated) (13, 122, 136, 140, 159, 179). Given the current
state of affairs in the Middle East, many of these opportunistic
dust-borne pathogens may play a significant role in human
health with regard to combat-related injuries, treatment, and
recovery.
Bacterial species that are known human pathogens have
been collected during dust events in Bamako, Mali (117). The
species include Acinetobacter calcoaceticus (nosocomial respiratory tract infections), Corynebacterium aquaticum (urinary
tract infections), Gordonia terrae (nervous system, skin), a
Kocuria sp. found in advanced noma lesions in Nigerian children, and Kocuria rosea (bacteremia) (10, 28, 55, 117, 147, 181,
226). Additionally, Acinetobacter calcoaceticus has been linked
to mad cow disease, and another isolate, Staphylococcus xylosus, was previously identified as the causative agent of septicemia in a loggerhead turtle in the Canary Islands (117, 229,
232). Of the 95 bacteria identified in this study, Kellogg et al.
reported that approximately 10% were potential animal pathogens, 5% were potential plant pathogens, and 25% were opportunistic human pathogens (117). In the African dust corridor over the mid-Atlantic ridge, two of the human pathogens
identified in the Mali dust study (83, 117), Kocuria rosea and
Gordonia terrae, were also recovered when elevated concentra-
tions of African dust were present in the atmosphere (83).
Furthermore, atmospheric dust-borne bacteria isolated in this
mid-Atlantic study that are recognized as pathogens included
Brevibacterium casei (opportunistic, sepsis) and Staphylococcus
epidermidis (opportunistic, endocarditis, urinary tract infections) (22, 254). In the atmosphere over the U.S. Virgin Islands, the opportunistic pathogen Pseudomonas aeruginosa,
which can cause fatal infections in burn patients, was isolated
when African dust was present (79). Additionally, identified
microorganisms found in a Nigerian noma lesion study were
also isolated (GenBank closest neighbor similarities: Kocuria
sp., 97%; Microbacterium arborescens, 98%; Sphingomonas sp.,
96%) (79). At Erdemli, Turkey, Kocuria rosea, Corynebacterium aquaticum (opportunistic, urinary tract infections, sepsis),
and Massilia timonae (which has been isolated from the blood
of an immunocompromised patient) were isolated during dust
events (82, 133, 162, 226). Other desert dust studies included
isolates of Bacillus, although no specific species-level pathogenic identifications were made (20, 190).
The bacterial endotoxin LPS can also directly impact human
health via inhalation (205). LPS is a cell wall component of
gram-negative bacteria and is commonly found in organic dusts
(240). Human and animal inhalation trials have shown increases in neutrophils and lymphocytes with a reduction in
alveolar macrophage phagocytosis (205). Short-term exposure
can result in fever and reduced airflow. Long-term exposure
can result in the development of lung diseases such as asthma,
bronchitis, and irreversible airflow obstruction (240). Since
gram-negative bacteria are dominant in marine waters, aerosolized marine bacteria that adhere to traversing dust particles
may enhance dust cloud toxicity and affect human health in
coastal environments that are typically impacted by significant
quantities of desert dust. African dust reaches coastal communities in Europe, the Middle East, the Caribbean, and the
Americas. Asian dust reaches Korea, Taiwan, Okinawa, Japan,
regional islands, the Artic, and North America. Approximately
half of the bacteria found in African dust studies conducted in
the Caribbean were gram-negative bacteria. Given the volume
of annual African dust exposure, LPS may contribute to the
high incidence of asthma in the region (79, 96). Sea spray
generation in near-shore environments may also produce elevated humidity levels in near-surface atmospheric layers, which
can both concentrate and “rain out” dust-borne pathogens and
toxins, thus increasing exposure and risk.
It is obvious from the few dust-borne microbiology studies
that have identified pathogenic bacteria that there is some
degree of human health risk associated with exposure to airborne desert dust. While most of the pathogens identified to
date are opportunistic in nature, these are but a small number
of culture-based studies, and as in most outbreaks of disease it
is often the young, old, and immunocompromised who are
within the higher levels of risk. These few studies provide a
glimpse of risk evidence and highlight the need for non-culture-based assays to advance this field of study.
Fungi
In 1941 several air fields were established in the
southern San Joaquin Valley. Coccidioidal infection
was recognized to be a hazard, but it was preferred to
VOL. 20, 2007
the hazards of mountains and fog in alternative locations. During the first year clouds of dust billowed
over the fields, and a quarter of the susceptible personnel became infected. C. E. Smith, appointed consultant to the Secretary of War, proposed rigid dust
control measures. Roads were paved, air strips were
hard-surfaced, and swimming pools were substituted
for dusty athletic fields. Lawns were planted by the
acre, and military personnel were ordered, at risk of
court martial, to avoid unprotected areas as much as
possible (64).
467
Acremonium, Alternaria, Arthrinium, Aspergillus, Cladosporium,
Curvularia, Emericella, Fusarium, Nigrospora, Paecilomyces,
Pithomyces, Phoma, Penicillium, Torula, Trichophyton, and Ulocladium). Outside of human disease, an outbreak of aspergillosis was documented in a captive locust population (⬃40% of
the population) in Bikaner, India, following a dust storm (239).
Sahara/Sahel dust storms have also been identified as longrange transport mechanisms for the pathogen responsible for
the Caribbean region-wide outbreak of Aspergillus infections
(A. sydowii) in seafans (213, 245). The long-range atmospheric
dispersal of fungal crop pathogens has been well documented.
Brown and Hovmøller present a review of those data (24).
Viruses
Transport of infectious human viruses in dust storms has not
been investigated. Hammond et al. hypothesized that longrange transport of human influenza virus from Asia to the
Americas could occur in the winter months given the prevailing
wind patterns over the Pacific and the low dose of virus required for infection (87). With the annual peak of the Asian
dust season occurring in March and April, the attachment of
infectious viruses to dust particles moving across the Pacific
may serve to enhance long-range host-to-host transport, as
virus survival studies (water and air based) have shown a relationship between particle association/attachment and enhanced survival (41, 45, 128, 194). Obviously, short-range
transmission (person to person) of infectious viruses such as
the influenza viruses and rhinoviruses is an evolved means of
movement. Short-range atmospheric transmission via dried
aerosolized rodent excreta (dust) is the primary route of hantavirus infection, and elevated risk has been documented in the
arid American southwest during droughts that follow El Niño
events (59). Evidence of longer-range transmission (building to
building) of the severe acute respiratory syndrome virus has
been documented (262), but what about even longer-range
transmission? Is there a range limit with various human viral
pathogens that are transmitted through the air? How does the
limit vary between viral pathogens, and what is the evidence
that long-range transmission occurs?
In livestock populations, dust storms have been identified as
a possible source of foot-and-mouth disease virus outbreaks
that occurred in Korea and Japan. Some of the outbreaks
followed Gobi/Takla Makan dust events (115, 175, 203). Although two studies (115, 175) screened dust samples for the
presence of foot-and-mouth disease virus by reverse transcriptase PCR (⬎400 samples) with no positive results, the authors
suggested additional testing before ruling out the transmission
route. Griffin et al. hypothesized that foot-and-mouth disease
virus outbreaks in Europe could result from long-range transmission in African dust based on the similarity of endemic
(Africa) and outbreak serotypes, dust events and outbreak
occurrences, and a favorable atmospheric route (over water)
(81). Evidence of regional (European) airborne transmission
of foot-and-mouth disease virus to downwind locations within
the United Kingdom, from France across the English Channel
to the United Kingdom, and from Germany over the Baltic Sea
to Denmark, has been well documented (51, 69, 71, 72, 157,
217). Using an atmospheric model and inputting optimal climate and topography, Sorensen et al. estimated that 1,000 pigs
V
The most well-known human pathogen associated with
desert dust storms is the fungus Coccidioides immitis (64). This
fungus has been found only in the Americas. Annual outbreaks
following dust storms (the primary means of exposure) or dust
clouds generated from natural disasters or anthropogenic activity (e.g., earthquakes and construction, etc.) are well documented (90, 113, 178, 208). An outbreak at a Naval Air Station
in California following a large dust storm event resulted in a
coccidioidomycosis incidence rate of 36 per 100,000 for personnel classified as white and 254 per 100,000 for those classified as nonwhite, indicating differences in racial susceptibility
(250). In Arizona, an increase in annual cases from 33 per
100,000 in 1998 to 43 per 100,000 in 2001 was attributed to
climate change (increased wind speed and drought), with peak
periods occurring in the winter and the age group at highest
risk being those ⱖ65 years old (33, 178). Of 128 studied cases
of coccidioidomycosis that occurred between 1 September and
31 December 1991 in Tulare County, CA, males, Asians and
blacks, and those over 20 years old were identified as the
highest risk groups (57). In addition to wind-generated dust
storms, an outbreak of coccidioidomycosis resulting in 203
cases and three fatalities followed exposure from earthquakegenerated dust clouds (208). Between 1991 and 1993, medical
expenses associated with outbreaks were estimated at $66 million (113).
While no other fungal outbreaks in human populations have
been attributed to dust storm exposure, the cited fungal prevalence studies in desert soils and dust storms have demonstrated diverse communities composed of both nonpathogenic
and pathogenic genera and species. In most of these studies,
only a fraction of the observed culturable community was identified, or the methods employed for identification, such as
morphological or spore identification, limited the ability to
identify pathogenic species. As a result, research has produced
only an indication of the true community structure in any of
the dust source regions. While they have yet to be identified in
dust storm studies, fungal pathogens such as Histoplasma capsulatum, the causative agent of histoplasmosis, often associated
with exposure to dust originating from dried bird or bat feces,
are certainly a potential risk factor (31, 164). Table 3 lists the
dust storm studies in which fungal CFU or spores have been
identified, the genera known to contain pathogenic species,
and, where information was available, the pathogenic species.
Information available on these genera indicates that most are
cosmopolitan in nature. These pathogenic or opportunistic
pathogens are known to cause a wide range of human diseases
(mild to fatal disseminating infections). Some of the fungi in
Table 3 are known to be mild or potent allergens (species of
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
468
GRIFFIN
CLIN. MICROBIOL. REV.
TABLE 3. Fungi capable of affecting humansa
Organism
Location(s) (reference关s兴)b
Dust source region(s)
Miscellaneous informationc
Disease(s)d
Mycetoma (colonization of
tissue/bone), onychomycosis
(colonization of nail),
mycotic keratitis, a number
of different allergen-related
disease types in the
immunocompromised
Cutaneous phaeohyphomycosis
(colonization of skin), potent
allergen (common cause of
extrinsic asthma)-related
disease, deep tissue infections
in the immunocompromised
Phaeohyphomycosis
Acremonium
USVI, Turkey (82, 83)
Sahara/Sahel,
Middle East
Common in soil, on plants,
and indoors
Alternaria
Mali, Africa, mid-Atlantic,
Barbados, Taiwan, Saudi
Arabia, Israel, Turkey
(82, 83, 92, 117, 126, 190,
207, 256)
Sahara/Sahel, Gobi/
Takla Makan,
Middle East
Common in soil, on plants,
and indoors
Alternaria infectoria
Turkey (82)
Sahara
Arthrinium
Barbados (190)
Sahara/Sahel
Aspergillus
Mali, Africa, USVI,
Barbados, Taiwan, Saudi
Arabia, Israel (79, 83, 92,
117, 126, 207)
Sahara/Sahel, Gobi/
Takla Makan,
Saudi Arabia
Common environmental
isolate
Common environmental
isolate
Common in soil, organic
detritus, and indoors
Aspergillus clavatus
Barbados (190)
Sahara/Sahel
Aspergillus flavus
Barbados, Israel (190, 207)
Sahara/Sahel
Aspergillus
fumigatus
Aspergillus niger
Barbados, Israel (190, 207)
Sahara/Sahel
Sahara/Sahel
Aspergillus terreus
Mali, Africa, Barbados,
Israel (117, 190, 207)
Barbados (190)
Sahara/Sahel
Aspergillus ustus
Israel (207)
Saharan
Aspergillus
versicolor
Aureobasidium
Mali, Africa, Israel (117,
207)
Mid-Atlantic, USVI (79,
83)
Sahara/Sahel
Bipolaris
USVI (79)
Sahara/Sahel
Cladosporium
Mali, Africa, mid-Atlantic,
USVI, Barbados, Taiwan,
Saudi Arabia, Turkey
(78, 79, 82, 83, 92, 117,
126, 256)
Sahara/Sahel, Gobi/
Takla Makan,
Middle East
Most commonly isolated
fungus in outdoor
studies
Cladosporium
cladosporioides
Cladosporium
sphaerospermum
Chrysosporium
Mali, Africa, USVI, Israel
(78, 117, 207)
Israel (207)
Sahara/Sahel
Sahara
USVI (79)
Sahara/Sahel
Curvularia
Taiwan, Barbados (92)
Gobi/Takla Makan
Common
isolate
Common
isolate
Common
isolate
Common
isolate
Emericella nidulans
Mid-Atlantic (83)
Sahara/Sahel
Fusarium
Taiwan, Turkey (82, 92,
256)
Gobi/Takla Makan,
Middle East
Common in tropical and
subtropical environments
Common soil and indoor
isolate
Microsporum
USVI, Turkey (79, 82)
Sahara/Sahel,
Middle East
Some species are
geographically restricted
Sahara/Sahel
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Distributed in temperate
areas; common on plant
tissue and indoors
Common plant and indoor
isolate
environmental
environmental
environmental
environmental
Allergen-related disease
Aspergillosis (pulmonary
关allergic and colonizing兴,
disseminated, central nervous
system, cutaneous, nasalorbital, and iatrogenic), a
number of different allergenrelated disease types in the
immunocompromised
Invasive aspergillosis
Invasive aspergillosis
Invasive aspergillosis
Invasive aspergillosis
Invasive aspergillosis
Rare, invasive aspergillosis
Invasive aspergillosis
Cutaneous phaeohyphomycosis,
invasive disease in the
immunocompromised
Pansinusitis,
meningoencephalitis, chronic
pulmonary disease
Cutaneous phaeohyphomycosis,
chromoblastomycosis
(subcutaneous skin
infections), mycotic keratitis,
potent allergen-related
disease
Cutaneous phaeohyphomycosis,
chromoblastomycosis
Cutaneous phaeohyphomycosis,
chromoblastomycosis
Opportunistic, infecting brain,
nasal and skin tissue
Allergen-related disease,
opportunistic, pneumonia,
disseminated
Allergic alveolitis
Invasive cutaneous
(erythematous lesions and
nodules), systemic
granulomatous disease,
allergen-related disease
Dermatophytosis (i.e.,
ringworm)
Continued on facomg page
VOL. 20, 2007
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
469
TABLE 3—Continued
Organism
b
Location(s) (reference关s兴)
Dust source region(s)
Mortierella
Saudi Arabia (126)
Saudi Arabia
Mucor
Saudi Arabia (126)
Saudi Arabia
Neotestudina rosatii
Mid-Atlantic (83)
Sahara/Sahel
Nigrospora
USVI, Taiwan (79, 92, 256)
Paecilomyces
USVI (79)
Sahara/Sahel, Gobi/
Takla Makan
Sahara/Sahel
Pithomyces
Taiwan (92, 256)
Gobi/Takla Makan
Phoma
Pythium
Penicillium
Mid-Atlantic (83)
Saudi Arabia (126)
Mid-Atlantic, USVI,
Barbados, Taiwan, Saudi
Arabia, Turkey (79, 82,
83, 92, 126, 190, 256)
Turkey (82)
Sahara/Sahel
Saudi Arabia
Sahara/Sahel, Gobi/
Takla Makan,
Middle East
Israel (207)
Sahara
Penicillium
brevicompactum
Penicillium
chrysogenum
Penicillium
spinulosum
Phoma cava
Israel (207)
Sahara
Israel (207)
Sahara
Rhizomucor
USVI (79)
Sahara/Sahel
Stachybotrys
Mid-Atlantic (83)
Sahara/Sahel
Stemphylium
Torula
Taiwan (256)
Taiwan (92, 256)
Gobi/Takla Makan
Gobi/Takla Makan
Trichophyton
Mid-Atlantic, USVI,
Turkey (79, 82, 83)
Taiwan, Saudi Arabia (92,
126)
Sahara/Sahel,
Middle East
Gobi/Takla Makan,
Saudi Arabia
Mid-Atlantic (83)
Sahara/Sahel
Ulocladium
Ulocladium botrytis
Sahara
Miscellaneous informationc
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate; Africa, Australia,
India
Common in soil, organic
detritus, and indoors
Common in soil, organic
detritus, and indoors
Typically found on dead
plant detritus
Common plant pathogens
Common plant pathogen
Very common in
temperate regions,
common in soil and
indoors
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Common environmental
isolate
Commonly found in soil
and decaying plants
Common plant pathogens
Common environmental
isolate
Commonly found in soils
and indoors
Found in soil, on plants,
and in high-moisture
environments
Found in soil, on plants,
and in high-moisture
environments
Disease(s)d
Rare, cutaneous
Rare, opportunistic, pulmonary,
disseminating, cutaneous
Mycetoma
Allergen-related disease
Mycotic keratitis
paecilomycosis, pneumonia,
allergen-related disease
Allergen-related disease
Allergen-related disease
Pythiosis
Bronchopulmonary penicilliosis,
potent allergen-related
disease (hypersensitivity and
allergic alveolitis)
Rare, necrotic lung ball
Rare, endocarditis, necrotizing
pneumonia
Allergen-related disease
Subcutaneous
phaeohyphomycosis
Rare opportunistic, pulmonary,
disseminating, cutaneous
zygomycosis
Rare, toxin producer,
pulmonary
Phaeohyphomycosis
Allergen-related disease
Dermatophytosis, allergenrelated disease
Phaeohyphomycosis
Allergic alveolitis
a
The fungi were cultured and identified—to the species level, where the information was available—in atmospheric desert dust samples. Where no species is given,
disease information is relevant to pathogenic strains.
b
USVI, U.S. Virgin Islands.
c
See references 199 and 221.
d
See references 199 and 221 and http://www.doctorfungus.org.
Unknown Agents
knock two people down, for the static electricity from
the dusters was so strong. Ike Osteen’s life spans the
flu epidemic of 1918, the worst depression in American history, and a world war that ripped apart the
globe. Nothing compares to the black dusters of the
1930s, he says, a time when the simplest thing in
life—taking a breath—was a threat (58).
Cattle went blind and suffocated. When farmers
cut them open, they found stomachs stuffed with fine
sand. Horses ran madly against the storms. Children
coughed and gagged, dying of something the doctors
called “dust pneumonia.” In desperation, some families gave away their children. The instinctive act of
hugging a loved one or shaking someone’s hand could
Incidence of pneumonia of unknown etiology in populations
exposed to airborne desert dust storms has been reported
throughout the course of time (18, 23, 121, 174, 248). In the
American Dust Bowl era of the 1930s, the numbers of cases of
pneumonia were 50 to 100% higher during dust periods than
during previous low-dust years (23). In dust storm-impacted
regions around the Aral Sea, pneumonia rates are the highest
excreting foot-and-mouth disease virus could infect cattle located 300 km downwind (217). Modeling was also used to
demonstrate the 1988 atmospheric spread of pseudorabies virus between swine herds over an area of 150 km2 in Decatur
County, IN (40, 75).
470
GRIFFIN
CLIN. MICROBIOL. REV.
in the former USSR, and 50% of all childhood illnesses are
respiratory (105, 237). Pneumonia from dust storm exposure
has also been reported in the Middle East, especially those
cases pertaining to deployed military personnel (14, 34, 121,
214). Of 15,459 surveyed military personnel who were deployed in Afghanistan or Iraq during 2003 and 2004, 69.1%
reported some form of respiratory illness (204). Pneumonia
acquired from exposure to inorganic and organic material in
dust storms has been termed Al Eskan disease, Persian Gulf
syndrome, Persian Gulf War syndrome, Gulf War syndrome,
and desert dust pneumonitis (50, 109, 120, 121). In addition to
pneumonia, adverse health conditions reported by military
personnel who were deployed in the area include fatigue, fever,
respiratory stress, arthromyoneuropathy, and neurological impairment, and epidemiological studies demonstrated higher
prevalence in exposed/deployed groups than in controls (14,
50, 65, 86, 108, 116). In contrast, a number of studies designed
to identify the incidence of disease in deployed versus nondeployed groups noted no identifiable differences between the
groups (101, 106, 118, 134, 201). In China and the Himalayas,
studies have shown that indigenous populations in dust areas
have higher incidences of silicosis than do populations residing
in nondust or low-dust areas (173, 202, 259). Cell culture studies have demonstrated that dust storm constituents can inhibit
defense functions of alveolar macrophages and increase reactive oxygen species, causing DNA base damage (61, 186).
Mouse- and rat-based inhalation studies have shown that
desert dust causes increases in the levels of neutrophils, lymphocytes, eosinophils, interleukin-2 and -6, and tumor necrosis
factor alpha and that responses are dose dependent (102, 137).
DETECTION
One of the most striking characteristics of aerobiological
studies, and more specifically of the few on dust storm microbiology cited in this article, is the different techniques used to
collect and analyze air samples, as previously reviewed (27,
255). The only instances of dust storm microbiology research
that employed “like protocols” are those papers published by
the same research groups. Due to the drawbacks of various
collection and evaluation assays, comparisons of results among
studies that utilized different techniques can answer only the
most basic of questions: that, yes, a diverse community of
culturable bacteria and fungi is capable of surviving long-range
atmospheric transport in clouds of desert dust. The limited
number of dust-borne projects, in addition to the lack of a
recognized or standardized protocol, has and will impede progression in this field of study. Moreover, there is a clear need
for culture-independent analysis of dust-borne microbial communities (16S and 18S rRNA gene sequencing), without which
we will never be able to see the “big picture” (98). For a
comprehensive review of aeromicrobiology methods, see Buttner et al. (27).
Collection
Protocols that have been used to collect microorganisms in
the atmosphere include impaction, impingement, centrifugation, filtration, and gravity deposition (27, 54, 219). Gravity
deposition is one of the simplest methods of collecting air-
borne microorganisms and involves exposing nutrient agar to
an open-air environment for some period of time. The benefits
of this protocol are that it is inexpensive and cell death from
impaction is insignificant, and yet it has been shown to be an
unacceptable method in comparison to volumetric assays (26,
76). Impaction of microorganisms onto surfaces such as tape,
nutrient agar, or hard surfaces coated with an adhesive fluid
such as oil is commonly utilized for the collection of airborne
microorganisms. Exposure of a petri dish containing nutrient
agar or a small metal surface coated with glycerol to an air
stream has been used to collect airborne microorganisms from
aircraft for morphological identification of airborne biological
constituents or culture-based studies (77, 152, 154, 155). While
a reliable estimate can be made of the volume of air sampled
based on the collector surface area, air speed, and time exposed, particle capture on the surfaces can be negatively influenced by wind speed, impactor shape, and presentation angle
(collector surface angle to wind/flight direction) (76). Impaction of spores or pollen onto adhesive tape via an air pumpdriven system such as a Burkard spore trap (Burkard Manufacturing Co. Ltd., Rickmansworth, United Kingdom) is an
efficient means of obtaining total counts of fungal spores (and
identifications based on spore morphology), as demonstrated
by Ho et al. and Wu et al. in their Taiwan-based Asian dust
studies (92, 256). The primary limitations of spore traps are
restricted use in the analysis of other microbial types (bacteria
and viruses) and the fact that morphology-based identifications
are limited to genus level classification.
Another method of impaction is the use of an air pump to
move air over the surface of a petri dish (cassettes and strips
are also used) containing nutrient agar. Airflow over nutrient
agar is controlled by slits or holes that are arranged to distribute the airflow evenly over the agar surface and in some cases
to control for particle size ranges. Numerous companies manufacture air pump devices, including the portable handheld
Millipore M Air T Air Tester (Millipore Corporation, Bedford,
MA) and the popular Andersen six-stage sampler (Andersen
6-STG; Graseby Andersen, Smyrna, GA) (12; K. R. Lentine,
N. Le, J. Lemonnier, A. Entzmann, and M. Pickett, presented
at the 99th General Meeting of the American Society for
Microbiology, Chicago, IL, 30 May to 3 June 1999). The benefits of these types of samplers are ease of use, portability, cost,
assessment of culturable populations of bacteria and fungi per
volume of air, and, as in the case of the Andersen 6-STG-type
sampler, the ability to determine the numbers of microorganisms associated with various size ranges of airborne particulates. Drawbacks to the use of these impactors are loss of
viability due to impact stress, loss of recovery efficiency due to
microorganisms not adhering to agar surfaces, low sample volumes due to low flow rates, and low recovery of ultrafine
biological matter in the size range of viruses (220). Centrifugation has been used to collect microorganisms on container
walls, wet or dry slides, or nutrient agar (petri dishes and strips,
etc.) (249, 251, 257). The benefits of centrifugal concentration
are the use of high flow rates (⬎100 liters min⫺1) and efficient
capture (251). The drawback of this method is the loss of
viability due to impaction stress (257).
Impingement of microorganisms into a liquid matrix (via
bubbling) is another method of capture used in aeromicrobiology (7, 27, 227). A widely used liquid impinger is the AGI-30
VOL. 20, 2007
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
(Ace Glass Inc., Vineland, NJ), which utilizes a low flow rate to
bubble air through a liquid matrix. Research has shown that
the AGI-30 is a low-cost and efficient method of collecting
aerosolized microorganisms for culture- and non-culturebased analyses (227). However, this impinger is constructed of
glass and can be easily broken in the rigors of field studies.
High-flow-rate liquid impinger units have been developed to
detect low concentrations of microorganisms in the atmosphere and have also been utilized for culture- and non-culture-based analyses for the presence of bacteria, fungi, and
viruses (17). The benefit of using liquid impingers for aeromicrobiology studies is that the liquid matrix can be split for
various analyses to include media cultures, direct counts, molecular assays, and cell cultures. The drawbacks of liquid impingement include the low capture rate of some low-flow-rate
impingers (the use of large-bore air lines and, thus, large bubble production in the liquid matrix), high cost (high-flow-rate
impingers), loss of collection fluid to evaporation and violent
bubbling (some of the high-flow-rate impingers limit this loss),
low capture rate of virus-sized particles, and loss of viability
(i.e., viral inactivation due to bubbling) (6).
Membrane filtration in which air is pumped through a porous membrane is also utilized in aeromicrobiology and has
been used by a number of researchers in desert dust microbiology (27, 78, 79, 83, 117, 190). This method can be employed
for both culture- and non-culture-based studies, is inexpensive,
can be portable, and is highly efficient at trapping microorganisms larger than the pore size on the filter surface (111, 145).
Filters commonly utilized for collection include cellulosebased, nylon, and glass fibers with pore sizes down to 0.02 ␮m
(for viral analysis) (78). The drawbacks of filtration include
desiccation of the microorganisms on the filter surface due to
filtration rate and time (higher flow rates and longer filtration
times), the preferential concentration of spore-forming microbes over other community members as non-spore formers
are desiccated during rapid or long filtration times (culturebased studies), filter size (37 mm versus 47 mm; i.e., larger
diameters limit stacking of cells in a high particle load environment), and filter type (a thicker filter can wick nutrients to
cells, thereby limiting close-contact nutrient shock of stressed
cells) (27, 83, 111, 150, 231).
In regard to these currently used methods of recovery, use of
a high-volume liquid impinger for aeromicrobiology studies in
general is the most versatile and arguably one of the most
efficient capture methods available. While the capture efficiency of virus-range particles is a concern with today’s machines, virus-based analyses are still possible. Furthermore,
advances in technology should enhance the capture of all microbial size fractions and at the same time allow what no other
isolation assay currently does: rapid large-volume sampling for
the full suite of microbial types and the ability to split a single
sample for multiple analyses.
Identification
Microorganisms collected in samples (soil, aquatic, air, and
clinical, etc.) are characterized by culture-based assays (for
CFU counts and identification via substrate utilization) and/or
non-culture-based assays (morphology-based identification;
cell, spore, physiological, and nucleic acid stains; identification
471
via nucleic acid amplification and/or hybridization; immunological identification; direct counts; and fatty-acid analysis).
Usually, in any environment, less than 1.0% of the bacterial
community is culturable under the most favorable (low-stress)
conditions, and thus any data obtained from this approach are
limited in regard to community composition (11). For culturebased studies of airborne microorganisms, particularly in the
case of long-range transport studies in which a majority of the
community may be stressed by desiccation, temperature, and
UV exposure, selection of a nutrient source and incubation
temperature that will maximize recovery is critical. It is known
that both nutrient and temperature shock can negatively impact the ability to culture stressed bacteria (197). Numerous
studies comparing low-nutrient broths or agars (diluted highnutrient recipes or low-nutrient recipes such as Reasoner’s 2
agar [R2A]) have shown superior recovery rates of culturable
bacteria versus rates with high-nutrient agars in different settings (water, air, soil, and serum, etc.) (15, 95, 112, 149, 195,
238). The incubation temperature can significantly impact culturability (in general, a temperature close to the environmental
temperature from which the sample was taken gives better
recoveries), and most dust-borne culture-based studies have
used moderate temperatures for growth (⬃23.0°C [room temperature]) (43, 79, 83, 117, 170, 185, 190). Several nutrientbased identification assays, such as the Analytab System (Analytab Products, Syosset, NY) and BioLog plates (Hayward,
CA), are utilized in environmental studies. Although these are
low-cost assays, they are subject to variation (i.e., reproducibility issues due to variation in cell densities and physiological
state, etc.) and false-positive results (previously unclassified
organisms producing similar or like carbon utilization patterns) (25, 119, 135). Recent advances in culture technology,
such as the employment of single-cell encapsulation into microdroplets containing naturally occurring nutrients, have
demonstrated improved recovery rates and hold promise for
future studies (264).
Microscopy is one of the oldest tools used for the study of
bacteria and fungi. Identifications or descriptions are based on
staining characteristics, cellular morphology, spore shape, the
presence or absence of spores, and pigmentation. At the microscopic level, many organisms cannot be identified, due to
similarities among species and genera and to significant differences in the education and experience of the investigator.
Species- and strain-specific identifications are possible with the
use of immunological (antigen-specific antibodies tagged with
a reporter) and genetic (i.e., fluorescence in situ hybridization
[FISH]) tools, as well as direct-count assays and physiological
studies using nucleic acid or cellular stains, respectively (37, 48,
172, 183, 228, 241). Whereas stains that utilize direct-count
assays are invaluable in assessing total cell counts in a sample,
certain cells are known to resist staining, and similar-sized
particles that are not cells may take up the stain, resulting in
false-positive counts (27). Another limitation is that more than
104 cells per sample are required for useful data (27). The
result is that microscopic methods can be prone to error. Such
methods also require expertise and can be time-consuming
(27).
Although sequence-based identification assays, such as those
using oligonucleotides (dot blot assays and FISH, etc.), have
served microbial ecologists well, the invention of nucleic acid
472
GRIFFIN
amplification protocols such as PCR and nucleic acid sequence-based amplification has enabled researchers to assess
community composition at the strain level efficiently and to
detect organisms in the community that occur in very low
numbers (42, 167, 182). Nucleic acid amplification methods
target regions of conserved genes, such as those found in the
ribosomal genes, for use in identification (42, 167). Once the
target gene is amplified, the community amplicon can be evaluated with ecology-based gene chips or through the classical
approach of clone library production and analysis (35, 253).
Several other widely used types of postamplification analysis
include denaturing gradient gel electrophoresis and temperature gradient gel electrophoresis (168). These assays produce a
microbial community fingerprint that can be analyzed with
specific group probes for individual band identification, or
individual bands can be excised and sequenced directly. The
primary benefits of PCR-based assays are ease of use as DNA
and RNA extraction kits, PCR amplification kits, cloning kits,
the availability of commercial sequencing facilities, and information on the community (culturable and nonculturable) are
obtained. The primary drawbacks are the cost of cloning kits,
the required expertise in sequence interpretation, debate
among mycologists on the appropriateness of relying on DNA
sequences alone to identify fungi, and the lack of a universal
gene for virus ecology (211).
Phospholipid ester-linked fatty acid and intact phospholipid
profiling can also be utilized to identify bacteria and fungi in
both culture- and non-culture-based studies via unique lipid
structures (63, 132, 246). The benefits of these assays are that
they address viable biomass due to rapid phospholipid turnover (63, 246). The drawbacks are costs of analysis, overlapping profiles, biomass to cell count conversion, and compositional shift from variance in growth conditions (63).
With the rapid progression of technology, new and emerging
tools, such as optical tweezers, phylogenic gene chips, chip use
in cross-hybridization studies, cellular circuits, mass spectrometry, and the miniaturization of existing equipment, should
greatly enhance our understanding of dust-borne microbial
ecology through availability, affordability, adaptation, and use
(38, 60, 123, 151, 171, 230, 253).
CONCLUSIONS AND PERSPECTIVES
Two common misconceptions are that desert soils are too
inhospitable to host a diverse microbial community and that
those microorganisms that are present cannot withstand the
physical stresses (UV, desiccation, temperature) of atmospheric transport. Research in the twentieth and twenty-first
centuries has shown that microorganisms mobilized into the
atmosphere along with desert soils are capable of surviving
long-range transport on a global scale. As with the betterknown pathogens that use aerosolization to move from host to
host (Bacillus anthracis, Yersinia pestis, Mycobacterium tuberculosis, Legionella pneumophila, Histoplasma capsulatum, influenza viruses, and rhinoviruses, etc.), the microbiological
research conducted to date has identified a wide range of
dust-borne pathogenic microorganisms that move great distances through the atmosphere. In light of the few dust-oriented studies outlined in Table 2, which are based only on
culture or spore-counting techniques, it is clear that we have
CLIN. MICROBIOL. REV.
only begun to grasp the true numbers of microorganisms capable of using the atmosphere as an infectious route or as a
means of extending the limit of their dispersion.
The prime question, of course, is related to risk: do microorganisms in dust clouds pose a risk to human health? The
evidence of outbreaks of coccidiomycosis following dust storm
exposure in the Americas demonstrates risk. Outside of this
example, the risk from other pathogenic microorganisms is
unknown, due to the limited number of studies and study
design (all to date have been culture based, and none have
been risk oriented). While some of the dust storm microbiology studies cited in this review have identified pathogenic microorganisms, information relative to concentrations over a
realistic period of exposure does not exist, nor do we know the
full extent of fate and survival issues as they relate to geographical variance and seasonal influences. The adaptation of existing and emerging molecular techniques will give us a clearer
understanding in future studies. We need non-culture-based
studies to advance this field in regard to issues in microbial
ecology, biogeography, pathogen prevalence (fungal, bacterial,
and viral), epidemiology, bacteria as carriers of potentially
harmful genetic elements (i.e., phage related), microbial fate
and survival, and risk. Integrated and global-scale collaborations need to be advocated and supported to allow multiple
purchases of appropriate equipment (i.e., high-volume liquid
impingers) for “true” matched studies in source and downwind
environments. We also do not know what roles the synergistic
influences of the many different constituents of dust play in
human health. How does exposure to dust storms differ between source regions? When individuals who have never been
exposed to desert environments (or dust storms) visit them (or
are deployed in them), how is their health impacted in both the
short and long terms? With the advent of the industrial age and
the resulting widespread use and release of anthropogenic
chemicals and emissions, are modern dust clouds more of a
health threat than those that blew around the planet before the
influence of humanity? How will climate change influence dust
emissions and their associated microbial communities? The
questions are many.
As if this point has not been made enough, I close this review
with a quotation from a paper published by Fred C. Meier and
Charles A. Lindbergh in 1935:
While it is generally known that bacteria, spores of
higher fungi and pollen grains are present among
dust particles in the atmosphere near the earth’s surface, much detailed information of practical value
remains to be revealed by further research (154).
ACKNOWLEDGMENT
The use of trade names is for descriptive purposes only and does not
imply endorsement by the U.S. Government.
REFERENCES
1. Abdel-Hafez, S. I. I. 1982. Cellulose-decomposing fungi of desert soils in
Saudi Arabia. Mycopathologia 78:73–78.
2. Abdel-Hafez, S. I. I. 1982. Survey of the mycoflora of desert soils in Saudi
Arabia. Mycopathologia 80:3–8.
3. Abdel-Hafez, S. I. I., and A. A. M. Shoreit. 1985. Mycotoxins producing
fungi and mycoflora of air-dust from Taif, Saudi Arabia. Mycopathologia
92:65–71.
4. Abdel-Hafez, S. I. I., A. A. M. Shoreit, A. I. I. Abdel-Hafez, and M. O. E.
Maghraby. 1986. Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt. Mycopathologia 93:25–32.
VOL. 20, 2007
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
473
PCR template concentration on the composition and distribution of total
community 16S rDNA clone libraries. Mol. Ecol. 6:475–482.
Chang, C. C., I. M. Lee, S. S. Tsai, and C. Y. Yang. 2006. Correlation of
Asian dust storm events with daily clinic visits for allergic rhinitis in Taipei,
Taiwan. J. Toxicol. Environ. Health A 69:229–235.
Chen, F., J.-R. Lu, B. J. Binder, Y.-C. Liu, and R. E. Hodson. 2001.
Application of digital image analysis and flow cytometry to enumerate
marine viruses stained with SYBR gold. Appl. Environ. Microbiol. 67:539–
545.
Cho, J. C., and J. M. Tiedje. 2000. Biogeography and degree of endemicity
of fluorescent Pseudomonas strains in soil. Appl. Environ. Microbiol. 66:
5448–5456.
Choi, D. S., Y. K. Park, S. K. Oh, H. J. Yoon, J. C. Kim, W. J. Seo, and S. H.
Cha. 1997. Distribution of airborne microorganisms in yellow sands of
Korea. J. Microbiol. 35:1–9.
Christensen, L. S., S. Mortensen, A. Botner, B. S. Strandbygaard, L. Ronsholt, C. A. Henricksen, and J. B. Anderson. 1993. Further evidence of long
distance airborne transmission of Aujeszky’s disease (pseudorabies) virus.
Vet. Rec. 132:317–321.
Chung, H., and M. D. Sobsey. 1993. Comparative survival of indicator
viruses and enteric viruses in seawater and sediment. Water Sci. Technol.
27:425–428.
Compton, J. 1991. Nucleic acid sequence-based amplification. Nature 350:
91–92.
Connon, S. A., and S. J. Giovannoni. 2002. High-throughput methods for
culturing microorganisms in very-low-nutrient media yield diverse new marine isolates. Appl. Environ. Microbiol. 68:3878–3885.
Cook, A. G., P. Weinstein, and J. A. Centeno. 2005. Health effects of natural
dust—role of trace elements and compounds. Biol. Trace Element Res.
103:1–15.
Cox, C. 1995. Stability of airborne microbes and allergens, p. 77–99. In C. S.
Cox and C. M. Wathes (ed.), Bioaerosols handbook. Lewis Publishers,
London, United Kingdom.
Daigle, C. C., D. C. Chalupa, F. R. Gibb, P. E. Morrow, G. Oberdorster,
M. J. Utell, and M. W. Frampton. 2003. Ultrafine particle deposition in
humans during rest and exercise. Inhal. Toxicol. 15:539–552.
Delfino, R. J., C. Sioutas, and S. Malik. 2005. Potential role of ultrafine
particles in associations between airborne particle mass and cardiovascular
health. Environ. Health Perspect. 113:934–946.
DeLong, E. F., L. T. Taylor, T. L. Marsh, and C. M. Preston. 1999. Visualization and enumeration of marine planktonic archaea and bacteria by
using polyribonucleotide probes and fluorescent in situ hybridization. Appl.
Environ. Microbiol. 65:5554–5563.
Reference deleted.
Doebbeling, B. N., W. R. Clarke, D. Watson, J. C. Torner, R. F. Woolson,
M. D. Voelker, D. H. Barrett, and D. A. Schwartz. 2000. Is there a Persian
Gulf War syndrome? Evidence from a large population-based survey of
veterans and nondeployed controls. Am. J. Med. 108:695–704.
Donaldson, A. I., and S. Alexandersen. 2002. Predicting the spread of foot
and mouth disease by airborne virus. Rev. Sci. Technique Off. Int. Epizoot.
21:569–575.
Donaldson, K., V. Stone, A. Seaton, and W. MacNee. 2001. Ambient particle inhalation and the cardiovascular system: potential mechanisms. Environ. Health Perspect. 109:523–527.
Dose, K., A. Bieger-Dose, B. Ernst, U. Feister, B. Gomez-Silva, A. Klein, S.
Risi, and C. Stridde. 2001. Survival of microorganisms under the extreme
conditions of the Atacama Desert. Orig. Life Evol. Biosph. 31:287–303.
Dowd, S. E., and R. M. Maier. 2000. Aeromicrobiology. Academic Press,
San Diego, CA.
Drancourt, M., J. Pelletier, A. A. Cherif, and D. Raoult. 1997. Gordona
terrae central nervous system infection in an immunocompetent patient.
J. Clin. Microbiol. 35:379–382.
Dufrene, Y. F. 2000. Direct characterization of the physicochemical properties of fungal spores using functionalized AFM probes. Biophys. J. 78:
3286–3291.
Durry, E., D. Pappagianis, S. B. Werner, L. Hutwagner, R. K. Sun, M.
Maurer, M. M. McNeil, and R. W. Pinner. 1997. Coccidioidomycosis in
Tulare County, California, 1991: reemergence of an endemic disease. Med.
Mycol. 35:321–326.
Egan, T. 2006. The worst hard time. Houghton Mifflin Company, New
York, NY.
Engelthaler, D. M., D. G. Mosley, J. E. Cheek, C. E. Levy, K. K. Komatsu,
P. Ettestad, T. Davis, D. T. Tanda, L. Miller, J. W. Frampton, R. Porter,
and R. T. Bryan. 1999. Climatic and environmental patterns associated with
hantavirus pulmonary syndrome, Four Corners Region, United States.
Emerg. Infect. Dis. 5:87–94.
Ericsson, M., D. Hanstorp, P. Hagberg, J. Enger, and T. Nystrom. 2000.
Sorting out bacterial viability with optical tweezers. J. Bacteriol. 182:5551–
5555.
Ezeamuzie, C. I., M. U. Beg, and D. Al-Ajmi. 1998. Responses of alveolar
macrophages to post-Gulf War airborne dust from Kuwait. Environ. Int.
24:213–220.
7
5. Abrahams, P. W. 2002. Soils: their implications to human health. Sci. Total
Environ. 291:1–32.
6. Agranovski, I. E., A. S. Safatov, A. I. Borodulin, O. V. Pyankov, V. A.
Petrishchenko, A. N. Sergeev, A. P. Agafonov, G. M. Ignatiev, A. A. Sergeev,
and V. Agranovski. 2004. Inactivation of viruses in bubbling processes
utilized for personal bioaerosol monitoring. Appl. Environ. Microbiol. 70:
6963–6967.
7. Agranovski, I. E., A. S. Safatov, O. V. Pyankov, A. A. Sergeev, A. N. Sergeev,
and S. A. Grinshpun. 2005. Long-term sampling of viable airborne viruses.
Aerosol Sci. Technol. 39:912–918.
8. Al Frayh, A. R., Z. Shakoor, M. O. G. E. Rab, and S. M. Hasnain. 2001.
Increased prevalence of asthma in Saudi Arabia. Ann. Allergy Asthma
Immunol. 86:292–296.
9. al-Musallam, A. A. 1989. Distribution of keratinophilic fungi in desert soil
of Kuwait. Mycoses 32:296–302.
10. Altuntas, F., O. Yildiz, B. Eser, K. Gundogan, B. Sumerkan, and M. Cetin.
2004. Catheter-related bacteremia due to Kocuria rosea in a patient undergoing peripheral blood stem cell transplantation. BMC Infect. Dis. 4:62.
11. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev. 59:143–169.
12. Andersen, A. A. 1958. New sampler for the collection, sizing, and enumeration of viable airborne particles. J. Bacteriol. 76:471–484.
13. Archer, G. L. 1998. Staphylococcus aureus: a well-armed pathogen. Clin.
Infect. Dis. 26:1179–1181.
14. Aronson, N. E., J. W. Sanders, and K. A. Moran. 2006. In harm’s way:
infection in deployed American military forces. Clin. Infect. Dis. 43:1045–
1051.
15. Azevedo, N. F., A. P. Pacheco, C. W. Keevil, and M. J. Vieira. 2004. Nutrient
shock and incubation atmosphere influence recovery of culturable Helicobacter pylori from water. Appl. Environ. Microbiol. 70:490–493.
16. Bener, A., Y. M. Abdulrazzaq, J. Al-Mutawwa, and P. Debuse. 1996. Genetic and environmental factors associated with asthma. Hum. Biol. 68:405–
414.
17. Bergman, W., J. Shinn, R. Lochner, S. Sawyer, F. Milanovich, and R.
Milanovich, Jr. 2005. High volume, low pressure drop, bioaerosol collector
using a multi-slit virtual impactor. J. Aerosol Sci. 36:619–638.
18. Blue, J. A. 1938. Dust—its effect on man from a medical standpoint with
special reference to the dust bowl. Southern Med. J. 31:1101–1106.
19. Bovallius, A., B. Bucht, R. Roffey, and P. Anas. 1978. Long-range air
transmission of bacteria. Appl. Environ. Microbiol. 35:1231–1232.
20. Bovallius, A., R. Roffey, and E. Henningson. 1980. Long range transmission
of bacteria. Ann. N. Y. Acad. Sci. 353:186–200.
21. Bowker, M. A., S. C. Reed, J. Belnap, and S. L. Phillips. 2002. Temporal
variation in community composition, pigmentation, and Fv/Fm of desert
cyanobacterial soil crusts. Microb. Ecol. 43:13–25.
22. Brazzola, P., R. Zbinden, C. Rudin, U. B. Schaad, and U. Heininger. 2000.
Brevibacterium casei sepsis in an 18-year-old female with AIDS. J. Clin.
Microbiol. 38:3513–3514.
23. Brown, E. G., S. Gottlieb, and R. L. Laybourn. 1935. Dust storms and their
possible effect on health. Public Health Rep. 50:1369–1383.
24. Brown, J. K. M., and M. S. Hovmoeller. 2002. Aerial dispersal of pathogens
on the global and continental scales and its impact on plant disease. Science
297:537–541.
25. Butler, D. A., C. M. Lobregat, and T. L. Gavan. 1975. Reproducibility of the
Analytab (API 20E) system. J. Clin. Microbiol. 2:322–326.
26. Buttner, M. P., and L. D. Stetzenbach. 1993. Monitoring airborne fungal
spores in an experimental indoor environment to evaluate sampling methods and the effects of human activity on air sampling. Appl. Environ.
Microbiol. 59:219–226.
27. Buttner, M. P., K. Willeke, and S. A. Grinshpun. 1997. Sampling and
analysis of airborne microorganisms, p. 629–640. In C. J. Hurst, G. R.
Knudsen, M. J. McInerney, L. D. Stetzenbach, and M. V. Walter (ed.),
Manual of environmental microbiology. ASM Press, Washington, DC.
28. Buxton, A. E., R. L. Anderson, D. Werdegar, and E. Atlas. 1978. Nosocomial respiratory tract infection and colonization with Acinetobacter calcoaceticus. Epidemiologic characteristics. Am. J. Med. 65:507–513.
29. Caimi, P., and A. Eisenstark. 1986. Sensitivity of Deinococcus radiodurans
to near-ultraviolet radiation. Mutat. Res. 162:145–151.
30. Canchaya, C., C. Proux, G. Fournous, A. Bruttin, and H. Brussow. 2003.
Prophage genomics. Microbiol. Mol. Biol. Rev. 67:238–276.
31. Cano, M. V., and R. A. Hajjeh. 2001. The epidemiology of histoplasmosis:
a review. Semin. Respir. Infect. 16:109–118.
32. Carlton, C. A., F. Westall, and R. T. Schelble. 2001. Importance of a
Martian hematite site for astrobiology. Astrobiology 1:111–123.
33. Centers for Disease Control and Prevention. 2003. Increase in coccidioidomycosis—Arizona, 1998–2001. Morbid. Mortal. Wkly. Rep. 52:109–112.
34. Centers for Disease Control and Prevention. 2003. Severe acute pneumonitis among deployed U.S. military personnel—southwest Asia, March–
August 2003. Morbid. Mortal. Wkly. Rep. 290:1845–1846.
35. Chandler, D. P., J. K. Fredrickson, and F. J. Brockman. 1997. Effect of
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
474
GRIFFIN
62. Ezeamuzie, C. I., M. S. Thomson, S. Al-Ali, A. Dowaisan, M. Khan, and Z.
Hijazi. 2000. Asthma in the desert: spectrum of the sensitizing aeroallergens. Allergy 55:157–162.
63. Fang, J., M. J. Barcelona, and P. J. J. Alvarez. 2000. A direct comparison
between fatty acid analysis and intact phospholipid profiling for microbial
identification. Org. Geochem. 31:881–887.
64. Fiese, M. J. 1958. Coccidioidomycosis. Charles C. Thomas, Springfield, MA.
65. Fukuda, K., R. Nisenbaum, B. Stewart, W. W. Thompson, L. Robin, R. M.
Washko, D. L. Noah, D. H. Barrett, B. Randall, B. L. Herwaldt, A. C.
Mawle, and W. C. Reeves. 1998. Chronic multisymptom illness affecting Air
Force veterans of the Gulf War. JAMA 280:981–988.
66. Fulton, J. D. 1966. Microorganisms of the upper atmosphere. V. Relationship between frontal activity and the micropopulation at altitude. Appl.
Environ. Microbiol. 14:245–250.
67. Gans, J., M. Wolinsky, and J. Dunbar. 2005. Computational improvements
reveal great bacterial diversity and high metal toxicity in soil. Science
309:1387–1390.
68. Gillies, J. A., W. G. Nickling, and G. H. McTainsh. 1996. Dust concentrations and particle-size characteristics of an intense dust haze event: Inland
Delta region, Mali, West Africa. Atmosph. Environ. 30:1081–1090.
69. Gloster, J. 1982. Risk of airborne spread of foot-and-mouth disease from
the continent to England. Vet. Rec. 111:290–295.
70. Gloster, J., and S. Alexandersen. 2004. New directions: airborne transmission of foot-and-mouth disease virus. Atmosph. Environ. 38:503–505.
71. Gloster, J., R. M. Blackall, R. F. Sellers, and A. I. Donaldson. 1981.
Forecasting the airborne spread of foot-and-mouth disease. Vet. Rec. 108:
370–374.
72. Gloster, J., R. F. Sellers, and A. I. Donaldson. 1982. Long-distance transport of foot-and-mouth-disease virus over the sea. Vet. Rec. 110:47–52.
73. Goudie, A. S., and N. J. Middleton. 2001. Saharan dust storms: nature and
consequences. Earth Sci. Rev. 56:179–204.
74. Graham, W. F., and R. A. Duce. 1979. Atmospheric pathways of the phosphorus cycle. Geochim. Cosmochim. Acta 43:1195–1208.
75. Grant, R. H., A. B. Scheidt, and L. R. Rueff. 1994. Aerosol transmission of
a viable virus affecting swine: explanation of an epizootic of pseudorabies.
Int. J. Biometeorol. 38:33–39.
76. Gregory, P. H. 1961. The microbiology of the atmosphere. Leonard Hill
Books Ltd., London, United Kingdom.
77. Griffin, D. W. 2004. Terrestrial microorganisms at an altitude of 20,000 m
in Earth’s atmosphere. Aerobiologia 20:135–140.
78. Griffin, D. W., V. H. Garrison, J. R. Herman, and E. A. Shinn. 2001. African
desert dust in the Caribbean atmosphere: microbiology and public health.
Aerobiologia 17:203–213.
79. Griffin, D. W., C. A. Kellogg, V. H. Garrison, J. T. Lisle, T. C. Borden, and
E. A. Shinn. 2003. African dust in the Caribbean atmosphere. Aerobiologia
19:143–157.
80. Griffin, D. W., C. A. Kellogg, V. H. Garrison, and E. A. Shinn. 2002. The
global transport of dust. Am. Sci. 90:228–235.
81. Griffin, D. W., C. A. Kellogg, and E. A. Shinn. 2001. Dust in the wind:
long-range transport of dust in the atmosphere and its implications for
global public and ecosystem health. Global Change Hum. Health 2:20–33.
82. Griffin, D. W., N. Kubilay, M. Kocak, M. A. Gray, T. C. Borden, C. A.
Kellogg, and E. A. Shinn. 2007. Airborne desert dust and aeromicrobiology
over the Turkish Mediterranean coastline. Atmosph. Environ. 41:4050–
4062
83. Griffin, D. W., D. L. Westphal, and M. A. Gray. 2006. Airborne microorganisms in the African desert dust corridor over the mid-Atlantic ridge,
Ocean Drilling Program, leg 209. Aerobiologia 22:211–226.
84. Grousset, F. E., P. Ginoux, A. Bory, and P. E. Biscaye. 2003. Case study of
a Chinese dust plume reaching the French Alps. Geophys. Res. Lett. 30:
1277.
85. Gyan, K., W. Henry, S. Lacaille, A. Laloo, C. Lamesee-Eubanks, S. McKay,
R. M. Antoine, and M. A. Monteil. 2005. African dust clouds are associated
with increased paediatric asthma accident and emergency admissions on
the Caribbean island of Trinidad. Int. J. Biometeorol. 49:371–376.
86. Haley, R. W., T. L. Kurt, and J. Hom. 1997. Is there a Gulf War Syndrome?
Searching for syndromes by factor analysis of symptoms. JAMA 277:215–
222.
87. Hammond, G. W., R. L. Raddatz, and D. E. Gelskey. 1989. Impact of
atmospheric dispersion and transport of viral aerosols on the epidemiology
of influenza. Rev. Infect. Dis. 11:494–497.
88. Harrison, R. M., and J. X. Yin. 2000. Particulate matter in the atmosphere:
which particle properties are important for its effects on health? Sci. Total
Environ. 249:85–101.
89. Hawksworth, D. L. 2001. The magnitude of fungal diversity: the 1.5 million
species estimate revisited. Mycol. Res. 105:1422–1432.
90. Hector, R. F., and R. Laniado-Laborin. 2005. Coccidioidomycosis—a fungal disease of the Americas. PLoS Med. 2:e2.
91. Herman, J. R., N. Krotkov, E. Celarier, D. Larko, and G. Labow. 1999. The
distribution of UV radiation at the earth’s surface from TOMS measured
UV-backscattered radiances. Geophys. Res. 104:12059–12076.
92. Ho, H. M., C. Y. Rao, H. H. Hsu, Y. H. Chiu, C. M. Liu, and H. J. Chao.
CLIN. MICROBIOL. REV.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
2005. Characteristics and determinants of ambient fungal spores in Hualien, Taiwan. Atmosph. Environ. 39:5839–5850.
Holmes, C. W., and R. Miller. 2004. Atmospherically transported metals
and deposition in the southeastern United States: local or transoceanic?
Appl. Geochem. 19:1189–1200.
Honrath, R. E., R. C. Owen, M. V. Martin, J. S. Reid, K. Lapina, P. Fialho,
M. P. Dziobak, J. Kleissl, and D. L. Westphal. 2004. Regional and hemispheric impacts of anthropogenic and biomass burning emissions on summertime CO2 and O3 in the North Atlantic lower free troposphere. J.
Geophys. Res. doi:10.1029/2004JD005147.
Horgan, S. E., M. M. Matheson, L. McLoughlin-Borlace, and J. K. Dart.
1999. Use of a low nutrient culture medium for the identification of bacteria
causing severe ocular infection. J. Med. Microbiol. 48:701–703.
Howitt, M. E. 2000. Asthma management in the Caribbean—an update.
Postgrad. Doctor Caribb. 16:86–104.
Howitt, M. E., R. Naibu, and T. C. Roach. 1998. The prevalence of childhood asthma and allergy in Barbados. The Barbados National Asthma and
Allergy Study. Am. J. Respir. Crit. Care Med. 157:A624.
Hugenholtz, P., B. M. Goebel, and N. R. Pace. 1998. Impact of cultureindependent studies on the emerging phylogenetic view of bacterial diversity. J. Bacteriol. 180:4765–4774.
Hurst, C. J., C. P. Gerba, and I. Cech. 1980. Effects of environmental
variables and soil characteristics on virus survival in soil. Appl. Environ.
Microbiol. 40:1067–1079.
Husar, R. B., D. M. Tratt, B. A. Schichtel, S. R. Falke, F. Li, D. Jaffe, S.
Gasso, T. Gill, N. S. Laulainen, F. Lu, M. C. Reheis, Y. Chun, D. Westphal,
B. N. Holben, C. Gueymard, I. McKendry, N. Kuring, G. C. Feldman, C.
McClain, R. J. Frouin, J. Merrill, D. DuBois, F. Vignola, T. Murayama, S.
Nickovic, W. W. Wilson, K. Sassen, N. Sugimoto, and W. C. Malm. 2001.
Asian dust events of April 1998. J. Geophys. Res. Atmosph. 106:18317–
18330.
Hyams, K. C., J. Riddle, D. H. Trump, and J. T. Graham. 2001. Endemic
infectious diseases and biological warfare during the Gulf War: a decade of
analysis and final concerns. Am. J. Trop. Med. Hyg. 65:664–670.
Ichinose, T., M. Nishikawa, H. Takano, N. Sera, K. Sadakane, K. Mori, R.
Yanagisawa, T. Oda, H. Tamura, K. Hiyoshi, H. Quan, S. Tomura, and T.
Shibamoto. 2005. Pulmonary toxicity induced by intratracheal instillation of
Asian yellow dust (Kosa) in mice. Environ. Toxicol. Pharmacol. 20:48–56.
Ichinose, T., K. Sadakane, H. Takano, R. Yanagisawa, M. Nishikawa, I.
Mori, H. Kawazato, A. Yasuda, K. Hiyoshi, and T. Shibamoto. 2006. Enhancement of mite allergen-induced eosinophil infiltration in the murine
airway and local cytokine/chemokine expression by Asian sand dust. J.
Toxicol. Environ. Health A 69:1571–1585.
Ijaz, M. K., Y. G. Karim, S. A. Sattar, and C. M. Johnson-Lussenburg.
1987. Development of methods to study the survival of airborne viruses.
J. Virol. Methods 18:87–106.
Ismaelov, S., and S. Akhmedov. 1989. Prevalence and clinico-functional
diagnosis of chronic non specific diseases of the lungs among the rural
population of Uzbekistan. Prob. Tuberk. 6:19–21. (In Russian.)
Ismail, K., B. Everitt, N. Blatchley, L. Hull, C. Unwin, A. David, and S.
Wessely. 1999. Is there a Gulf War syndrome? Lancet 353:179–182.
Ismail, M. A., S. I. I. Abdel-Hafez, and A. M. Moharram. 2002. Aeromycobiota of western desert of Egypt. Afr. J. Sci. Technol. 3:1–9.
Jaenicke, R. 2005. Abundance of cellular material and proteins in the
atmosphere. Science 308:73.
Jamal, G. A., S. Hansen, F. Apartopoulos, and A. Peden. 1996. The “Gulf
War syndrome.” Is there evidence of dysfunction in the nervous system?
J. Neurol. Neurosurg. Psych. 60:449–451.
Janssen, P. H. 2006. Identifying the dominant soil bacterial taxa in libraries
of 16S rRNA and 16S rRNA genes. Appl. Environ. Microbiol. 72:1719–
1728.
Jensen, P. A., B. Lighthart, A. J. Mohr, and B. T. Shaffer. 1994. Instrumentation used with microbial bioaerosol, p. 226–284. In B. Lighthart and A. J.
Mohr (ed.), Atmospheric microbial aerosols: theory and applications.
Chapman and Hall, New York, NY.
Jensen, P. R., C. A. Kauffman, and W. Fenical. 1996. High recovery of
culturable bacteria from the surfaces of marine algae. Mar. Biol. 126:1–7.
Jinadu, B. A. 1995. Valley Fever Task Force report on the control of
Coccidioides immitis. Kern County Health Department, Kern County, CA.
Johnson, K. S., V. A. Elrod, S. E. Fitzwater, J. N. Plant, F. P. Chavez, S. J.
Tanner, R. M. Gordon, D. L. Westphal, K. D. Perry, J. Wu, and D. M. Karl.
2003. Surface ocean-lower atmosphere interactions in the Northeast Pacific
Ocean Gyre: aerosols, iron and the ecosystem response. Global Biogeochem. Cycles 17:1063.
Joo, Y. S., S. H. An, O. K. Kim, J. Lubroth, and J. H. Sur. 2002. Foot-andmouth disease eradication efforts in the Republic of Korea. Can. J. Vet.
Res. 66:122–124.
Kang, H. K., C. M. Mahan, K. Y. Lee, F. M. Murphy, S. J. Simmens, H. A.
Young, and P. H. Levine. 2002. Evidence for a deployment-related Gulf
War syndrome by factor analysis. Arch. Environ. Health 57:61–68.
Kellogg, C. A., D. W. Griffin, V. H. Garrison, K. K. Peak, N. Royall, R. R.
VOL. 20, 2007
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
Smith, and E. A. Shinn. 2004. Characterization of aerosolized bacteria and
fungi from desert dust events in Mali, West Africa. Aerobiologia 20:99–110.
Knoke, J. D., T. C. Smith, G. C. Gray, K. S. Kaiser, and A. W. Hawksworth.
2000. Factor analysis of self-reported symptoms: does it identify a Gulf War
syndrome? Am. J. Epidemiol. 152:379–388.
Konopka, A., L. Oliver, and R. F. Turko, Jr. 1998. The use of carbon
substrate utilization patterns in environmental and ecological microbiology.
Microb. Ecol. 35:103–115.
Korenyi-Both, A. L., A. L. Korenyi-Both, and D. J. Juncer. 1997. Al Eskan
disease: Persian Gulf syndrome. Military Med. 62:1–13.
Korenyi-Both, A. L., A. L. Kornyi-Both, A. C. Molnar, and R. Fidelus-Gort.
1992. Al Eskan disease: Desert Storm pneumonitis. Military Med. 157:452–
462.
Krause, A., F. K. Gould, and J. Forty. 1999. Prosthetic heart valve endocarditis caused by Bacillus circulans. J. Infect. 39:160–162.
Kuske, C. R. 2006. Current and emerging technologies for the study of
bacteria in the outdoor air. Curr. Opin. Biotechnol. 17:291–296.
Kuske, C. R., S. M. Barns, and J. D. Busch. 1997. Diverse uncultivated
bacterial groups from soils of the arid southwestern United States that are
present in many geographic regions. Appl. Environ. Microbiol. 63:3614–
3621.
Kwaasi, A. A. 2003. Date palm and sandstorm-borne allergens. Clin. Exp.
Allergy 33:419–426.
Kwaasi, A. A., R. S. Parhar, F. A. Al-Mohanna, H. A. Harfi, K. S. Collison,
and S. T. Al-Sedairy. 1998. Aeroallergens and viable microbes in sandstorm
dust. Potential triggers of allergic and nonallergic respiratory ailments.
Allergy 53:255–265.
Kwon, H. J., S. H. Cho, Y. Chun, F. Lagarde, and G. Pershagen. 2002.
Effects of the Asian dust events on daily mortality in Seoul, Korea. Environ.
Res. A 90:1–5.
Labelle, R., and C. P. Gerba. 1981. Investigations into the protective effect
of estuarine sediment on virus survival. Water Res. 16:469–478.
Lacey, J. 1981. Aerobiology of conidial fungi, vol. 1. Academic Press Inc.,
New York, NY.
Laden, F., L. M. Neas, D. W. Dockery, and J. Schwarz. 2000. Association of
fine particulate matter from different sources with daily mortality in six U.S.
cities. Environ. Health Perspect. 108:941–947.
Lancaster, N., R. Bamford, and S. Metzger. 1995. Field studies of the
potential for wind transport of plutonium—contaminated soils at sites in
areas 6 and 11, Nevada Test Site, p. 1–77. U.S. Department of Energy,
DOE/NV/10845-60.
Larsen, J., P. A. Olsson, and I. Jakobsen. 1998. The use of fatty acid
signatures to study mycelial interactions between the arbuscular mycorrhizal fungus Glomus intraradices and the saprotrophic fungus Fusarium culmorum in root-free soil. Mycol. Res. 102:1491–1496.
La Scola, B., R. J. Birtles, M. N. Mallet, and D. Raoult. 1998. Massilia
timonae gen. nov., sp. nov., isolated from blood of an immunocompromised
patient with cerebellar lesions. J. Clin. Microbiol. 36:2847–2852.
Lee, H. A., R. Gabriel, J. P. G. Bolton, A. J. Bale, and M. Jackson. 2002.
Health status and clinical diagnoses of 3000 UK Gulf War veterans. J. R.
Soc. Med. 95:491–497.
Lee, H. B., and N. Magan. 1999. Environmental factors and nutritional
utilization patterns affect niche overlap indices between Aspergillus ochraceus and spoilage fungi. Lett. Appl. Microbiol. 28:300–304.
Lee, Y. A., H. J. Kim, T. W. Lee, M. J. Kim, M. H. Lee, J. H. Lee, and C. G.
Ihm. 2004. First report of Cryptococcus albidus-induced disseminated cryptococcosis in a renal transplant recipient. Korean J. Intern. Med. 19:53–57.
Lei, Y. C., C. C. Chan, P. Y. Wang, C. T. Lee, and T. J. Cheng. 2004. Effects
of Asian dust event particles on inflammation markers in peripheral blood
and bronchoalveolar lavage in pulmonary hypertensive rats. Environ. Res.
95:71–76.
Lenes, J. M., B. P. Darrow, C. Cattrall, C. A. Heil, M. Callahan, G. A.
Vargo, R. H. Byrne, J. M. Prospero, D. E. Bates, K. A. Fanning, and J. J.
Walsh. 2001. Iron fertilization and the Trichodesmium response on the
West Florida shelf. Limnol. Oceanogr. 46:1261–1277.
Reference deleted.
Lim, P. S., S. L. Chen, C. Y. Tsai, and M. A. Pai. 2006. Pantoea peritonitis
in a patient receiving chronic ambulatory peritoneal dialysis. Nephrology
11:97–99.
Lyles, M. B., H. L. Fredrickson, A. J. Bednar, H. B. Fannin, and T. M.
Sobecki. 2005. The chemical, biological, and mechanical characterization of
airborne micro-particulates from Kuwait. Abstr. 8th Ann. Force Health
Protect. Conf., session 2586, Louisville, KY.
Lysenko, S. 1980. Resistance of microorganisms of upper layers of the
atmosphere to ultraviolet radiation and a high vacuum. Mikrobiologiia
49:175–177.
Lysenko, S., and N. S. Demina. 1992. Drying as one of the extreme factors
for the microflora of the atmosphere. J. Br. Interplanetary Soc. 45:39–41.
Maier, R. M., K. P. Drees, J. W. Neilson, D. A. Henderson, J. Quade, and
J. L. Betancourt. 2004. Microbial life in the Atacama Desert. Science
306:1289–1290.
Makino, S. I., H. I. Cheun, M. Watarai, I. Uchida, and K. Takeshi. 2001.
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
475
Detection of anthrax spores from the air by real-time PCR. Lett. Appl.
Microbiol. 33:237–240.
Marsh, P., and E. M. H. Wellington. 1994. Phage-host interactions in soil.
FEMS Microbiol. Ecol. 15:99–108.
Martin, T., D. J. Hogan, F. Murphy, I. Natyshak, and E. P. Ewan. 1991.
Rhodococcus infection of the skin with lymphadenitis in a nonimmunocompromised girl. J. Am. Acad. Dermatol. 24:328–332.
Martiny, J. B., B. J. Bohannon, J. H. Brown, R. K. Colwell, J. A. Fuhrman,
J. L. Green, M. C. Horner-Devine, M. Kane, J. A. Krumins, C. R. Kuske,
P. J. Morin, S. Naeem, L. Ovreas, A. L. Reysenbach, V. H. Smith, and J. T.
Staley. 2006. Microbial biogeography: putting microorganisms on the map.
Nat. Rev. Microbiol. 4:102–112.
Massa, S., M. Caruso, F. Trovatelli, and M. Tosques. 1998. Comparison of
plate count agar and R2A medium for enumeration of heterotrophic bacteria in natural mineral water. World J. Microbiol. Biotechnol. 14:727–730.
McFeters, G. A., S. C. Cameron, and M. W. LeChevallier. 1982. Influence
of diluents, media, and membrane filter on detection of injured waterborne
coliform bacteria. Appl. Environ. Microbiol. 43:97–103.
Medoro, G., N. Manaresi, A. Leonardi, L. Altomare, M. Tartagni, and R.
Guerrieri. 2003. A lab-on-a-chip for cell detection and manipulation. Sensors J. 3:317–325.
Meier, F. C. 1936. Collecting microorganisms from winds above the Caribbean Sea. Phytopathology 26:102.
Meier, F. C. 1936. Effects of conditions in the stratosphere on spores of
fungi. Natl. Geogr. Soc. Stratosph. Ser. 2:152–153.
Meier, F. C., and E. Artschwager. 1938. Airplane collections of sugar-beet
pollen. Science 88:507–508.
Meier, F. C., and C. A. Lindbergh. 1935. Collecting micro-organisms from
the arctic atmosphere. Sci. Monthly 40:5–20.
Middleton, N. J., and A. S. Goudie. 2001. Saharan dust: sources and trajectories. Trans. Inst. Br. Geogr. 26:165–181.
Mikkelsen, T., S. Alexandersen, P. Astrup, H. J. Champion, A. I. Donaldson, F. N. Dunkerley, J. Gloster, J. H. Sorensen, and S. Thykier-Nielsen.
2003. Investigation of airborne foot-and-mouth disease virus transmission
during low-wind conditions in the early phase of the UK 2001 epidemic.
Atmosph. Chem. Phys. 3:2101–2110.
Mohr, A. J. 1997. Fate and transport of microorganisms in air. ASM Press,
Washington, DC.
Moissenet, D., P. Bidet, A. Garbarg-Chenon, G. Arlet, and H. Vu-Thien.
2001. Ralstonia paucula (formerly CDC group IV c-2): unsuccessful strain
differentiation with PCR-based methods, study of the 16S-23S spacer of the
rRNA operon, and comparison with other Ralstonia species (R. eutropha, R.
pickettii, R. gilardii, and R. solanacearum). J. Clin. Microbiol. 39:381–384.
Molesworth, A. M., L. E. Cuevas, S. J. Conner, A. P. Morse, and M. C.
Thomson. 2003. Environmental risk and meningitis epidemics in Africa.
Emerg. Infect. Dis. 9:1287–1293.
Molesworth, A. M., L. E. Cuevas, A. P. Morse, J. R. Herman, and M. C.
Thomson. 2002. Dust clouds and spread of infection. Lancet 359:81–82.
Moore, C., and R. Norton. 1995. Corynebacterium aquaticum septicaemia in
a neutropenic patient. J. Clin. Pathol. 48:971–972.
Moreno, A., J. Targarona, J. Henderiks, M. Canals, T. Freudenthal, and H.
Meggers. 2001. Orbital forcing of dust supply to the North Canary Basin
over the last 250 kyr. Quaternary Sci. Rev. 20:1327–1339.
Morgan, J., M. V. Cano, D. R. Feikin, M. Phelan, O. V. Monroy, P. K.
Morales, J. Carpenter, A. Weltman, P. G. Spitzer, H. H. Liu, S. A. Mirza,
D. E. Bronstein, D. J. Morgan, L. A. Kirkman, M. E. Brandt, N. Iqbal,
M. D. Lindsley, D. W. Warnock, R. A. Hajjeh, and the Acapulco Histoplasmosis Working Group. 2003. A large outbreak of histoplasmosis among
American travelers associated with a hotel in Acapulco, Mexico, spring
2001. Am. J. Trop. Med. Hyg. 69:663–669.
Moubasher, A. H. 1993. Soil fungi in Qatar and other Arab countries.
Centre for Scientific and Applied Research, University of Qatar.
Moulin, C., C. E. Lambert, F. Dulac, and U. Dayan. 1997. Control of
atmospheric export of dust from North Africa by the North Atlantic Oscillation. Nature 387:691–694.
Mullis, K., F. Faloona, S. Scharf, R. Saiki, G. Horn, and H. Erlich. 1986.
Specific enzymatic amplification of DNA in vitro: the polymerase chain
reaction. Cold Spring Harbor Symp. Quant. Biol. 1:263–273.
Muyzer, G., and K. Smalla. 1998. Application of denaturing gradient gel
electrophoresis (DGGE) and temperature gradient gel electrophoresis
(TGGE) in microbial ecology. Antonie Leeuwenhoek 73:127–141.
Navarro-Gonzalez, R., F. A. Rainey, P. Molina, D. R. Bagaley, B. J. Hollen,
J. de la Rosa, A. M. Small, R. C. Quinn, F. J. Grunthaner, L. Caceres, B.
Gomez-Silva, and C. P. McKay. 2003. Mars-like soils in the Atacama
Desert, Chile, and the dry limit of microbial life. Science 302:1018–1021.
Nichols, C. M., J. P. Bowman, and J. Geuzennec. 2005. Effects of incubation
temperature on growth and production of exopolysaccharides by an Antarctic sea ice bacterium grown in batch culture. Appl. Environ. Microbiol.
71:3519–3523.
Nivens, D. E., T. E. McKnight, S. A. Moser, S. J. Osbourn, M. L. Simpson,
and G. S. Sayler. 2004. Bioluminescent bioreporter integrated circuits:
476
172.
173.
174.
175.
176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
186.
187.
188.
189.
190.
191.
192.
193.
194.
195.
196.
197.
GRIFFIN
potentially small, rugged and inexpensive whole-cell biosensors for remote
environmental monitoring. J. Appl. Microbiol. 96:33–46.
Noble, R. T., and J. A. Furman. 1998. Use of SYBR green I for rapid
epifluorescence counts of marine viruses and bacteria. Aquat. Microbiol.
Ecol. 14:113–118.
Norboo, T., P. T. Angchuk, M. Yahya, S. R. Kamat, F. D. Pooley, B. Corrin,
I. H. Kerr, N. Bruce, and K. P. Ball. 1991. Silicosis in a Himalayan village
population: role of environmental dust. Thorax 46:861–863.
O’Hara, S. L., G. F. S. Wiggs, B. Mamedov, G. Davidson, and R. B.
Hubbard. 2000. Exposure to airborne dust contaminated with pesticide in
the Aral Sea region. Lancet 355:627.
Ozawa, Y., B. L. Ong, and S. H. An. 2001. Traceback systems used during
recent epizootics in Asia. Rev. Sci. Technique Off. Int. Epizoot. 20:605–613.
Papastefanou, C., M. Manolopoulou, S. Stoulos, A. Ioannidou, and E.
Gerasopoulos. 2001. Coloured rain dust from Sahara Desert is still radioactive. J. Environ. Radioact. 55:109–112.
Papova, N. A., I. A. Nikolaev, T. P. Turova, A. M. Lysenko, G. A. Osipov,
N. V. Verkhovtseva, and N. S. Panikov. 2002. Geobacillus uralicus, a new
species of thermophilic bacteria. Mikrobiologiia 71:391–398.
Park, B. J., K. Sigel, V. Vaz, K. Komatsu, C. McRill, M. Phelan, T. Colman,
A. C. Comrie, D. W. Warnock, J. N. Galgiani, and R. A. Hajjeh. 2005. An
epidemic of coccidioidomycosis in Arizona associated with climatic
changes, 1998–2001. J. Infect. Dis. 191:1981–1987.
Park, D. J., J. C. Yun, J. E. Baek, E. Y. Jung, D. W. Lee, M. A. Kim, and
S. H. Chang. 2006. Relapsing Bacillus licheniformis peritonitis in a continuous ambulatory peritoneal dialysis patient. Nephrology 11:21–22.
Park, J. W., Y. H. Lim, S. Y. Kyung, C. H. An, S. P. Lee, S. H. Jeong, and
Y. S. Ju. 2005. Effects of ambient particulate matter on peak expiratory flow
rates and respiratory symptoms of asthmatics during Asian dust periods in
Korea. Respirology 10:470–476.
Paster, B. J., W. A. J. Falkler, C. O. Enwonwu, E. O. Idigbe, K. O. Savage,
V. A. Levanos, M. A. Tamer, R. L. Ericson, C. N. Lau, and F. E. Dewhirst.
2002. Prevalent bacterial species and novel phylotypes in advanced noma
lesions. J. Clin. Microbiol. 40:2187–2191.
Patterson, S. S., E. T. Casper, L. Garcia-Rubio, M. C. Smith, and J. H.
Paul. 2005. Increased precision of microbial RNA quantification using
NASBA with an internal control (IC-NASBA). J. Microbiol. Methods 60:
342–352.
Paul, J. H. 1982. Use of Hoechst dyes 33258 and 3342 for enumeration of
attached and planktonic bacteria. Appl. Environ. Microbiol. 43:939–944.
Perkins, S. 2001. Dust, the thermostat. Sci. News 160:200–201.
Pettersson, M., and E. Baath. 2003. Temperature-dependent changes in the
soil bacterial community in limed and unlimed soil. FEMS Microbiol. Ecol.
45:13–21.
Prahalad, A. K., J. Inmon, L. A. Dailey, M. C. Madden, A. J. Ghio, and J. E.
Gallagher. 2001. Air pollution particles mediated oxidative DNA base
damage in a cell free system and in human airway epithelial cells in relation
to particulate metal content and bioreactivity. Chem. Res. Toxicol. 14:879–
887.
Proctor, B. E. 1935. The microbiology of the upper air. J. Bacteriol. 30:
363–375.
Prospero, J. M. 1999. Long-range transport of mineral dust in the global
atmosphere: impact of African dust on the environment of the southeastern
United States. Proc. Natl. Acad. Sci. USA 96:3396–3403.
Prospero, J. M. 1999. Long-term measurements of the transport of African
mineral dust to the southeastern United States: implications for regional air
quality. J. Geophys. Res. 104:15917–15927.
Prospero, J. M., E. Blades, G. Mathison, and R. Naidu. 2005. Interhemispheric transport of viable fungi and bacteria from Africa to the Caribbean
with soil dust. Aerobiologia 21:1–19.
Prospero, J. M., and P. J. Lamb. 2003. African droughts and dust transport
to the Caribbean: climate change implications. Science 302:1024–1027.
Prospero, J. M., and R. T. Nees. 1986. Impact of the North African drought
and El Nino on mineral dust in the Barbados trade winds. Nature 320:735–
738.
Qian, W., L. Quan, and S. Shi. 2002. Variations of the dust storm in China
and its climatic control. J. Climate 15:1216–1229.
Rao, V. C., K. M. Seidel, S. M. Goyal, T. G. Metcalf, and J. L. Melnick.
1984. Isolation of enteroviruses from water, suspended solids, and sediments from Galveston Bay: survival of poliovirus and rotavirus adsorbed to
sediments. Appl. Environ. Microbiol. 48:404–409.
Reasoner, D. J., and E. E. Geldreich. 1985. A new medium for the enumeration and subculture of bacteria from potable water. Appl. Environ.
Microbiol. 49:1–7.
Reid, J. S., E. M. Prins, D. L. Westphal, C. C. Schmidt, K. A. Richardson,
S. A. Christopher, T. F. Eck, E. A. Reid, C. A. Curtis, and J. P. Hoffman.
2004. Real-time monitoring of South American smoke particle emissions
and transport using a coupled remote sensing/box-model approach. Geophys. Res. Lett. doi:10.1029/2203GL018845.
Reynolds, D. T., and C. R. Fricker. 1999. Application of laser scanning for
the rapid and automated detection of bacteria in water samples. J. Appl.
Microbiol. 86:785–795.
CLIN. MICROBIOL. REV.
198. Reynolds, K. A., and I. L. Pepper. 2000. Microorganisms in the environment, p. 585. In R. M. Maier, I. L. Pepper, and C. P. Gerba (ed.), Environmental microbiology. Academic Press, San Diego, CA.
199. Rippon, J. W. 1988. Medical mycology: the pathogenic fungi and the pathogenic actinomycetes, 3rd ed. W. B. Saunders Company, Philadelphia, PA.
200. Rogers, L. A., and F. C. Meier. 1936. The collection of microorganisms
above 36,000 feet. Natl. Geogr. Soc. Stratosph. Ser. 2:146–151.
201. Rook, G. A., and A. Zumla. 1997. Gulf War syndrome: is it due to a systemic
shift in cytokine balance towards a Th2 profile? Lancet 349:1831–1833.
202. Saiyed, H. N., Y. K. Sharma, H. G. Sadhu, T. Norboo, P. D. Patel, T. S.
Patel, K. Venkaiah, and S. K. Kashyap. 1991. Non-occupational pneumoconiosis at high altitude villages in central Ladakh. Br. J. Indian Med.
48:825–829.
203. Sakamoto, K., and K. Yoshida. 2002. Recent outbreaks of foot and mouth
disease in countries of East Asia. Rev. Sci. Technique Off. Int. Epizoot.
21:459–463.
204. Sanders, J. W., S. D. Putnam, C. Frankart, R. W. Frenck, M. R. Monteville,
M. S. Riddle, D. M. Rockabrand, T. W. Sharp, and D. R. Tribble. 2005.
Impact of illness and non-combat injury during operations Iraqi Freedom
and Enduring Freedom (Afghanistan). Am. J. Trop. Med. Hyg. 73:713–719.
205. Sandstrom, T., L. Bjermer, and R. Rylander. 1992. Lipopolysaccharide
(LPS) inhalation in health subjects increases neutrophils, lymphocytes and
fibronectin levels in bronchoalveolar lavage fluid. Eur. Respir. J. 5:992–996.
206. Sattar, S. A., and M. K. Ijaz. 1997. Airborne viruses, p. 682–692. In C. J.
Hurst, G. R. Knudsen, M. J. McInerney, L. D. Stetzenbach, and M. V.
Walter (ed.), Manual of environmental microbiology. ASM Press, Washington, DC.
207. Schlesinger, P., Y. Mamane, and I. Grishkan. 2006. Transport of microorganisms to Israel during Saharan dust events. Aerobiologia 22:259–273.
208. Schneider, E., R. A. Hajjeh, R. A. Spiegel, R. W. Jibson, E. L. Harp, G. A.
Marshall, R. A. Gunn, M. M. McNeil, R. W. Pinner, R. C. Baron, R. C.
Burger, L. C. Hutwagner, C. Crump, L. Kaufman, S. E. Reef, G. M.
Feldman, D. Pappagianis, and B. Werner. 1997. A coccidioidomycosis
outbreak following the Northridge, California earthquake. JAMA 277:904–
908.
209. Schollaert, S. E., J. A. Yoder, D. L. Westphal, and J. E. O’Reilly. 2003. The
influence of dust and sulfate aerosols on ocean color spectra and chlorophyll-a concentrations derived for SeaWiFS of the U.S. coast. J. Geophys.
Res. 108:3191.
210. Schwartz, J., G. Norris, T. Larson, L. Sheppard, C. Claiborne, and J.
Koenig. 1999. Episodes of high coarse particle concentrations are not associated with increased mortality. Environ. Health Perspect. 107:339–342.
211. Seifert, K. A., B. D. Wingfield, and M. J. Wingfield. 1995. A critique of
DNA sequence analysis in the taxonomy of filamentous ascomycetes and
ascomycetous anamorphs. Can. J. Botany 73:S760–S767.
212. Shinn, E. A., D. W. Griffin, and D. B. Seba. 2003. Atmospheric transport of
mold spores in clouds of desert dust. Arch. Environ. Health 58:498–504.
213. Shinn, E. A., G. W. Smith, J. M. Prospero, P. Betzer, M. L. Hayes, V.
Garrison, and R. T. Barber. 2000. African dust and the demise of Caribbean coral reefs. Geol. Res. Lett. 27:3029–3032.
214. Shoor, A. F., S. L. Scoville, S. B. Cersovsky, D. Shanks, C. F. Ockenhouse,
B. L. Smoak, W. W. Carr, and B. P. Petruccelli. 2004. Acute eosinophilic
pneumonia among US military personnel deployed in or near Iraq. JAMA
292:2997–3005.
215. Sobsey, M. D., C. H. Dean, M. E. Knuckles, and R. A. Wagner. 1980.
Interactions and survival of enteric viruses in soil materials. Appl. Environ.
Microbiol. 40:92–101.
216. Song, L., W. J. Li, Q. L. Wang, G. Z. Chen, Y. S. Zhang, and L. H. Xu. 2005.
Jiangella gansuensis gen. nov., sp. nov., a novel actinomycete from a desert
soil in north-west China. Int. J. Syst. Evol. Microbiol. 55:881–884.
217. Sorensen, J. H., D. K. J. Mackay, C. O. Jensen, and A. I. Donaldson. 2000.
An integrated model to predict the atmospheric spread of foot-and-mouth
disease virus. Epidemiol. Infect. 124:577–590.
218. States, J. S., and M. Christensen. 2001. Fungi associated with biological soil
crusts in desert grasslands of Utah and Wyoming. Mycologia 93:432–439.
219. Stetzenbach, L. D., M. P. Buttner, and P. Cruz. 2004. Detection and
enumeration of airborne biocontaminants. Curr. Opin. Biotechnol. 15:170–
174.
220. Stewart, S. L., S. A. Grinshpun, K. Willeke, S. Terzieva, V. Ulevicius, and
J. Donnelly. 1995. Effect of impact stress on microbial recovery on an agar
surface. Appl. Environ. Microbiol. 61:1232–1239.
221. St. Germain, G., and R. Summerbell. 1996. Identifying filamentous fungi.
Star Publishing Company, Belmont, CA.
222. Straub, T. M., I. L. Pepper, and C. P. Gerba. 1993. Virus survival in sewage
sludge amended desert soil. Water Sci. Technol. 27:421–424.
223. Sultan, B., K. Labadi, J. F. Guegan, and S. Janicot. 2005. Climate drives the
meningitis epidemics onset in West Africa. PLoS Med. 2:e6.
224. Swap, R., M. Garstang, S. Greco, R. Talbot, and P. Kallberg. 1992. Saharan
dust in the Amazon Basin. Tellus 44:133–149.
225. Tate, R. L., III. 2000. Soil microbiology, 2nd ed. John Wiley and Sons, Inc.,
New York, NY.
226. Tendler, C., and E. J. Bottone. 1989. Corynebacterium aquaticum urinary
VOL. 20, 2007
227.
228.
229.
230.
231.
232.
233.
234.
235.
236.
237.
238.
239.
240.
241.
242.
243.
244.
245.
246.
tract infection in a neonate, and concepts regarding the role of the organism
as a neonatal pathogen. J. Clin. Microbiol. 27:343–345.
Terzieva, S., J. Donnelly, V. Ulevicius, S. A. Grinshpun, K. Willeke, G. N.
Stelma, and K. P. Brenner. 1996. Comparison of methods for detection and
enumeration of airborne microorganisms collected by liquid impingement.
Appl. Environ. Microbiol. 62:2264–2272.
Thrane, C., S. Olsson, T. H. Nielsen, and J. Sorensen. 1999. Vital fluorescent stains for detection of stress in Pythium ultimum and Rhizoctonia
solani. FEMS Microbiol. Ecol. 30:11–23.
Tiwana, H., C. Wilson, J. Pirt, W. Cartmell, and A. Ebringer. 1999. Autoantibodies to brain components and antibodies to Acinetobacter calcoaceticus are present in bovine spongiform encephalopathy. Infect. Immun.
67:6591–6595.
Tobias, H. J., M. P. Schafer, M. Pitesky, D. P. Fergenson, J. Horn, M.
Frank, and E. E. Gard. 2005. Bioaerosol mass spectrometry for rapid
detection of individual airborne Mycobacterium tuberculosis H37Ra particles. Appl. Environ. Microbiol. 71:6086–6095.
Tobin, R. S., P. Lomax, and D. J. Kushner. 1980. Comparison of nine
brands of membrane filter and the most-probable-number methods for total
coliform enumeration in sewage-contaminated drinking water. Appl. Environ. Microbiol. 40:186–191.
Torrent, A., S. Deniz, P. Calabuig, and J. Oros. 2000. Septicemia due to
Staphylococcus xylosis in a loggerhead sea turtle (Caretta caretta). www.vet
.uga.edu/esp/IVCVM/Oros1/.
Torsvik, V., J. Goksoyr, and F. L. Daae. 1990. High diversity in DNA of soil
bacteria. Appl. Environ. Microbiol. 56:782–787.
Torsvik, V., L. Ovreas, and T. F. Thingstad. 2002. Prokaryotic diversity—
magnitude, dynamics, and controlling factors. Science 296:1064–1066.
Tucker, C. J., and S. E. Nicholson. 1999. Variations in the size of the Sahara
Desert from 1980 to 1997. Ambio 28:587–591.
Tyndall, J. 1882. Essays on the floating-matter of the air in relation to
putrefaction and infection. Johnson Reprint Corporation (1966), New
York, NY.
United Nations Development Program. 1997. Turkmenistan: human development report 1996. United Nations Development Program, Ashgabat,
Turkmenistan.
van der Linde, K., B. T. Lim, J. M. M. Rondeel, L. P. M. T. Antonissen, and
G. M. T. de Jong. 1999. Improved bacteriological surveillance of haemodialysis fluids: a comparison between Tryptic soy agar and Reasoner’s 2A
media. Nephrol. Dialysis Transplant. 14:2433–2437.
Venkatesh, M. V., K. R. Joshi, S. C. Harjai, and I. N. Ramdeo. 1975.
Aspergillosis in desert locust (Schistocerka gregaria Forsk). Mycopathologia
57:135–138.
Vernooy, J. H. J., M. A. Dentener, R. J. van Suylen, W. A. Buurman, and
E. F. M. Wouters. 2002. Long-term intratracheal lipopolysaccharide exposure in mice results in chronic lung inflammation and persistent pathology.
Am. J. Respir. Cell Mol. Biol. 26:152–159.
Vesey, G., J. Narai, N. Ashbolt, K. W. Williams, and D. Veal. 1994. Detection of specific microorganisms in environmental samples using flow cytometry. Methods Cell Biol. Flow Cytom. 42:490–519.
Wainwright, M., N. C. Wickramasinghe, J. V. Narlikar, and P. Rajaratnam.
2003. Microorganisms cultured from stratospheric air samples obtained at
41 km. FEMS Microbiol. Lett. 218:161–165.
Walsh, J. J., and K. A. Steidinger. 2001. Saharan dust and Florida red tides:
the cyanophyte connection. J. Geophys. Res. 106:11597–11612.
Washington, R., M. Todd, N. J. Middleton, and A. S. Goudie. 2003. Duststorm source areas determined by the total ozone monitoring spectrometer
and surface observations. Ann. Assoc. Am. Geogr. 93:297–313.
Weir-Brush, J. R., V. H. Garrison, G. W. Smith, and E. A. Shinn. 2004. The
relationship between gorgonian coral (Cnidaria: Gorganacea) diseases and
African dust storms. Aerobiologia 20:119–126.
White, D. C., H. C. Pinkart, and D. B. Ringelberg. 1997. Biomass measurements: biochemical approaches, p. 91–101. In C. J. Hurst, G. R. Knudsen,
M. J. McInerney, L. D. Stetzenback, and M. V. Walter (ed.), Manual of
environmental microbiology. ASM Press, Washington, DC.
DESERT DUST MICROBIOLOGY AND HUMAN HEALTH
477
247. Whitman, W. B., D. C. Coleman, and W. J. Wiebe. 1998. Prokaryotes: the
unseen majority. Proc. Natl. Acad. Sci. USA 95:6578–6583.
248. Wiggs, G. F. S., S. L. O’hara, J. Wegerdt, J. V. D. Meer, I. Small, and R.
Hubbard. 2003. The dynamics and characteristics of aeolian dust in dryland
Central Asia: possible impacts on human exposure and respiratory health in
the Aral Sea basin. Geogr. J. 169:142–157.
249. Willeke, K., X. Lin, and S. A. Grinshpun. 1998. Improved aerosol collection
by combined impaction and centrifugal motion. Aerosol Sci. Technol. 28:
439–456.
250. Williams, P. L., D. L. Sable, P. Mendez, and L. T. Smyth. 1979. Symptomatic coccidioidomycosis following a severe natural dust storm. An outbreak
at the Naval Air Station, Lemoore, California. Chest 76:566–570.
251. Williams, R. H., E. Ward, and H. A. McCartney. 2001. Methods for integrated air sampling and DNA analysis for detection of airborne fungal
spores. Appl. Environ. Microbiol. 67:2453–2459.
252. Williamson, K. E., K. E. Wommack, and M. Radosevich. 2003. Sampling
natural viral communities from soil for culture-independent analyses. Appl.
Environ. Microbiol. 69:6628–6633.
253. Wilson, K. H., W. J. Wilson, J. L. Radosevich, T. Z. DeSantis, V. S.
Viswanathan, T. A. Kuczmarski, and G. L. Andersen. 2002. High-density
microarray of small-subunit ribosomal DNA probes. Appl. Environ. Microbiol. 68:2535–2541.
254. Wisplinghoff, H., A. E. Rosato, M. C. Enright, M. Noto, W. Craig, and G. L.
Archer. 2003. Related clones containing SCCmec type IV predominate
among clinically significant Staphylococcus epidermidis isolates. Antimicrob.
Agents Chemother. 47:3574–3579.
255. Wolf, F. T. 1943. The microbiology of the upper air. Bull. Torrey Botanical
Club 70:1–14.
256. Wu, P. C., J. C. Tsai, F. C. Li, S. C. Lung, and H. J. Su. 2004. Increased
levels of ambient fungal spores in Taiwan are associated with dust events
from China. Atmosph. Environ. 38:4879–4886.
257. Wust, G., F. Friedl, D. Haas, M. Kock, F. Pichler-Semmelrock, F. F.
Reinthaler, R. Schlacher, and E. Marth. 2003. A comparison between
Andersen (ACFM) and Reuter Centrifugal Sampler (RCS-plus) for indoor
sampling of airborne molds. Aerobiologia 19:125–128.
258. Xiao, C., S. C. Kang, D. Qin, T. D. Yao, and J. W. Ren. 2002. Transport of
atmospheric impurities over the Qinghai-Xizang (Tibetan) Plateau as
shown by snow chemistry. J. Asian Earth Sci. 20:231–239.
259. Xu, X. Z., X. G. Cai, X. S. Men, P. Y. Yang, J. F. Yang, S. L. Jing, J. H. He,
and W. Y. Si. 1993. A study of siliceous pneumoconiosis in the desert area
of Sunan County, Gansu Province, China. Biomed. Environ. Sci. 6:217–222.
260. Yates, M. V., and S. R. Yates. 1988. Modeling microbial fate in the subsurface environment. CRC Crit. Rev. Environ. Control 17:307–344.
261. Yeo, H. G., and J. H. Kim. 2002. SPM and fungal spores in the ambient air
of west Korea during the Asian dust (yellow sand) period. Atmosph. Environ. 36:5437–5442.
262. Yu, I. T. S., Y. Li, T. W. Wong, W. Tam, M. Phil, A. T. Chan, J. H. W. Lee,
D. Y. C. Leung, and T. Ho. 2004. Evidence of airborne transmission of the
severe acute respiratory syndrome virus. N. Engl. J. Med. 350:1731–1739.
263. Zanobetti, A., and J. Schwartz. 2005. The effect of particulate air pollution
on emergency admissions for myocardial infarction: a multicity case-crossover analysis. Environ. Health Perspect. 113:978–982.
264. Zengler, K., G. Toledo, M. Rappe, J. Elkins, E. J. Mathur, J. M. Short, and
M. Keller. 2002. Cultivating the uncultured. Proc. Natl. Acad. Sci. USA
99:15681–15686.
265. Zhang, X. Y., S. L. Gong, T. L. Zhao, R. Arimoto, Y. Q. Wang, and Z. J.
Zhou. 2003. Sources of Asian dust and role of climate change versus
desertification in Asian dust emission. Geophys. Res. Lett. 30:2272.
266. Zhenda, Z., and W. Tao. 1993. The trends of desertification and its rehabilitation in China. Desertification Control Bull. 22:27–29.
267. Zitouni, A., H. Boudjella, L. Lamari, B. Badji, F. Mathieu, A. Lebrihi, and
N. Sabaou. 2005. Nocardiopsis and Saccharothrix genera in Saharan soils in
Algeria: isolation, biological activities and partial characterization of antibiotics. Res. Microbiol. 156:984–993.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 478–488
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00006-07
Vol. 20, No. 3
Epidemiology of Human Immunodeficiency Virus in the United States
Susan Hariri and Matthew T. McKenna*
HIV Incidence and Case Surveillance Branch, Division of HIV/AIDS Prevention, National Center for HIV/AIDS, Viral Hepatitis,
STD and TB Prevention (Proposed), Centers for Disease Control and Prevention, Atlanta, Georgia
INTRODUCTION .......................................................................................................................................................478
BACKGROUND AND EARLY HISTORY ..............................................................................................................478
DATA SOURCES AND METHODS ........................................................................................................................479
HIV/AIDS National Surveillance ..........................................................................................................................479
Population-Based Serosurveys (NHANES) .........................................................................................................479
Other Methods ........................................................................................................................................................479
CURRENT PICTURE ................................................................................................................................................480
Mortality Patterns ..................................................................................................................................................480
AIDS .........................................................................................................................................................................481
HIV Infection (Including AIDS) ...........................................................................................................................482
FUTURE DIRECTIONS ............................................................................................................................................485
Clinical and Epidemiologic Effects of HAART ...................................................................................................485
HIV Incidence..........................................................................................................................................................486
Monitoring HIV Risk Behavior.............................................................................................................................486
CONCLUSION............................................................................................................................................................487
ACKNOWLEDGMENTS ...........................................................................................................................................487
REFERENCES ............................................................................................................................................................487
Columbia have mandated some form of reporting for individuals diagnosed with HIV infection, even in the absence of
AIDS, and efforts are under way to standardize methods to
comply with CDC-recommended confidential name-based reporting and to integrate data into a national HIV/AIDS surveillance system (17). An essential role of such a surveillance
system is to safeguard against duplication of case reports
among different states to provide the most accurate and complete picture of the HIV epidemic across the United States.
The purpose of this paper is to describe the current state of
HIV infection, using national HIV/AIDS surveillance data.
INTRODUCTION
Advances in the treatment of human immunodeficiency virus (HIV) infection have resulted in a fundamental shift in its
epidemiology, from a highly lethal infectious disease to a potentially chronic and manageable condition (46). Thus, overall
rates of the most severe clinical presentations of the infection,
i.e., AIDS, have declined compared to those in the early 1990s
(35). The result is that more people are living with HIV infection, and deaths from AIDS remain low relative to historical
levels (33). Unfortunately, successes in preventing new infections appear to have stalled during the late 1990s (33). Therefore, achieving a clear understanding of the sociobehavioral
determinants of HIV infection will be essential for successfully
controlling the disease. Moreover, racial and ethnic disparities
clearly exist both in access to effective treatments for HIV and
in rates of new infections (15). Given that the success of prevention and treatment efforts depends on accurate and complete identification of at-risk populations, collection, analysis,
and interpretation of surveillance data remain critical for keeping abreast of the evolving nature of the epidemic (12, 50). In
particular, the increase in the time from diagnosis of HIV to
the onset of AIDS resulting from the use of effective antiretrovirals underscores the need for ongoing enumeration and
evaluation of the extents and patterns of diagnosed HIV infections as well as AIDS cases (25).
In 1999, the Centers for Disease Control and Prevention
(CDC) recommended national implementation of name-based
HIV reporting, which had previously been implemented in
only 34 areas (11). To date, all states and the District of
BACKGROUND AND EARLY HISTORY
The first decade of the HIV epidemic was characterized by
steady and sharp increases in the incidence of AIDS cases,
punctuated by diagnostic and therapeutic milestones as well as
changes in the methods used to monitor the clinical manifestations of the infection. These changes were precipitated by
increases in the number of new infections and advances in the
understanding of the biology of the virus. By the peak of the
epidemic in 1993, AIDS had become the leading cause of
death in men and women aged 25 to 44 years and was the
eighth leading cause of death overall, accounting for 2% of all
deaths in the United States (10). Age-adjusted death rates
attributed to HIV increased in a linear fashion from 6 deaths
per 100,000 in 1987 to 17 deaths per 100,000 in 1995, when
deaths due to the disease peaked. Between 1995 and 1998,
however, the numbers of reported AIDS cases and deaths in
the United States declined precipitously, at rates of 28%, 45%,
and 18% each year, after which they remained relatively stable,
at approximately 40,000 each year through 2004 (7). Widespread use of improved antiretroviral therapy leading to longer
incubation periods and survival after infection is believed to
* Corresponding author. Mailing address: CDC, NCCDPHP, 1600
Clifton Road, MS E 47, Atlanta, GA 30333. Phone: (404) 639-2050.
Fax: (404) 639-2980. E-mail: [email protected].
478
VOL. 20, 2007
EPIDEMIOLOGY OF HIV IN THE UNITED STATES
explain most of the rapid reduction in mortality in the mid1990s (21). However, other factors, such as increased use of
prophylaxis for opportunistic infections and primary prevention, are also likely to have contributed to the observed decline
(28).
Models that indirectly measured the incidence of HIV infection, using AIDS case reports and knowledge about the
distribution of HIV incubation periods, indicated that the
transmission incidence peaked around the mid-1980s, approximately a decade earlier than did cases of AIDS (33).
In the early years of the epidemic, HIV/AIDS, defined as all
HIV infections, with and without AIDS, was characterized as a
disease of white men who have sex with men (MSM), the group
in whom the disease was first recognized (8). Injecting drug
users (IDUs) represented approximately 20% of cases, while
heterosexuals and females from all transmission categories accounted for about 5% and 8% of all reported cases, respectively (10). Because direct socioeconomic data were not routinely collected as part of the AIDS national surveillance
system, little to no information is available at the national level
to describe the socioeconomic characteristics of the early patients.
DATA SOURCES AND METHODS
HIV/AIDS National Surveillance
The national HIV/AIDS surveillance system, supported by
the CDC, is the primary national source of information used to
track the changing characteristics and patterns of the epidemic.
With ongoing technical assistance from the CDC, state and
local health departments collect surveillance data for analysis
at the local level (41). Local surveillance data are routinely
reported to the CDC, where they are analyzed in the aggregate
to provide national population-based estimates aimed at elucidating the epidemic. Surveillance data include data on all
persons diagnosed with HIV in the entire U.S. population,
including institutionalized individuals and noncivilian (i.e., military) persons.
Prior to the widespread use of highly active antiretroviral
therapy (HAART) in 1996, HIV prevalence was estimated
indirectly through mathematical models designed to “backcalculate” numbers of HIV diagnoses (1, 4). The validity of
these estimates depended not only on the number of reported
AIDS cases but also on knowledge of the HIV incubation
period distribution needed to estimate the probability of developing AIDS for each year following HIV infection (23).
HAART can differentially affect the incubation period distribution for users, depending on access, adherence, and effectiveness. This situation renders the back-calculation method
based on the incidence of AIDS inaccurate for deriving the
infection incidence for HIV after the advent of HAART. Since
1994, the number of states using an integrated HIV/AIDS
surveillance system has increased (23). Currently, data are
available from 33 states with surveillance systems that integrate
ascertainment of new HIV diagnoses with monitoring of AIDS
cases, using confidential name-based reporting. Sixty-three
percent of all new U.S. AIDS cases each year are diagnosed in
these states (23). It is important, however, that current surveillance data are limited to persons with a diagnosed HIV infec-
479
tion and do not directly represent the number of infections
because some HIV-infected individuals may not get tested.
Population-Based Serosurveys (NHANES)
The National Health and Nutrition Examination Surveys
(NHANES) are a series of population-based cross-sectional
surveys designed to provide nationally representative estimates
of the health and nutritional status of the civilian noninstitutionalized U.S. population (9). NHANES data are collected
through personal interviews and physical examinations of survey participants, with the latter including biologic samples used
for anonymous HIV antibody testing from 1988 to 1994 and for
confidential name-based HIV antibody testing from 1999 to
2002 (42). As such, NHANES is the only nationally representative survey from which HIV seroprevalence can be estimated. Moreover, data from the 1999–2002 NHANES can be
used to examine associations between HIV serostatus and various demographic and risk characteristics for a more thorough
investigation of the impact of these factors on the disease (39).
Other Methods
Mortality data collected through the HIV/AIDS surveillance
system are sensitive to changes in the HIV and AIDS case
definitions because surveillance reporting is limited to cases
that meet the definition in effect at the time of a person’s
death. For example, the annual numbers of deaths among
persons with HIV infection or AIDS reported to CDC’s HIV/
AIDS surveillance program by state and local health departments may be affected by expansion of the CDC case definition
for AIDS and by expansion of the policies of the health departments for reporting of non-AIDS HIV infection cases.
Reporting may be less complete for AIDS cases meeting the
expanded criteria of the current AIDS case definition but not
meeting the narrower criteria of earlier case definitions, particularly for cases diagnosed years before the case definition
was expanded in 1993. Further complicating the interpretation
of mortality for cases reported to CDC’s HIV/AIDS surveillance program is the fact that no distinction is made between
deaths due to HIV/AIDS and deaths due to other causes. In
contrast, death certificate data on deaths attributed to HIV
disease (regardless of whether it is AIDS or non-AIDS) as the
underlying cause are less likely to have been affected by
changes in case reporting policies and practices since 1987 and
are more likely to reflect true long-term trends in mortality
caused by HIV. Therefore, estimates of trends and distributions of deaths due to HIV in the United States are based on
data compiled by the National Center for Health Statistics
(NCHS) from death certificates of U.S. residents in the 50
states and the District of Columbia. The underlying cause of
each death is selected from the conditions reported by physicians, medical examiners, and coroners in the cause-of-death
section of the death certificate. The mortality data from NCHS
are the sole source of information on all causes of death in the
national population, allowing comparison of deaths due to
HIV disease and deaths due to other causes (7, 29).
Smaller serosurveys lack either power (if population-based)
or representativeness (if targeted to special high-risk populations) and thus cannot be generalized to the U.S. population.
480
HARIRI AND MCKENNA
FIG. 1. Trends in annual age-adjusted (to 2000 U.S. population)
rate of death due to HIV disease in the United States by sex for the
period 1987–2002. For comparison with data for 1999 and later years,
data for 1987–1988 were modified to account for ICD-10 rules instead
of ICD-9 rules. (Reprinted from the CDC website [http://www.cdc.gov
/hiv/graphics/mortalit.htm].)
Also, in the case of the latter design, the size and characteristics of the population from which samples were drawn (denominator) are often unknown.
Longitudinal cohort studies to determine the incidence of
HIV infection are not practical due to the associated costs and
loss to follow-up and may also lack representativeness.
CURRENT PICTURE
The most recent estimates indicate that 40 million people
are currently infected with HIV (with and without AIDS)
worldwide, 1.2 million of whom are in the United States and
thus represent 2.5% of the global disease burden (24, 48).
Mortality Patterns
After years of steady increase followed by precipitous declines, deaths of persons with HIV/AIDS reported to the national HIV/AIDS surveillance system and U.S. Vital Statistics
began to stabilize to approximately 5 per 100,000 in 1998 (7,
29). Between 2000 and 2004, in contrast to the steep annual
decreases of up to 45% in the latter part of the 1990s, deaths
of persons with HIV/AIDS declined only a modest 8%. The
lower rates of decline in HIV-related mortality in recent years
are largely attributed to the emergence of resistance to currently available HAART regimens and to differential access to
treatment. When these medications are appropriately prescribed and the regimens are followed, the progression of the
infection can be arrested effectively and substantial immune
reconstitution can ensue. However, such treatment cannot
eradicate or cure HIV infection. Therefore, ongoing therapy is
necessary to arrest disease progression. Late diagnosis, erratic
adherence, and adverse side effects of the medications result in
poorer outcomes and the emergence of drug resistance. All of
these health service challenges are compounded by the fact
that HIV is increasingly impacting communities that lack access to treatment, including racial and ethnic minorities and
the socioeconomically disadvantaged (3, 15).
Although death rates have followed similar patterns across
most demographic and behavioral strata, including gender,
age, geographic distribution, and race/ethnicity, substantial
variation exists in the percentages of decline among different
subgroups. For example, although the number of deaths attrib-
CLIN. MICROBIOL. REV.
FIG. 2. Trends in age-adjusted (to 2000 U.S. population) annual
rates of death due to HIV disease in the United States by race/ethnicity
for the period 1990–2002. For comparison with data for 1999 and later
years, data for 1987–1988 were modified to account for ICD-10 rules
instead of ICD-9 rules. (Reprinted from the CDC website [http://www
.cdc.gov/hiv/graphics/mortalit.htm].)
uted to HIV has declined in both men and women, it has
always been and continues to be higher among males (Fig. 1).
This reflects the higher incidence rate of the infection in males.
However, over time, the ratio of male to female deaths fell
from 10:1 in 1987 to 3:1 in 1998 (7, 29). Similarly, although
HIV-related deaths declined rapidly in the 1990s in all racial
groups, the percent decline was significantly lower for nonHispanic blacks than for any other race/ethnic group, suggesting race/ethnic disparities (Fig. 2). Further stratification of
race/ethnicity by gender illustrated similar lower percent decreases in nonwhite men and women. Black women had the
smallest percent decline of any category. Moreover, between
2001 and 2004, while the number of deaths continued to decrease steadily, if less dramatically, for non-Hispanic whites,
they either stayed the same or increased slightly from year to
year among the other race/ethnic groups. Percent declines also
differed by geographic region and by poverty level. Geographic
comparison of mortality patterns across the U.S. Census Bureau-designated regions of the country (Northeast, South,
West, and Midwest) showed the highest death rates in the
Northeast and South, with coastal states and large cities carrying the heaviest burden of deaths due to HIV (Fig. 3). Racial
and ethnic disparities in death rates were observed in all regions, with non-Hispanic blacks showing the lowest percent
FIG. 3. Trends in age-adjusted (to 2000 U.S. population) annual
rates of death due to HIV disease in the United States by geographic region for the period 1987–2002. For comparison with data
for 1999 and later years, data for 1987–1988 were modified to
account for ICD-10 rules instead of ICD-9 rules. The age distribution of the U.S. population was used as the standard for age adjustment. (Reprinted from the CDC website [http://www.cdc.gov/hiv
/graphics/mortalit.htm].)
VOL. 20, 2007
EPIDEMIOLOGY OF HIV IN THE UNITED STATES
481
are also evident in the prevalence and diagnosis of HIV/AIDS,
as presented below.
AIDS
FIG. 4. Trends in age-adjusted (to 2000 U.S. population) annual
rates of death due to HIV disease in the United States by age group for
the period 1987–2002. For comparison with data for 1999 and later
years, data for 1987–1988 were modified to account for ICD-10 rules
instead of ICD-9 rules. (Reprinted from the CDC website [http://www
.cdc.gov/hiv/graphics/mortalit.htm].)
decline compared to other race/ethnic groups in all four regions of the country. Another factor associated with death
rates was poverty, with the poorest areas (defined by the percentage of residents living below the poverty level in 1990)
experiencing the lowest percent decreases in mortality. Finally,
mortality data suggest an important shift in deaths toward
older age groups, such that the median age at death due to
HIV infection increased from 36 years in 1987 to the older
median age of 43 years in 2002 (Fig. 4). Only 61 deaths due to
AIDS were reported for children of ⬍13 years in 2004 (12).
The age-related trends are reflective of changes in survival
after diagnosis due to HAART as well as of a decreasing
incidence of infection from perinatal exposure and transfusions with contaminated blood products for general medical
indications as well as for hemophiliacs. Intergroup differences
As increasing use of HAART leads to increased survival
times and decreasing numbers of HIV-related deaths, the total
number of persons living with the infection has increased (Fig.
5) (35). Moreover, as long as the number of new infections
decreases or remains the same, the biggest increase in persons
living with HIV likely will be among those who would otherwise have died. Results of the surveillance data indicate that
despite rapid declines in AIDS diagnoses between 1993 and
2001, estimated AIDS diagnoses increased modestly each year
from 2001 through 2004, supporting the assumptions described
above. In 2004, the annual incidence of AIDS was estimated to
be 14.1 per 100,000 nationally (12). Almost all of the reported
AIDS cases in 2004 were in adults (Table 1). Children under
the age of 13 years accounted for only 48 of the newly diagnosed cases, representing a very small fraction of the total
cases of AIDS and, more importantly, reflecting a substantial
decrease of 61% in pediatric AIDS since 2000. Among the
mostly adult AIDS diagnoses reported in 2004, males represented almost three times as many cases (⬃31,000) as females
(⬃11,000) and were diagnosed with AIDS at higher rates (25.6
per 100,000) than females (9.0 per 100,000) between 2000 and
2004. However, females had the largest increase in absolute
numbers of AIDS (10%) compared to their male counterparts
(7%) in the same time period. Also, during 2000–2004, the
number of AIDS cases increased slightly in all racial/ethnic
categories. However, almost double the number of AIDS cases
(⬃21,000) occurred among non-Hispanic blacks compared to
non-Hispanic whites (⬃12,000), with almost three times as
many as those among Hispanics (⬃8,700). In 2004, non-Hispanic blacks also represented the highest rates of AIDS (56.4
FIG. 5. Estimated numbers of AIDS cases, deaths, and persons living with AIDS in the United States for the period 1985–2004. Data have been
adjusted for reporting delays. (Reprinted from the CDC website [http://www.cdc.gov/hiv/topics/surveillance/resources/slides/trends/index.htm].)
482
HARIRI AND MCKENNA
CLIN. MICROBIOL. REV.
TABLE 1. Estimated numbers of AIDS cases, by year of diagnosis and selected characteristics, in the United States in 2000–2004a
No. of cases in yr of diagnosisb
Characteristic
2000
2001
2002
2003
2004
Sex
Male
Female
28,974
10,415
28,743
10,348
29,730
10,429
30,578
11,184
31,024
11,442
Age at diagnosis (yr)
⬍13
13–19
20–29
30–39
40–49
50–59
ⱖ60
124
351
4,761
15,427
12,730
4,535
1585
115
353
4,582
14,907
12,903
4,766
1579
109
383
4,746
14,726
13,481
5,154
1668
69
359
4,940
14,766
14,393
5,526
1777
48
386
5,364
13,817
14,992
6,011
1897
Race/ethnicity
White, not Hispanic
Black, not Hispanic
Hispanic
Asian/Pacific Islander
American Indian/Alaska Native
11,378
19,510
7,957
350
175
11,052
19,473
7,974
381
169
11,604
19,934
7,907
440
186
11,657
20,685
8,632
478
189
12,013
20,965
8,672
488
193
Transmission category
Male-to-male sexual contact
IDU
Male-to-male sexual contact and IDU
Heterosexual contact
Perinatal
Otherc
15,374
10,429
2,102
10,947
122
537
15,510
9,622
2,056
11,370
113
533
16,442
9,255
1,982
11,952
105
528
17,139
9,281
1,996
12,826
68
520
17,691
9,152
1,920
13,128
47
577
Region of residence
Northeast
Midwest
South
West
U.S. dependency
12,105
3,968
15,841
6,443
1,156
11,212
3,949
16,598
6,258
1,190
10,395
4,303
17,751
6,745
1,073
11,149
4,495
18,612
6,474
1,100
11,158
4,498
19,792
6,083
982
Totald
39,513
39,206
40,267
41,831
42,514
a
Data from reference 12.
These numbers do not represent reported case counts. Rather, these numbers are point estimates, which result from adjustments of reported case counts. The
reported case counts are adjusted for reporting delays and for redistribution of cases for persons initially reported without an identified risk factor. The estimates do
not include adjustment for incomplete reporting.
c
Includes hemophilia, blood transfusion, perinatal transmission, and risk factor not reported or not identified.
d
Includes persons of unknown race or multiple races and persons of unknown sex. The cumulative total includes 2,308 persons of unknown race or multiple races
and 2 persons of unknown sex. Because column totals were calculated independently of the values for the subpopulations, the values in each column may not sum to
the column total.
b
per 100,000), followed by Hispanics (18.6 per 100,000), American Indians/Alaska Natives (7.9 per 100,000), whites (6.0 per
100,000), and Asians/Pacific Islanders (3.7 per 100,000).
Although the estimated annual number of AIDS diagnoses
increased among persons exposed through heterosexual contact as well as among MSM between 2000 and 2004, the number decreased among IDUs and MSM who were also IDUs in
the same time period. The largest number of AIDS cases in
2004 was attributed to male-male sex, followed by heterosexual
sex and then IDU. Regionally, the number of reported AIDS
cases increased 25% in the South and 13% in the Midwest
while decreasing 8% in the Northeast, 6% in the West, and
15% in the U.S. dependencies, possessions, and associated
nations (12).
Results from the 1999–2002 NHANES indicate racial disparities in treatment that may be partially responsible for
the proportional disparities in AIDS deaths and prevalence
among non-Hispanic blacks (39). First, by comparing CD4
counts among seropositive respondents who reported
HAART use to those among seropositive respondents who
did not, NHANES analysis confirmed previous results of
HAART effectiveness in slowing disease progression in a
population-based sample. Next, the analysis indicated that
only 17% of seropositive black respondents reported using
HAART medication, in contrast to 78% of respondents in
all other categories. Furthermore, among seropositive respondents who were aware of their HIV status, only 67% of
blacks reported HAART use, in contrast to a full 100%
among all other race/ethnic groups (39).
HIV Infection (Including AIDS)
Of the estimated 1.2 million people in the United States
living with HIV infection, approximately 34% have progressed
to AIDS, 42% are classified as having HIV only (not AIDS),
and 24% remain undiagnosed and therefore may be at any
VOL. 20, 2007
EPIDEMIOLOGY OF HIV IN THE UNITED STATES
TABLE 2. Estimated numbers and proportions of persons with
HIV infection diagnosis by selected characteristics in 33 states with
confidential name-based HIV infection reporting in 2004a
Characteristic
No. (%) with
HIV diagnosisb
Sex
Male ...................................................................................28,143 (72.7)
Female................................................................................10,410 (26.9)
Age at diagnosis (yr)
⬍13 ..................................................................................... 174 (0.4)
13–19 .................................................................................. 1,121 (2.9)
20–29 .................................................................................. 8,366 (21.6)
30–39 ..................................................................................12,281 (31.7)
40–49 ..................................................................................10,880 (28.1)
50–59 .................................................................................. 4,370 (11.3)
ⱖ60 ..................................................................................... 1,538 (4.0)
Race/ethnicity
White, not Hispanic .........................................................11,806 (30.5)
Black, not Hispanic ..........................................................19,206 (49.6)
Hispanic ............................................................................. 6,970 (18.0)
Asian/Pacific Islander....................................................... 394 (1.0)
American Indian/Alaska Native...................................... 208 (0.5)
Transmission category
Male-to-male sexual contact ...........................................18,203 (47.1)
IDU .................................................................................... 5,962 (15.4)
Male-to-male sexual contact and IDU .......................... 1,372 (3.5)
Heterosexual contact........................................................12,683 (32.8)
Perinatal............................................................................. 145 (0.4)
Otherc ................................................................................. 335 (0.9)
Total .......................................................................................38,685 (100)
a
Data from reference 12. Since 2000, the following 33 states have had laws or
regulations requiring confidential name-based HIV infection reporting: Alabama, Alaska, Arizona, Arkansas, Colorado, Florida, Idaho, Indiana, Iowa, Kansas, Louisiana, Michigan, Minnesota, Mississippi, Missouri, Nebraska, Nevada,
New Jersey, New Mexico, New York, North Carolina, North Dakota, Ohio,
Oklahoma, South Carolina, South Dakota, Tennessee, Texas, Utah, Virginia,
West Virginia, Wisconsin, and Wyoming. Since July 1997, Florida has had confidential name-based HIV infection reporting only for new diagnoses.
b
These numbers do not represent reported case counts. Rather, these numbers are point estimates, which result from adjustments of reported case counts.
The reported case counts are adjusted for reporting delays and for redistribution
of cases for persons initially reported without an identified risk factor. The
estimates do not include adjustment for incomplete reporting. Data include
persons with a diagnosis of HIV infection. This includes persons with a diagnosis
of HIV infection only, a diagnosis of HIV infection and a later AIDS diagnosis,
and concurrent diagnoses of HIV infection and AIDS.
c
Includes hemophilia, blood transfusion, perinatal transmission, and risk factor not reported or not identified.
stage along the spectrum of the disease. Table 2 summarizes
the demographic and transmission characteristics of persons
newly diagnosed with HIV in 2004. The data suggest that
HIV-infected individuals who are diagnosed can be characterized as predominantly male (73%) and nonwhite (69%) (24).
Non-Hispanic blacks comprise the greatest percentage of HIV
infections (50%), while Hispanics represent 18% of all cases.
Male-male sex is the most frequently reported transmission
category (47%), followed by heterosexual contact (33%) and
IDU (5%). Similarly, among non-Hispanic blacks, the most
frequently reported transmission route is male-male sex
(45%), followed by heterosexual contact (27%) and IDU
(22%) (24).
Health care personnel are potentially at risk of occupationally acquired HIV infection. However, many health care work-
483
ers also have behavioral risk factors for HIV that make it
difficult to differentiate whether the source of infection was
attributable specifically to workplace exposures. In general,
few HIV infections have been rigorously documented as occurring due to exposures to infectious fluids or tissues from
patients. Data from the National Surveillance for Occupationally Acquired HIV Infection and national AIDS surveillance
systems identified 57 cases of documented occupationally acquired infection between 1981 and 2001. Specific regimens
have been recommended to provide postexposure prophylaxis
(PEP) for workers with significant exposures, and among the
three cases that occurred after 1996, recommended PEP failed
in the only person who received treatment with a two-drug
regimen; the other two refused PEP (19, 44).
Geographically, HIV infection remains predominantly an
urban phenomenon, and southern and northeastern regions of
the country contain a disproportionate burden of the disease
(24). While the overall trends in new HIV diagnoses suggested
no significant change in annual rates between 2001 and 2004
(Fig. 6), subgroup analyses revealed statistically significant increases in annual rates for both males and females in the Asian
race/ethnic category (7.8% and 15.1% per year, respectively)
(Fig. 7). Annual rates declined significantly in the IDU and
heterosexual transmission categories (⫺9.1% and ⫺3.9% per
year, respectively) as well as in non-Hispanic black males and
females (Fig. 8 and 9) and Hispanic females (⫺4.4%, ⫺6.8%,
and ⫺13.0% per year, respectively) during the same time period (12, 22). Although the reductions in rates of HIV infection
in certain subgroups are encouraging, important intergroup
rate differences exist and must also be considered. In particular, members of nonwhite race/ethnic groups, especially females in these groups, are disproportionately affected by the
epidemic. Between 2001 and 2004, 51% of all new HIV diagnoses were in non-Hispanic blacks, who accounted for only
13% of the population from which the data were collected
(15). In the same time period, annual HIV diagnosis rates were
highest for non-Hispanic black males, followed by non-Hispanic black females, who had higher rates of infection than
males of all other race/ethnic categories (12).
The 1999–2002 NHANES results are consistent with surveillance data and indicate a high prevalence of HIV in nonHispanic blacks aged 40 to 49 years old (3.58%; 95% confidence interval, 1.88% to 6.71%), with 40- to 49-year-old
non-Hispanic black males having the highest prevalence (4.54%;
95% confidence interval, 2.24% to 8.97%) (39). Additionally,
surveillance results indicate racial/ethnic differences in transmission characteristics. Analyses of case surveillance data show
that male-male sex was the most commonly reported transmission category for all race/ethnic groups (12). However, the
proportion of black men reportedly infected through heterosexual contact was over four times greater than that for white
men (27% versus 6%). Also, a higher proportion of black men
(18%) reported IDU, compared to 10% of white men (12).
Infection attributed to heterosexual exposure was reported
with greatest frequency among females in all race/ethnic categories. However, infections among white women were almost
twice as likely to be attributed to IDU (30%) as those among
black women (17%). Therefore, a higher proportion of black
women are reportedly infected through heterosexual contact
(80%) than are white women (67%) (CDC, unpublished data).
484
HARIRI AND MCKENNA
CLIN. MICROBIOL. REV.
FIG. 6. Estimated numbers and rates of HIV/AIDS diagnoses in 33 states for the period 2001–2004. EAPC, estimated annual percent
change.
Stratification of the estimated prevalence of cases of diagnosed
and undiagnosed infections by stage of disease (HIV [not
AIDS] or AIDS) also reveals some interesting differences.
First, females represent a higher proportion of all cases in the
HIV (not AIDS) category than in the AIDS category (29%
versus 23%). Likewise, non-Hispanic blacks comprise a higher
percentage of those with HIV (not AIDS) than those in the
AIDS category (47% versus 43%). Finally, 29% of HIV (not
AIDS) cases are reported for heterosexuals versus 23% of
AIDS cases. In contrast, whites, MSM, and IDUs represent a
larger proportion of persons living with AIDS than of those in
the HIV (not AIDS) group (24). These proportions, although
not statistically significantly different, are suggestive of more
new infections in women, nonwhites, and heterosexuals due to
a higher percentage of them representing an earlier stage of
the disease. However, these differences may be an artifact of
differential testing patterns for the various subgroups and must
be investigated further using methods to measure HIV incidence.
FIG. 7. Estimated annual rates of HIV/AIDS diagnoses in 33 states
by sex and race/ethnicity for the period 2001–2004. EAPC, estimated
annual percent change; A/PI, Asian/Pacific Islander; AI/AN, American
Indian/Alaska Native. Statistically significant percent changes are indicated with asterisks.
While people of color currently experience a disproportionate burden of HIV infection, the numbers of children aged
⬍13 years with HIV and of new perinatal infections have
declined dramatically. Between 1992 and 2004, the estimated
annual number pediatric AIDS cases in the United States
decreased steadily each year from 945 to 57, a 94% decrease in
just over a decade (12). The reduction of pediatric and perinatal HIV infection has resulted from successful public health
interventions targeted to pregnant women. Specifically, since
antiretroviral therapy was demonstrated to be effective in reducing mother-to-child transmission of HIV, most professional
groups and the CDC have recommended that pregnant women
in the United States be provided with universal counseling,
voluntary testing, and appropriate treatment to prevent such
transmission. If testing and/or treatment is refused or proves
ineffective in blocking transmission to a newborn, the child is
placed on treatment early to increase survival and decrease the
risk of morbidity and mortality due to HIV. These measures
have led to the significant reductions in HIV-related infant and
child mortality observed in recent years (13).
FIG. 8. Estimated annual rates of HIV/AIDS diagnoses among
males in 33 states by race/ethnicity for the period 2001–2004. EAPC,
estimated annual percent change. Percentages of change were not
statistically significant.
VOL. 20, 2007
FIG. 9. Estimated annual rates of HIV/AIDS diagnoses among
females in 33 states by race/ethnicity for the period 2001–2004. EAPC,
estimated annual percent change. Statistically significant percent
changes are indicated with asterisks.
Studies of sexual transmission of HIV suggest that persons
who are unaware of their HIV infection are 3.5 times as likely
to transmit the virus to a partner as individuals who are aware
of their HIV status (37). Therefore, providing opportunities
for widespread testing and early detection would greatly benefit HIV prevention efforts. However, because of the stigma
traditionally associated with HIV and AIDS, recommendations and policies surrounding the use of HIV testing have
usually included requirements for extensive counseling about
the disease, with the solicitation of explicit consent before
obtaining the test. This approach is known as the “opt-in”
method. However, in the context of screening pregnant women
for HIV, the imperatives for optimizing early detection in
order to guide therapy and prevent transmission to the newborn have resulted in most recommendations from professional organizations, including the CDC, encouraging an “optout” approach to testing of pregnant women. This approach
allows for testing unless the mother explicitly objects. Currently, five states (Delaware, Florida, Indiana, Oregon, and
Texas) authorize an “opt-out” approach to HIV testing in
pregnant women, and two states (New York and Connecticut)
mandate HIV testing for all newborns (26). Recently, the CDC
extended the recommendation to testing all persons being
evaluated in clinical settings. Persons being tested for HIV can
be informed either verbally without extensive counseling or by
soliciting written consent (3).
Taken together, results from national surveillance and population-based survey data reveal some important trends, underscoring successes while serving as reminders of significant
challenges that remain in the context of social, economic, and
health care access disparities. Therapeutic advances have resulted in reduced mortality, longer survival, and improved life
quality among HIV-infected individuals. Public health campaigns to provide education, testing, and treatment to pregnant
women with HIV have led to declines in the number of infants
suffering from the disease. Finally, transfusion-transmitted and
hemophilia-associated HIV infections have been virtually eliminated in the United States. On the other hand, surveillance
data indicate that racial/ethnic, gender, and possibly socioeconomic disparities in HIV infection persist. However, current
prevalence estimates from surveillance data cannot discriminate between new and long-standing infections and therefore
EPIDEMIOLOGY OF HIV IN THE UNITED STATES
485
FIG. 10. Annual distribution of AIDS cases in the United States by
case definition category for the period 1981–2003.
do not adequately explain the impact of these disparities on the
future of the epidemic.
FUTURE DIRECTIONS
Clinical and Epidemiologic Effects of HAART
During the past decade, the introduction of HAART has
been responsible for increased length and quality of life among
many HIV-infected individuals and has contributed to significant reductions in HIV-related morbidity and mortality (27,
43). As illustrated in Fig. 10, following the dramatic proportional increase in the number of AIDS cases without opportunistic infections (OIs) relative to those with OIs that resulted
from the change in the AIDS case definition in 1993 (which
was expanded to include all HIV-infected persons with a
CD4⫹ T-lymphocyte count of ⬍200 cells/␮l or a CD4⫹ Tlymphocyte percentage of total lymphocytes of ⬍14%), the
percentage of AIDS cases without OIs continued to increase
coincident with the widespread use of HAART in 1996. The
absolute number of AIDS cases without OIs also began to
increase after 1996, such that 71% of all reported AIDS cases
in 2003 were classified on the basis of low CD4 counts without
OI, compared to only 35% in 1993.
Despite obvious successes, however, widespread use of
HAART has also led to new challenges in clinical management
of HIV disease due to its failure to completely suppress viral
replication, thus resulting in the emergence of HIV drug resistance (5). Most cases of drug resistance are thought to arise
as a result of random mutations in the presence of drugselective pressures in treated individuals. However, although
the use of HAART has been shown to decrease HIV infectivity
by suppressing the viral load (2), transmission of viruses resistant to all classes of antiretroviral drugs has also been demonstrated clearly for all transmission categories. Moreover, transmission of drug-resistant virus appears to be increasing (47).
Given that 25% of patients reportedly discontinue treatment
within 1 year due to drug toxicities and inconsistent adherence,
the long-term success of HAART must be evaluated in the
context of this important and rising phenomenon of drug resistance. The drug-associated mutations in most transmitted
quasi-species appear to persist as the dominant variant over
486
HARIRI AND MCKENNA
time, unlike the situation where mutations in a wild-type variant are selected by drug pressure (4). In the latter situation,
there is generally rapid reemergence and dominance of archived wild-type quasi-species when medications are discontinued. Although strains with drug resistance-associated mutations persist in the setting of transmitted resistance, such
mutations usually result in reduced viral fitness, as measured
by replicative capacity (19). Nevertheless, despite compromised viral fitness and a probable reduced transmissibility of
HIV type 1 (HIV-1) drug-resistant variants relative to that of
the wild type, primary transmission to drug-naı̈ve individuals
can and does occur, and resistant variants persist for years even
in the absence of treatment. Persons with acquired or transmitted drug resistance do not respond as well to treatment and
take 2 to 8 weeks longer to achieve viral suppression than their
drug-susceptible counterparts (18).
The prevalence of resistance mutations in drug-naı̈ve individuals newly diagnosed with HIV-1 infection has been shown
to vary with place and time. Resistance to all classes of
HAART drugs has been documented worldwide, as has resistance to multiple drugs. Various studies have estimated the
prevalence of at least one resistance mutation to range from
8% to 28% in the United States (47). Analysis of surveillance
data representing a large population-based sample of persons
in the United States revealed a prevalence of at least one
mutation in 10% of the overall sample. The prevalence of
resistance to all classes of drugs was detected and varied by
state from 6% to 13% (49). In addition, more sensitive assays
are now available to detect minority mutations that were not
detectable using bulk sequence detection methods (32). Nevertheless, it is difficult to predict the future trends in transmitted HIV drug resistance. At present, transmitted resistance
accounts for only a small fraction of the drug resistance population, and there is evidence of continuing benefits of antiretroviral therapy even among persons with persistent drugresistant variants (18).
HAART medications are also associated with substantial
side effects that can result in minor as well as substantial
metabolic, dermatologic, and neurologic dysfunctions (40). It
is beyond the scope of this paper to review the impact of
specific HAART medications. However, up to 25% of patients
reportedly discontinue treatment within the first 8 months
from HAART initiation, in part due to toxic effects of the
drugs. Adverse effects of HAART therapy range from mild
nuisances, such as fatigue, headaches, and skin rashes, to lifethreatening effects, such as metabolic disruption and hepatotoxicity (40). Given the potential morbidity and mortality associated with HAART therapy and the impact of poor
adherence on the development of drug resistance, management of HAART-related adverse outcomes is imperative.
On the population level, increased use of HAART must also
be considered in the context of HIV incidence and changes in
risky behaviors. The impacts of HAART use on the epidemic
are decreased mortality and incidence rates (43). However,
potential increases in risky behaviors due to treatment availability and complacence among high-risk groups have been
shown to negatively impact the amount by which these parameters are reduced (2, 20). Therefore, the potential tradeoff
between treatment benefits and negative consequences must
be closely monitored. Specifically, continued prevention efforts
CLIN. MICROBIOL. REV.
targeted to high-risk populations combined with identification
and monitoring of viral resistance are critical needs in the next
phase of the epidemic. The CDC is currently supporting several surveillance sites to monitor the prevalence of HIV-1
subtypes and primary drug resistance patterns among new
cases of HIV infection. As part of the Variant, Atypical, and
Resistant Strains of HIV Surveillance System, four cities and
18 state heath departments are currently funded to conduct
drug resistance surveillance on remnant sera collected from
persons newly diagnosed with HIV infection (1).
HIV Incidence
According to back-calculations, 40,000 people are newly infected with HIV in the United States annually. However, the
accuracy of the statistical models used to derive this estimate is
unclear, given their sensitivity to the effects of the change in
the AIDS case definition in 1993 and the introduction of
HAART in 1996. Yet no alternative was available since, historically, systematic monitoring of new cases of HIV infection
was not a part of the national surveillance infrastructure, primarily due to unavailability of a marker able to distinguish
newly infected (incident) cases from infections of longer duration. As recommended by the Institute of Medicine in 2001,
assessment of HIV incidence trends is a priority for evaluation
of current prevention efforts as well as for future resource
allocation (30). Incidence estimates are also necessary to evaluate the goal of reducing the estimated annual 40,000 new
HIV infections in the United States to 20,000 per year, as
outlined in the CDC HIV Prevention Strategic Plan (6). Toward this end, the CDC developed and has begun to implement a National HIV Incidence Surveillance System, which
consists of two equally important components (36). The first
is an innovative serologic testing strategy called the Serologic Testing Algorithm for Recent HIV Seroconversion
(STARHS), which was developed and validated for ascertaining seroincidence (31). This method provided the breakthrough necessary to differentiate between recent and longstanding infections by using a tandem sensitive/less sensitive
testing method. The less sensitive assay was subsequently replaced by an enzyme immunoassay that is able to accurately
capture immunoglobulin G from infections with HIV subtypes
B, E, and D. This test is known as the BED assay and was
developed specifically for detecting recent HIV infection (45).
However, due to various factors, including widespread use of
HAART, that can affect antibody levels measured by these
tests, the STARHS test results must be interpreted in the
context of supplementary testing history information on each
individual tested in order to obtain valid incidence estimates.
Collection of the testing history information is the second
component of the new surveillance system, which is designed
to be fully integrated within the existing case surveillance system. Currently, 34 areas that cover approximately 85% of the
epidemic in the United States are implementing this system.
Monitoring HIV Risk Behavior
In addition to enumerating new HIV infections, ongoing
assessment of risk correlates, especially for subgroups at increased risk of infection, is an integral part of the goal to
VOL. 20, 2007
EPIDEMIOLOGY OF HIV IN THE UNITED STATES
reduce the burden of disease. The CDC is coordinating the
National HIV Behavioral Surveillance System (NHBS) to examine HIV-related behaviors in three high-risk groups, including MSM, IDUs, and heterosexual adults, in areas with high
rates of HIV by using population-based surveys (14, 22). Data
collection began in 2003 among MSM aged ⱖ18 years, the
group with the highest rates of HIV infection. As of 2005,
surveys have been conducted among eligible MSM in 25 metropolitan statistical areas. Results of surveys conducted between November 2003 and April 2005 indicate that the majority of MSM participants had previously been tested (⬎90%)
for HIV infection, with 77% percent reporting testing during
the preceding 12 months and 80% having received free condoms during the preceding 12 months (14). In contrast, 58% of
respondents reported unprotected anal intercourse with a
main partner, while 34% reported this same behavior with a
casual partner. Moreover, noninjection drug use was reported
by 42% of respondents, and few individual-level (15%) or
group-level (8%) HIV prevention programs were utilized by
respondents. These data suggest that although HIV testing is
common practice among this group, MSM continue to be at
increased risk of HIV through sexual and drug-related behaviors (14). Interestingly, data collected between 1990 and 1999
in New York City indicated a 15% decline in HIV seroprevalence among male IDUs who have sex with other men, despite
their engaging in these high-risk behaviors. The same study
also showed HIV seroprevalence to have decreased in male
IDUs who did not report sex with other men (38).
Another risk group for whom national HIV-related behavior
data have been collected is adolescents. Data from the national
Youth Risk Behavior Survey indicate a decline in the percentage of high school students engaging in high-risk sexual behavior during 1991–2005 (16). Overall, self-reported sexual experience decreased 13%, from 54% to 47%; multiple sex partners
(defined as four or more in the preceding 3 months) decreased
24%, from 19% to 14%; current sexual activity decreased 9%,
from 37% to 34%; and condom use increased 36%, from 46%
to 63%. Despite overall declines, however, disparities that
must be addressed further remained among subgroups. For
example, black students were more likely than white and Hispanic students to report high-risk sexual behaviors, while no
decrease was observed in the prevalence of sexual experience,
having had multiple sex partners, or current sexual activity
among Hispanic students. Moreover, the percentage of high
school students reporting injection drug use remained stable,
at 4%, during the same time period.
The second group assessed by the NHBS was IDUs (34).
The next phase of NHBS focuses on high-risk heterosexuals
and is under way. Data generated from NHBS and other national and local surveys will provide more information on HIVrelated behaviors and help us to move toward more effective
and targeted prevention strategies to reduce the burden of
HIV disease.
CONCLUSION
The emergence of the HIV epidemic in the United States
has been characterized by many transitions, initially presenting
as a rapidly lethal disease primarily affecting white MSM in a
limited number of urban areas. Systematic public health sur-
487
veillance data have served as the foundation for extensive
clinical, epidemiologic, viral, behavioral, and pharmacologic
research. The result of these efforts was the rapid identification
of a novel retroviral infection with a long incubation period as
the cause of a severe, cellular immunodeficiency. The development of diagnostic tests, effective behavioral preventive interventions for adults, and the implementation of treatment
protocols that decrease perinatal transmission were followed,
within a decade, by the introduction of pharmacologic therapies that arrest disease progression and allow for immune
restoration. Despite the generally encouraging evolution of
these events, the epidemic presents persistent challenges. HIV
now exacts enormous morbidity and mortality in minority communities, particularly among African-American men and
women. The infection has also disseminated into rural areas.
Finally, although treatable, HIV infections are incurable. The
result has been the emergence of drug resistance among
treated persons as well as drug-naı̈ve, newly diagnosed persons.
Surveillance efforts must continue to adapt to the changing
characteristics of the epidemic to accurately capture the molecular, clinical, and behavioral dimensions of the epidemic so
that activities focused on prevention, treatment, and care can
continue to progress.
ACKNOWLEDGMENTS
We are grateful to Richard Selik for his input and assistance in
summarizing the HIV mortality data.
The findings and conclusions in this paper are those of the authors
and do not necessarily reflect the views of the Centers for Disease
Control and Prevention.
REFERENCES
1. Bennett, D. 2005. HIV [corrected] genetic diversity surveillance in the
United States. J. Infect. Dis. 192:4–9.
2. Blower, S., E. Bodine, J. Kahn, and W. McFarland. 2005. The antiretroviral
rollout and drug-resistant HIV in Africa: insights from empirical data and
theoretical models. AIDS 19:1–14.
3. Branson, B. M., H. H. Handsfield, M. A. Lampe, R. S. Janssen, A. W. Taylor,
S. B. Lyss, and J. E. Clark. 2006. Revised recommendations for HIV testing
of adults, adolescents, and pregnant women in health-care settings. Morb.
Mortal. Wkly. Rep. Recomm. Rep. 55:1–17.
4. Brookmeyer, R. 2003. Temporal factors in epidemics: the role of the incubation period, p. 127–145. In R. Brookmeyer and D. F. Stroup (ed.), Monitoring the health of populations: statistical principles and methods for public
health surveillance. Oxford University Press, Oxford, United Kingdom.
5. Cane, P. A. 2005. Stability of transmitted drug-resistant HIV-1 species. Curr.
Opin. Infect. Dis. 18:537–542.
6. CDC. August 2003, posting date. HIV prevention strategic plan through 2005.
CDC, Atlanta, GA. http://www.cdc.gov/hiv/partners/PSP/Goal4-Objective1-2-3
.htm#obj1.
7. CDC. 2002, posting date. HIV/AIDS mortality surveillance slides. CDC,
Atlanta, GA. http://www.cdc.gov/hiv/graphics/mortalit.htm.
8. CDC. 1981. Kaposi’s sarcoma and Pneumocystis pneumonia among homosexual men—New York City and California. Morb. Mortal. Wkly. Rep.
30:305–308.
9. CDC. 1994. Plan and operation of the Third National Health and Nutrition
Examination Survey, 1988–94. Series 1: programs and collection procedures.
Vital Health Stat. 1:1–407.
10. CDC. 1996. Update: mortality attributable to HIV infection among persons
aged 25–44 years—United States, 1994. Morb. Mortal. Wkly. Rep. 45:121–
125.
11. CDC. December 2000, posting date. HIV/AIDS surveillance report, 1999,
vol. 11. U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, Atlanta, GA. http://www.cdc.gov/hiv/stats
/hasr1102.pdf.
12. CDC. December 2005, posting date. HIV/AIDS surveillance report, 2004,
vol. 17. U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, Atlanta, GA. http://www.cdc.gov/hiv/topics
/surveillance/resources/reports/2004report/pdf/2004SurveillanceReport.pdf.
13. CDC. 2006. Achievements in public health. Reduction in perinatal transmission of HIV infection—United States, 1985–2005. Morb. Mortal. Wkly. Rep.
55:592–597.
488
HARIRI AND MCKENNA
14. CDC. 2006. Human immunodeficiency virus (HIV) risk, prevention, and
testing behaviors—United States, National HIV Behavioral Surveillance
System: men who have sex with men, November 2003–April 2005. Morb.
Mortal. Wkly. Rep. 55:1–16.
15. CDC. 2006. Racial/ethnic disparities in diagnoses of HIV/AIDS—33 states,
2001–2004. Morb. Mortal. Wkly. Rep. 55:121–125.
16. CDC. 2006. Trends in HIV-related risk behaviors among high school students—United States, 1991–2005. Morb. Mortal. Wkly. Rep. 55:851–854.
17. CDC. 2006. Twenty-five years of HIV/AIDS—United States, 1981–2006.
Morb. Mortal. Wkly. Rep. 55:585–589.
18. Deeks, S. G., T. Wrin, T. Liegler, R. Hoh, M. Hayden, J. D. Barbour, N. S.
Hellmann, C. J. Petropoulos, J. M. McCune, M. K. Hellerstein, and R. M.
Grant. 2001. Virologic and immunologic consequences of discontinuing
combination antiretroviral-drug therapy in HIV-infected patients with detectable viremia. N. Engl. J. Med. 344:472–480.
19. Do, A. N., C. A. Ciesielski, R. P. Metler, T. A. Hammett, J. Li, and P. L.
Fleming. 2003. Occupationally acquired human immunodeficiency virus
(HIV) infection: national case surveillance data during 20 years of the HIV
epidemic in the United States. Infect. Control Hosp. Epidemiol. 24:86–96.
20. Fenton, K. A., and J. Imrie. 2005. Increasing rates of sexually transmitted
diseases in homosexual men in Western Europe and the United States: why?
Infect. Dis. Clin. N. Am. 19:311–331.
21. Fleming, P. L., J. W. Ward, J. M. Karon, D. L. Hanson, and K. M. De Cock.
1998. Declines in AIDS incidence and deaths in the USA: a signal change in
the epidemic. AIDS 12(Suppl. A):S55–S61.
22. Gallagher, K., P. S. Sullivan, A. Lansky, and I. Onorato. 2007. Behavioral
surveillance among persons at risk for HIV infection in the U.S.: The National HIV Behavioral Surveillance System. Public Health Rep. 122(Suppl.
1):32–38.
23. Glynn, M. K., L. M. Lee, and M. T. McKenna. 2007. The status of national
HIV case surveillance, United States 2006. Public Health Rep. 122(Suppl.
1):63–71.
24. Glynn, M. K., and P. Rhodes. Estimated HIV prevalence in the United
States at the end of 2003, abstr. T1–B1101. 2005 Natl. HIV Prev. Conf.,
Atlanta, GA, 14 June 2005.
25. Hall, H. I., K. McDavid, Q. Ling, and A. Sloggett. 2006. Determinants of
progression to AIDS or death after HIV diagnosis, United States, 1996 to
2001. Ann. Epidemiol. 16:824–833.
26. Health Research and Education Trust. 2006, posting date. Cross-state comparison tables. Health Research and Education Trust, Chicago, IL. http:
//www.hret.org/hret/about/crossstate.html.
27. Hogg, R. S., B. Yip, C. Kully, K. J. Craib, M. V. O’Shaughnessy, M. T.
Schechter, and J. S. Montaner. 1999. Improved survival among HIV-infected patients after initiation of triple-drug antiretroviral regimens. CMAJ
160:659–665.
28. Holtgrave, D. R. 2005. Causes of the decline in AIDS deaths, United States,
1995–2002: prevention, treatment or both? Int. J. Sex Transm. Dis. Acquir.
Immune Defic. Syndr. 16:777–781.
29. Hoyert, D. L., M. P. Heron, S. L. Murphy, and H. Kung. April 2006, posting
date. Deaths: final data for 2003. National vital statistics reports, 2006, vol.
54. National Center for Health Statistics, Hyattsville, MD. http://www.cdc
.gov/nchs/data/nvsr/nvsr54/nvsr54_13.pdf.
30. Institute of Medicine. 2001, posting date. No time to lose. Institute of
Medicine, Washington, DC. http://www.iom.edu/Object.File/Master/4/131
/HIV8pager.pdf.
31. Janssen, R. S., G. A. Satten, S. L. Stramer, B. D. Rawal, T. R. O’Brien, B. J.
Weiblen, F. M. Hecht, N. Jack, F. R. Cleghorn, J. O. Kahn, M. A. Chesney,
and M. P. Busch. 1998. New testing strategy to detect early HIV-1 infection
for use in incidence estimates and for clinical and prevention purposes.
JAMA 280:42–48.
32. Johnson, J., J. F. Li, X. Wei, J. Lipscomb, A. Smith, C. Stone, D. Irlbeck, M.
Monsour, E. Lanier, and W. Heneine. 2007. Low frequency mutations substantially increase the prevalence of transmitted drug resistance and greatly
CLIN. MICROBIOL. REV.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
strengthen the relationship between resistance mutations and virologic failure, abstr. 639. 14th Conf. Retrovir. Opportun. Infect., Los Angeles, CA,
February 2007.
Karon, J. M., P. L. Fleming, R. W. Steketee, and K. M. De Cock. 2001. HIV
in the United States at the turn of the century: an epidemic in transition.
Am. J. Public Health 91:1060–1068.
Lansky, A., A. S. Abdul-Quader, M. Cribbin, T. Hall, T. J. Finlayson, R. S.
Garfein, L. S. Lin, and P. S. Sullivan. 2007. Developing an HIV behavioral
sruveillance system for injecting drug users: a national application of venuebased, time-space sampling. Public Health Rep. 122(Suppl. 1):48–55.
Lee, L. M., J. M. Karon, R. Selik, J. J. Neal, and P. L. Fleming. 2001. Survival
after AIDS diagnosis in adolescents and adults during the treatment era,
United States, 1984–1997. JAMA 285:1308–1315.
Lee, L. M., and M. T. McKenna. 2007. Monitoring the incidence of HIV
infection in the United States. Public Health Rep. 122(Suppl. 1):72–79.
Marks, G., N. Crepaz, and R. S. Janssen. 2006. Estimating sexual transmission of HIV from persons aware and unaware that they are infected with the
virus in the USA. AIDS 20:1447–1450.
Maslow, C. B., S. R. Friedman, T. E. Perlis, R. Rockwell, and J. D. C. Des.
2002. Changes in HIV seroprevalence and related behaviors among male
injection drug users who do and do not have sex with men: New York City,
1990–1999. Am. J. Public Health 92:382–384.
McQuillan, G. M., D. Kruszon-Moran, B. J. Kottiri, L. A. Kamimoto, L.
Lam, M. F. Cowart, M. Hubbard, and T. J. Spira. 2006. Prevalence of HIV
in the US household population: the National Health and Nutrition Examination Surveys, 1988 to 2002. J. Acquir. Immune Defic. Syndr. 41:651–656.
Montessori, V., N. Press, M. Harris, L. Akagi, and J. S. Montaner. 2004.
Adverse effects of antiretroviral therapy for HIV infection. CMAJ 170:229–
238.
Nakashima, A. K., and P. L. Fleming. 2003. HIV/AIDS surveillance in the
United States, 1981–2001. J. Acquir. Immune Defic. Syndr. 32(Suppl. 1):
S68–S85.
National Center for Health Statistics. October 2006, posting date. National
Health and Nutrition Examination Survey (NHANES). National Center for
Health Statistics, Hyattsville, MD. http://www.cdc.gov/nchs/about/major
/nhanes/nhanes01-02.htm.
Palella, F. J., Jr., K. M. Delaney, A. C. Moorman, M. O. Loveless, J. Fuhrer,
G. A. Satten, D. J. Aschman, and S. D. Holmberg. 1998. Declining morbidity
and mortality among patients with advanced human immunodeficiency virus
infection. N. Engl. J. Med. 338:853–860.
Panlilio, A. L., D. M. Cardo, L. A. Grohskopf, W. Heneine, and C. S. Ross.
2005. Updated U.S. Public Health Service guidelines for the management of
occupational exposures to HIV and recommendations for postexposure prophylaxis. Morb. Mortal. Wkly. Rep. Recomm. Rep. 54:1–17.
Parekh, B. S., M. S. Kennedy, T. Dobbs, C. P. Pau, R. Byers, T. Green, D. J.
Hu, S. Vanichseni, N. L. Young, K. Choopanya, T. D. Mastro, and J. S.
McDougal. 2002. Quantitative detection of increasing HIV type 1 antibodies
after seroconversion: a simple assay for detecting recent HIV infection and
estimating incidence. AIDS Res. Hum. Retrovir. 18:295–307.
Pomerantz, R. J., and D. L. Horn. 2003. Twenty years of therapy for HIV-1
infection. Nat. Med. 9:867–873.
Tang, J. W., and D. Pillay. 2004. Transmission of HIV-1 drug resistance.
J. Clin. Virol. 30:1–10.
UNAIDS. December 2006, posting date. AIDS epidemic update. UNAIDS, Geneva, Switzerland. http://data.unaids.org/pub/EpiReport/2006/2006_EpiUpdate_en
.pdf.
Wheeler, W., K. Mahle, U. Bodnar, R. Kline, I. Hall, and M. McKenna.
Antiretroviral drug-resistance mutations and subtypes in drug-naive persons
newly diagnosed with HIV-1 infection, US, March 2003-October 2006, abstr.
648. 14th Conf. Retrovir. Opportun. Infect. Los Angeles, CA, February 2007.
World Health Organization. 2006, posting date. Second generation surveillance for HIV/AIDS. World Health Organization, Geneva, Switzerland.
http://www.who.int/hiv/topics/surveillance/2ndgen/en/.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 489–510
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00005-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Current Status of Veterinary Vaccines
1
Els N. T. Meeusen, * John Walker,2 Andrew Peters,3 Paul-Pierre Pastoret,4 and Gregers Jungersen5
Animal Biotechnology Research Laboratories, Department of Physiology, Monash University, Victoria 3800, Australia1;
VMRD Pfizer Australia, 52 Poplar Rd., Parkville, Victoria 3052, Australia2; University of Edinburgh, Royal (Dick) School of
Veterinary Studies, Easter Bush, Roslin, Midlothian EH25 9RG, United Kingdom3; Publications Department,
World Organisation for Animal Health, 12 rue de Prony, 75017 Paris, France4; and National Veterinary Institute,
Technical University of Denmark, Bülowsvej 27, 1790 Copenhagen, Denmark5
cowpox virus to confer protection against the related human
smallpox virus and illustrates the close relationship between
human and animal infectious disease sciences. The criteria for
successful animal or veterinary vaccines can be very different
from those for human vaccines depending on the animal
groups under consideration. For example, criteria for companion animal vaccines are similar to those for human vaccines in
that the health and welfare of the individual animal are primary concerns. The main objective of livestock vaccines, on the
other hand, is to improve overall production for the primary
producers, and the cost-benefit resulting from vaccination is
the bottom line for this industry. Vaccination against zoonotic
or food-borne infections is aimed at reducing or eliminating
INTRODUCTION
In its original concept, vaccination aims to mimic the development of naturally acquired immunity by inoculation of nonpathogenic but still immunogenic components of the pathogen
in question, or closely related organisms. The term “vaccine”
(from the Latin term “vacca,” meaning cow) was first coined by
Edward Jenner to describe the inoculation of humans with the
* Corresponding author. Mailing address: Department of Physiology, Building 13f, Monash University, Clayton, Victoria 3800, Australia. Phone: 61 3 99052513. Fax: 61 3 99052547. E-mail: els.meeusen
@med.monash.edu.au.
489
m
INTRODUCTION .......................................................................................................................................................489
VETERINARY VIRAL VACCINES ..........................................................................................................................491
Conventional Live and Inactivated Viral Vaccines ............................................................................................491
DIVA Vaccines.........................................................................................................................................................492
Molecularly Defined Subunit Vaccines ................................................................................................................493
Genetically Engineered Viral Vaccines ................................................................................................................493
Live Viral Vector Vaccines.....................................................................................................................................494
DNA Vaccines ..........................................................................................................................................................495
VETERINARY BACTERIAL VACCINES................................................................................................................495
Conventional Live Vaccines...................................................................................................................................495
Conventional Inactivated Vaccines.......................................................................................................................496
Gene-Deleted Vaccines ...........................................................................................................................................496
Subunit Vaccines.....................................................................................................................................................497
Vaccines against Zoonotic Bacteria......................................................................................................................497
Rickettsia Vaccines .................................................................................................................................................498
VETERINARY PARASITE VACCINES ...................................................................................................................499
Protozoal Vaccines ..................................................................................................................................................499
Live protozoal parasite vaccines.......................................................................................................................499
(i) Vaccines based on complete life cycle infections ..................................................................................499
(ii) Vaccines based on drug-abbreviated infections ...................................................................................500
(iii) Vaccines based on infections with parasites with a truncated life cycle.........................................500
(iv) Vaccines based on infection with virulence-attenuated strains ........................................................500
Killed or subunit protozoal parasite vaccines ................................................................................................500
Helminth and Ectoparasite Vaccines ...................................................................................................................501
VETERINARY VACCINES FOR NONINFECTIOUS DISEASES.............................................................................502
Allergy Vaccines ......................................................................................................................................................502
Cancer Vaccines ......................................................................................................................................................502
VETERINARY VACCINES FOR FERTILITY AND PRODUCTION CONTROL ............................................502
Design of Reproduction Control Vaccines ..........................................................................................................503
Vaccines against Reproductive Hormones ..........................................................................................................503
Vaccines against Gamete Antigens: Wildlife Control ........................................................................................504
Sperm antigens....................................................................................................................................................504
Oocyte antigens ...................................................................................................................................................504
Vaccines To Increase Fertility...............................................................................................................................505
CONCLUSION AND FUTURE DIRECTIONS......................................................................................................505
ACKNOWLEDGMENTS ...........................................................................................................................................506
REFERENCES ............................................................................................................................................................506
490
MEEUSEN ET AL.
CLIN. MICROBIOL. REV.
FIG. 1. Simplified schematic representation of immune mechanisms that can act to protect animals against invading viral, bacterial, and
protozoal pathogens or against multicellular helminth parasites. Viral, bacterial, or protozoal pathogens (red ovals) that infect non-antigenpresenting cells can be killed by cytotoxic T cells (CTL) that recognize pathogen-derived epitopes presented in conjunction with major histocompatibility complex (MHC) class I on infected cells or by antibody-dependent lysis or opsonization of infected cells expressing pathogen molecules.
Extracellular pathogens, or intracellular pathogens on their way to infect other cells, can be attacked by specific circulating antibodies and either
killed by lysis or agglutination or phagocytosed by macrophages and neutrophils. Both antibody and CTL induction requires help from pathogenspecific CD4 helper T cells that are activated after interaction with pathogen-derived epitopes presented in conjunction with MHC class II
molecules on the surface of MHC class II⫹ antigen-presenting cells. If pathogens infect antigen-presenting cells, they can be killed directly by CD4
T cells as well as CD8 CTL through the induction of mediators such as gamma interferon (IFN-␥), reactive oxygen and nitrogen species, and
indoleamine 2,3-dioxygenase (IDO). Toxins released by pathogens (red circles) can be neutralized by circulating antibodies, thereby decreasing
clinical signs of infection. Multicellular helminth parasites generally do not reside within host cells and are too large to be phagocytosed; therefore,
they usually require alternative immune killer mechanisms mediated by antibody-directed actions of mast cells and eosinophils. Essential secreted
proteins and toxins derived from the worms (brown circles) may also be neutralized by antibodies and thereby interfere with parasite growth.
the risk for the consumer and in some cases to improve the
productivity of the individual animal. Vaccination of wildlife is
generally considered only with respect to infections that are
transmittable to humans (zoonotic diseases), although welfare
concerns are of increasing importance.
While veterinary vaccines comprise only approximately 23%
of the global market for animal health products, the sector has
grown consistently due mainly to new technological advances
in vaccine development, the continuous development of drug
resistance by pathogens, and the emergence of new diseases.
Apart from improving animal health and productivity, veterinary vaccines have a significant impact on public health
through reductions in the use of veterinary pharmaceuticals
and hormones and their residues in the human food chain.
This will be an increasing impetus for activity with the more
stringent requirements of regulatory agencies and consumer
groups, particularly in the major markets of Europe and the
United States (166). For example, the use of antibiotics in
animal production has already been severely restricted, and the
European Union has recently banned the use of coccidiostats
for poultry. In addition, vaccines contribute to the well-being
of livestock and companion animals, and their use is favored by
the growing animal welfare lobby.
The process of developing veterinary vaccines has both advantages and disadvantages over human vaccine development.
On the one hand, the potential returns for animal vaccine
producers are much less than those for human vaccines, with
lower sales prices and smaller market sizes, resulting in a much
lower investment in research and development in the animal
vaccine area than in the human vaccine area, although the
complexity and range of hosts and pathogens are greater. For
example, the market size for the recently launched human
vaccine (Gardasil) against papillomavirus and cervical cancer
is estimated to be greater than 1 billion U.S. dollars, while the
most successful animal health vaccines (e.g., against foot-andmouth disease [FMD] virus in cattle and Mycoplasma hyopneumoniae in pigs) enjoy a combined market size that is 10 to 20%
of this figure. On the other hand, veterinary vaccine development generally has less stringent regulatory and preclinical
trial requirements, which can make up the largest cost in human vaccine development, and a shorter time to market launch
and return on investment in research and development. In
contrast to human vaccine development, veterinary scientists
are also able to immediately perform research in the relevant
target species. This is an obvious advantage over human vaccine development, as experimental infections, dose-response
studies, and challenge inoculations need not be carried out in
less relevant rodent models.
Immunity acquired through natural infection can take on
several forms depending on the type and life cycle of the
pathogen, as schematically represented in Fig. 1. Vaccines may
be used to prevent clinical signs of disease after infection or to
help control, eliminate, or even eradicate an infection at the
population level (e.g., the expected global eradication of
rinderpest virus through vaccination). Both vaccine effectiveness and mechanism of action may vary depending on the
VOL. 20, 2007
VETERINARY VACCINES
491
TABLE 1. Second-generation licensed/commercialized veterinary viral vaccines
Target pathogen
Target
animal
Brand name(s)a
Distributor
PCV2
Pigs
Porcilis-PCV2
Intervet
PCV2
Pigs
Suvaxyn PCV2
Fort Dodge
Pseudorabies virus
Pigs
Suvaxyn Aujeszky
Fort Dodge
Classical swine fever
virus
Classical swine fever
virus
BHV-1
Pigs
Porcilis Pesti
Intervet
Pigs
Bayovac CSF E2
Bayer Leverkusen
Cattle
Bovilis IBR Marker
Intervet
Equine influenza virus
Horses
Merial
WNV
WNV
WNV
MDV (HTV) and
IBDV
Horses
Horses
Horses
Poultry
PROTEQ-FLU (European
Union), Recombitek (United
States)
PreveNile
West Nile-Innovator DNA
RECOMBITEKEquine WNV
Vaxxitek HVT⫹IBD
Newcastle disease virus
Poultry
NA
Dow AgroSciences
Newcastle disease virus
Avian influenza virus
(H5N1) and NDV
Avian influenza virus
Poultry
Poultry
Vectormune FP-ND
Biomune
Intervet
Poultry
Poulvac FluFend I AI H5N3 RG
Fort Dodge
Trovac AI H5
Raboral
Merial
Merial
Rabies virus
Rabies virus
Feline leukemia virus
Canine parvovirusl
Canine coronavirus
Canine distemper virus
Poultry
Wildlife,
canines
Cats
Cats
Cats
Dogs
Dogs
Dogs
Purevax Feline Rabies
PUREVAX Feline Rabies
EURIFEL FeLV
RECOMBITEK Canine Parvo
RECOMBITEK Corona MLV
RECOMBITEK rDistemper
Merial
Merial
Merial
Merial
Merial
Merial
Canine distemper virus
IHN virus
Fur animals
Salmon
PUREVAXFerret Distemper
Apex-IHN
Merial
Novartis (Aqua Health)
Avian influenza virus
Rabies virus
a
Intervet
Fort Dodge
Merial
Merial
Characteristic(s)
Inactivated baculovirus expressed PCV2
ORF2 protein; adjuvanted
Inactivated PCV1-2 chimera;
adjuvanted
gE- and thymidine kinase-deleted
marker vaccine
Baculovirus recombinant E2 protein
without emulsion
Baculovirus recombinant E2 protein
without emulsion
Live or inactivated gE-deleted marker
vaccine
Canarypox virus-vectored vaccine
Live flavivirus chimera vaccine
DNA vaccine
Canarypox virus-vectored vaccine
Live recombinant chimera virus
expressing VP2 gene of IBD on
HTV virus
HN recombinant produced in plant cell
lines (registered but not on market)
Fowlpox virus vectored
Chimera virus on NDV backbone; field
trials in 2007
Chimera H5N3 virus, inactivated in
oil-based adjuvant
Fowlpox virus-vectored H5
Vaccinia virus recombinant
Canarypox virus-vectored
Canarypox virus-vectored
Canarypox virus-vectored
Modified live virus
Modified live virus
Canarypox virus-vectored
(HA and F antigens)
Canarypox virus-vectored
DNA vaccine
Reference(s)
20
55
56
181
116
185
113
114
45
113
43
133, 187
29
26, 100, 152,
170
vaccine
vaccine
vaccine
132
vaccine
vaccine
Brand names may differ between countries. NA, not applicable.
required outcome. New technologies to achieve the selective
induction of effective immune responses in the development of
new vaccines are becoming available to vaccine researchers
and have been extensively reviewed in recent papers (33, 136,
163, 166). Notwithstanding the scientific advances, the single
factor that determines the success of an experimental vaccine
is its successful commercialization and/or use in the field. This
outcome requires a combination of basic research, commercial
imperatives, local requirements, and global perspectives depending on the particular disease under investigation. These
four aspects are represented by the authors of this review,
which will concentrate on recent advances in veterinary vaccines that have reached the marketplace or are actively produced by veterinary institutes for use by local farming communities.
VETERINARY VIRAL VACCINES
As there are no broad-spectrum antiviral pharmaceuticals
available, hygienic measures to limit exposure and vaccination
are the only means to prevent or control viral infections. Viruses (especially RNA viruses) are highly variable, and many
viral infections are due to viruses with multiple serotypes (e.g.,
FMD virus, bluetongue virus, and influenza viruses). As a
consequence, many of the existing viral vaccines are often
unable to cope with the prevailing strains in the field, and new
ones have to be generated from field strains with new outbreaks. Numerous conventional live and inactivated viral vaccines have been produced by animal health companies and
have been used for many decades in routine vaccination protocols for both companion and production animals. Increasingly, a number of rationally designed and subunit vaccines are
reaching the market, and this section will concentrate mainly
on these “second-generation” viral vaccines (summarized in
Table 1).
Conventional Live and Inactivated Viral Vaccines
As with the first vaccine for human smallpox, most live
veterinary viral vaccines induce mild infections with live organisms derived from nontarget hosts or attenuated through passage in different cell line cultures or chicken embryos (eggs).
Attenuated viral strains are also obtained by inducing random
mutations and selecting for reduced virulence. As the live
organism can still infect target cells, these vaccines can replicate and induce both cellular and humoral immunity and generally do not require an adjuvant to be effective. Live products
also offer the advantage of ease of administration, potentially
in drinking water, intranasally, intraocularly, etc. However,
they can pose a risk of residual virulence and reversion to
492
MEEUSEN ET AL.
pathogenic wild types as well as provide a potential source of
environmental contamination. Although modern regulatory
processes require data to provide assurance on these issues,
problems in the field can arise. This was highlighted during a
program to control porcine respiratory and reproductive syndrome (PRRS) in Denmark. This disease first emerged in
North America in the late 1980s and spread quickly in Europe
in the early 1990s. The two main types of PRRS virus, European and North American, are only 55 to 80% identical at the
nucleotide level (122) and cause distinguishable serological
responses. Following vaccination with the live, attenuated
North American PRRS vaccine against the European PRRS
virus type present in Denmark in 1996, the vaccine virus reverted and spread within vaccinated herds as well as from
vaccinated to nonvaccinated herds, leaving both virus types in
the Danish pig population (120).
Despite such drawbacks of live viral vaccines, they have
played a major role in successful disease control and eradication. For example, the virtual eradication of rinderpest virus
from the globe is widely believed to have been critically dependent on the use of the “Plowright” vaccine (12, 150). This
is an attenuated vaccine produced from the Kabete O strain
passaged 90 times in tissue culture (141). The vaccine virus was
recently found to have attenuating mutations in most of its
genes, none of which are sufficiently debilitating to induce
strong pressure for reversion (11). Although there are examples of stable attenuations from a single point mutation in the
polymerase gene, the high rate of spontaneous mutations of
RNA viruses increases the risk for reversion to virulence. Safe
live viral vaccines are therefore likely to require a number of
attenuating mutations distributed throughout the genome.
Whole inactivated or killed viral vaccines are generally more
stable and do not pose the risk of reversion to virulence compared to live vaccines, but their inability to infect cells and
activate cytotoxic T cells makes them much less protective.
Consequently, they generally require strong adjuvants and several injections to induce the required level of immunity and are
usually effective in controlling only clinical signs rather than
infection (113). Inactivated adjuvanted vaccines also pose a
greater risk of causing autoimmune diseases, allergic disorders,
and vaccine injection site sarcomas (46). Viral inactivation is
commonly achieved through heat or chemicals (e.g., formaldehyde, thiomersal, ethylene oxide, and ␤-propriolactone). The
higher production cost and need for adjuvants make these
vaccines more expensive to manufacture. Inactivated viral vaccines for a wide range of viral diseases have been available for
several decades (reviewed in references 113 and 121) and are
still being developed for some recently emergent diseases. For
example, a one-dose inactivated porcine circovirus type 2
(PCV2) vaccine has recently been licensed in the United States
for the prevention of postweaning multisystemic wasting syndrome in pigs (Table 1). Much of the recent research in this
area has concentrated on the development of improved adjuvanted formulations to overcome the effects of maternal antibodies on young animals (see, for example, reference 17).
Inactivated vaccines for several viral diseases need to be
continuously adapted to contain the appropriate serotypes, as
exemplified by equine influenza virus vaccines. Vaccines for
equine influenza virus, mostly inactivated, have been available
since the 1960s (28). The most important equine subtypes are
CLIN. MICROBIOL. REV.
H7N7 and H3N8, although H7N7 has not been detected for
several decades and is no longer included in vaccines, at least
in Europe and the United States (130). Conversely, vaccination
against H3N8 has been less effective, possibly due to antigenic
drift, and there are now considered to be two distinct lineages,
European and United States, and vaccines therefore tend to
contain both. Over the years, improvements have been attempted, and more potent adjuvants have been used. Several
European vaccines now produce high antibody responses that
last for up to 1 year (113). Until recently, equine influenza
virus vaccines produced in the United States have been considered to be of limited efficacy and sometimes lacking the
relevant H3N8 strains (M. Mellencamp and A. Schultze, presented at the Proceedings Quality Control of Equine Influenza
Vaccines, Budapest, Hungary, 2001).
DIVA Vaccines
For several viral infections of livestock, effective conventional vaccines are available but cannot be used, as they would
interfere with disease surveillance based on serological testing
and may result in the loss of a country’s disease-free status. A
classic example is FMD in cattle. Although inactivated FMD
vaccines have been available for many years and are quite
effective in controlling clinical disease (49), they are not used
in FMD-free countries, as this would compromise this status
and hence international trade. Nevertheless, conventional vaccines have reduced the prevalence of disease in enzootic areas,
and in a recent outbreak in The Netherlands, vaccination was
used to reduce the spread of the disease (142), although the
vaccinates were subsequently slaughtered to enable the rapid
reestablishment of the FMD-free status of the country.
The ability to identify and selectively delete genes from a
pathogen has allowed the development of “marker vaccines”
that, combined with suitable diagnostic assays, allow differentiating infected from vaccinated animals (DIVA) by differentiation of antibody responses induced by the vaccine (no antibodies generated to deleted genes) from those induced during
infection with the wild-type virus (e.g., see Fig. 2). Such DIVA
vaccines and their companion diagnostic tests are now available or in development for several diseases including infectious
bovine rhinotracheitis (IBR), pseudorabies, classical swine fever (CSF), and FMD, as detailed below.
IBR, caused by bovine herpesvirus type 1 (BHV-1) infection
of cattle, and pseudorabies (Aujeszky’s disease) in pigs have
been identified internationally as being candidates for eradication from national herds, and so there has been an impetus
for the development of DIVA vaccines and diagnostics. The
demand for a marker (DIVA) vaccine for IBR in Europe was
met by the development of a glycoprotein E (gE)-deleted vaccine using conventional methodology (reviewed in reference
185). The gE protein is not essential for viral replication, but it
plays a major role in intercellular spread, particularly along
nerves. Specific diagnostic tests based on gE deletion have
been developed using both gE-blocking enzyme-linked immunosorbent assay (ELISA) techniques and PCR amplification
(138, 159).
Deletion of the gE gene has also been used to enable a
DIVA approach for an Aujeszky’s disease vaccine (137). The
gene for thymidine kinase is also deleted in some formulations
VOL. 20, 2007
VETERINARY VACCINES
493
proaches for FMD (reviewed in references 8 and 66). Subunit
antigen approaches to vaccination have been largely ineffective, as they present only a limited number of epitopes to the
animal’s immune system, and multiple antigens are generally
required for protection. Current research is focused largely
on combinations of capsid proteins, including empty capsid
delivered by various expression systems, and the development of sensitive tests (ELISA) for antibodies against nonstructural proteins (66). Other diseases for which a DIVA
approach is highly desirable but currently unavailable include bluetongue virus in cattle, Newcastle disease virus and
avian influenza virus in poultry, bovine viral diarrhea, and
equine viral arteritis.
Molecularly Defined Subunit Vaccines
FIG. 2. Simplified representation of the reverse genetic approach
used to construct the chimera vaccine Poulvac FluFend i AI H5N3 RG
to protect poultry against the pathogenic H5N1 virus. The HA gene
was removed from an H5N1 virus (from a recent Asian outbreak),
inactivated by removing the polybasic amino acid sequences, and
combined with the NA gene from an H2N3 virus onto an H1N1
“backbone” virus. An immunoassay able to specifically detect antibodies against N3 and N1 proteins could be used for DIVA (i.e.,
N3⫹ N1⫺ indicates vaccinated, and N3⫺ N1⫹ indicates infected).
(Modified from Fort Dodge Poulvac FluFend i AI H5N3 RG promotional flyer with permission.)
(e.g., Suvaxyn Aujesky), adding to the degree of attenuation
(e.g., see reference 56). These deletion vaccines have been
available since the 1980s, and their use has contributed to
disease control and eradication in the United States and several European countries (e.g., see reference 24).
CSF is on the World Organization for Animal Health list of
notifiable diseases and is one of the most important contagious
diseases of pigs worldwide. In its classical clinical form, it is an
acute hemorrhagic disease accompanied by high fever, depression, anorexia, and conjunctivitis. Morbidity and mortality are
both very high and may reach 100%. However, it can also
present as a subacute, chronic, or even subclinical condition.
Countries in which the disease is enzootic tend to vaccinate
with a very effective live, attenuated vaccine, while those that
are free of disease do not (reviewed in reference 13). Two
subunit vaccines based on the viral envelope glycoprotein E2
produced in a baculovirus/insect cell system, formulated in a
water-in-oil adjuvant, and accompanied by discriminatory
ELISA tests are available (116, 181). These vaccines will allow
a DIVA approach to emergency vaccination and disease control in the case of new outbreaks, although these have not yet
been used widely in the field and appear to be less protective
than conventional live, attenuated CSF vaccines (13).
As there are now major doubts about the sustainability of
“stamping-out” policies in areas of high animal population
density, there is considerable investment in DIVA vaccine ap-
Identification of the protective viral antigens potentially allows their isolation and/or recombinant production so that they
can be administered as safe, nonreplicating vaccines. However,
as isolated antigens generally induce poor protective immunity,
subunit vaccines usually require repeated administration with
strong adjuvants, making them less competitive. Notwithstanding these limitations, there are some examples of effective
subunit vaccines.
PCV2 is considered to be the major pathogen in the etiology
of postweaning multisystemic wasting syndrome (2). A recombinant baculovirus producing the protective ORF2 protein of
PCV2 has recently become available as a vaccine for pigs (20).
Dow AgroSciences successfully registered the first plantbased vaccine for Newcastle disease virus in poultry in the
United States in 2005. Recombinant viral HN protein was
generated in plant cell lines via Agrobacterium transformation
and could successfully protect chickens from viral challenge
(G. A. Cardineau, H. S. Mason, J. Van Eck, D. D. Kirk, and
A. M. Walmsley, 2004, PCT patent application 60/467,998, WO
2004/098533; C. A. Mihaliak, S. Webb, T. Miller, M. Fanton,
D. Kirk, G. Cardineau, H. Mason, A. Walmsley, C. Arntzen,
and J. Van Eck, presented at the 108th Annual Meeting of the
United States Animal Health Association, Greensboro, NC,
2005). This process was a proof-of-concept exercise designed
to test regulatory feasibility, and the product is not on the
market.
Genetically Engineered Viral Vaccines
The availability of complete DNA sequences and a better
understanding of gene function have allowed specific modifications or deletions to be introduced into the viral genome,
with the aim of producing well-defined and stably attenuated
live or inactivated viral vaccines.
Gene-deleted vaccines (glycoprotein I and/or glycoprotein
X) against pseudorabies allowed a DIVA approach and control of Aujeszky’s disease in swine (96); however, the potential
for recombination between pseudorabies virus strains has
raised concern (101). Similarly, thymidine kinase deletion in
BHV-1 vaccines has been associated with latency and reactivation after treatment with dexamethasone (194), and deletion
of multiple genes has been proposed in order to improve safety
(14).
An interesting development in genetically engineered viral
494
MEEUSEN ET AL.
vaccines is the production of chimera viruses that combine
aspects of two infective viral genomes. A chimera PCV1-2
vaccine has the immunogenic capsid gene of PCV2 cloned into
the backbone of the nonpathogenic PCV1 and induces protective immunity to wild-type PCV2 challenge in pigs (55). A
further sophistication of this approach is a recently developed
vaccine against avian influenza virus (Poulvac FluFend), where
the hemagglutinin (HA) gene has been removed from an
H5N1 virus, inactivated by removing the polybasic amino acid
sequences, and combined with the NA gene from an H2N3
virus onto an H1N1 “backbone” virus (Fig. 2). A vaccine containing the resultant inactivated H5N3-expressing virus administered in a water-in-oil emulsion protects chickens and ducks
against the highly pathogenic H5N1 strain.
Similarly, a live Flavivirus chimera vaccine against West Nile
virus (WNV) in horses (PreveNile) was registered in the
United States in 2006. In this chimera vaccine, the structural
genes of the attenuated yellow fever YF-17D backbone virus
have been replaced with structural genes of the related WNV.
The resulting chimera vaccine express the PreM and E proteins of WNV, while the nucleocapsid (C) protein, nonstructural proteins, and nontranslated termini responsible for virus
replication remain those of the original yellow fever 17D virus
(114). After a single shot, the vaccine stimulates both cellmediated and humoral responses without causing any clinical
illness or spreading to sentinel horses and provides protection
against WNV challenge for up to 12 months (PreveNile package insert). A similar vaccine could be a candidate for a human
WNV vaccine (115).
Live Viral Vector Vaccines
Poxviruses including vaccinia virus, fowlpox virus, and canarypox virus have been used as vectors for exogenous genes,
as first proposed in 1982 (131), both for the delivery of vaccine
antigens and for human gene therapy. Poxviruses can accommodate large amounts of foreign genes and can infect mammalian cells, resulting in the expression of large quantities of
encoded protein. For example, modified vaccinia virus Ankara
is a highly attenuated strain produced by several hundred passages of the virus in chicken cells. Modified vaccinia virus
Ankara lacks about 10% of the vaccinia virus genome, including the ability to replicate in mammalian cells (reviewed in
reference 139).
A particular success story has been the development of an
oral recombinant vaccinia-rabies vaccine in bait for wild carnivores such as foxes in Europe (26) and foxes, raccoons, and
coyotes in the United States (152, 170). Rabies is caused by a
negative-stranded Rhabdoviridae RNA virus transmitted
mainly via saliva following a bite from an infected animal. The
main source of infection for humans is domestic reservoir
species including dogs and cats. There are seven rabies virus
genotypes, all of which, excluding type 2, produce similar effects in humans. Rabies can infect most if not all mammals.
The virus enters the central nervous system, causing an encephalomyelitis that is always fatal once symptoms develop.
Worldwide, the disease causes many thousands of human
deaths each year. One type of oral vaccine is in the form of a
bait containing a recombinant vaccinia virus vector expressing
the protective glycoprotein G of rabies virus (100, 135). After
CLIN. MICROBIOL. REV.
several years of vaccination campaigns against fox rabies virus
in several Western European countries, rabies could be eliminated from its wildlife terrestrial reservoir, as exemplified by
the successful elimination of terrestrial rabies virus from Belgium and France (26, 135, 136).
The canarypox virus vector system ALVAC has been used as
a platform for a range of veterinary vaccines including WNV,
canine distemper virus, feline leukemia virus, rabies virus, and
equine influenza virus (176) (Table 1). Canarypox virus was
originally isolated from a single pox lesion in a canary and
serially passaged 200 times in chicken embryo fibroblasts and
serially plaque purified under agarose (Merial bulletin TSB-40019-FTB). Canarypox viruses and fowlpox viruses have the
advantage of being more host restricted than vaccinia virus.
While they produce an abortive infection in mammalian cells,
canarypox virus recombinants still effectively express inserted
foreign genes. Several veterinary viral vaccines have been produced using the ALVAC vector system (Table 1). Most notably, a novel equine influenza virus vaccine using the canarypox
vector to express the hemagglutinin genes of the H3N8 Newmarket and Kentucky strains has recently been registered in
the European Union (Proteq-Flu) (113) and the United States
(Recombitek). It contains a polymer adjuvant (Carbopol; Merial Ltd.), and through the induction of both cell-mediated and
humoral immunity, it is claimed to produce sterile immunity 2
weeks after the second of two doses. The new vaccine is also
designed to protect horses against the highly virulent N/5/03
American strain of equine influenza virus and to prevent the
virus from spreading through the elimination of viral shedding.
Trovac AI H5 is a recombinant fowlpox virus expressing the
H5 antigen of avian influenza virus. This product has had a
conditional license for emergency use in the United States
since 1998 and has been widely used in Central America, with
over 2 billion doses administered (29). As the vaccinated birds
will not develop antibodies against matrix protein/nucleoprotein, this vaccine can also be used with a DIVA approach.
Several vaccines are available based on inactivated adjuvanted formulations for equine herpesvirus type 1 and equine
herpesvirus type 4, equine herpesviruses that are major causes
of abortion and respiratory disease. None of these vaccines are
considered to provide complete clinical or virological protection (113). A canarypox virus-vectored vaccine containing the
genes for gB, gC, and gD has been developed, but the latest
reports suggested that it did not completely protect against
challenge (113).
A further application of vectored vaccines is the use of an
attenuated viral pathogen as the vector, with the aim of inducing protection against two diseases, as with the live recombinant vaccine against both Marek’s disease virus (MDV) and
infectious bursal disease virus (IBDV) in chickens (Vaxxitek
HVT ⫹ IBD). MDV is a highly contagious neoplastic disease
of poultry caused by gallid herpesvirus type 2, while IBDV
replicates in the bursa of Fabricius, the primary lymphoid organ in birds, and causes a serious immunosuppressive condition in poultry flocks worldwide. Turkey herpesvirus (HVT) is
nonpathogenic in chickens but confers cross-protection against
MDV and has traditionally been used in live vaccines against
MDV. The new vaccine is based on a recombinant parent HVT
virus expressing the VP2 gene of IBDV (44) and can be given
to embryonated eggs or 1-day-old chicks without interference
VOL. 20, 2007
VETERINARY VACCINES
from maternally derived antibodies. Data from large-scale field
trials for this vaccine have not yet been reported, but those
studies may encounter difficulties in maintaining high efficacy.
This is because these tightly regulated recombinant vaccines
cannot easily adapt to meet the emergence of very virulent
strains of both IBDV and MDV, apparently induced by the
comprehensive numbers of vaccinations performed against
these diseases (81, 146).
Chimera avian influenza virus vaccines have also recently
been produced on a backbone of an existing, attenuated Newcastle disease virus vaccine strain. Both Asian H5N1 and the
pathogenic H7N7 strain, responsible for the chicken influenza
virus outbreak in The Netherlands in 2003, were produced as
chimeras with the Newcastle disease virus strain. This chimera
vaccine induced strong protection against the respective wildtype influenza virus as well as against Newcastle disease virus
(133, 187).
DNA Vaccines
Immunization of animals with naked DNA encoding protective viral antigens would in many ways be an ideal procedure
for viral vaccines, as it not only overcomes the safety concerns
of live vaccines and vector immunity but also promotes the
induction of cytotoxic T cells after intracellular expression of
the antigens. Furthermore, DNA vaccines are very stable and
do not require a cold chain. While DNA vaccination of large
animals has not been as effective as initially demonstrated in
mice, several groups have obtained significant improvements in
immune responses using innovative technologies such as specific targeting of the vaccine antigen to antigen-presenting cells
(85), priming-boosting with stimulating CpG oligodeoxynucleotides (85, 97), and in vivo electroporation of DNA (155).
Considerable research into DNA vaccines for fish viruses,
where this approach seems to be particularly effective (73, 99),
has been ongoing. Notably, the first DNA vaccine for an edible
species (Apex-IHN) was registered in 2005 in Canada to protect Atlantic salmon from infectious hematopoietic necrosis
(IHN) (167). IHN disease is enzootic in wild salmon populations and can cause devastating outbreaks in farm-raised
salmon that have had no prior exposure. The DNA vaccine
encodes a surface glycoprotein of IHN virus and is administered intramuscularly (99).
A DNA vaccine to protect horses against viremia caused by
WNV (West Nile-Innovator DNA) received a license from the
USDA at approximately the same time as the fish DNA vaccine. WNV infection is caused by a flavivirus belonging to the
Japanese encephalitis virus complex. It is enzootic in parts of
Africa and Asia but was first detected in the United States in
1999 in an outbreak involving birds, horses, and humans in
New York, and it subsequently spread rapidly to many states
(62). The DNA plasmid codes for the WNV outer coat proteins and is administered with a proprietary adjuvant (143).
The vaccine was, however, produced as part of a buildingplatform technology rather than as a commercial product, as
the manufacturer already has a WNV vaccine on the market.
The success of these two DNA vaccines may be due more to
good fortune than to any specific technological advances, as
DNA uptake into fish muscle seems to be unusually efficient
(99), and the WNV viral protein may be particularly effective
495
because it naturally produces highly immunogenic virus-like
particles (161). It is likely that a wider application of DNA
vaccines will require further improvements and optimization
for each host-pathogen combination.
VETERINARY BACTERIAL VACCINES
Many attenuated live or inactivated (killed) bacterial vaccines have been available for decades as prophylaxis against
bacterial diseases in veterinary medicine. For most of the attenuated bacterial strains, the nature of the attenuation is not
known, and since they have a proven track record, little is done
to characterize underlying genetics. In some cases, however,
the old and well-recognized live strains are not highly protective, and continued research is being performed to improve
and develop new vaccines or vaccination strategies against,
e.g., bovine tuberculosis, paratuberculosis, and brucellosis, as
described below. Inactivated vaccines generally consist of bacterins of one or more bacterial species or serotypes (i.e., crude
formalin-killed whole bacterial cultures and supernatants) or
more well-defined subunit antigens formulated most often in
an oil or aluminum hydroxide adjuvant.
Many of the established bacterial vaccines are highly efficacious, but since the technology has been available for many
years, these conventional vaccines will not be dealt with in this
review, and the reader is referred to company websites for
information on specific diseases and vaccines. Both live and
inactivated autogenous bacterial vaccines are also produced
by local veterinary institutions or specialized companies for
on-farm specific demands where no commercial vaccines are
available.
This section will review some of the more recent additions to
bacterial veterinary vaccines (summarized in Table 2), with
particular focus on the more molecularly defined vaccines.
Conventional Live Vaccines
In spite of modern technological advances, new live vaccines based on strains without identification of the attenuating characteristics continue to reach the market. One such
example is a new live vaccine (Enterisol Ileitis) against porcine proliferative enteropathy caused by the obligate intracellular bacterium Lawsonia intracellularis. Identification of
L. intracellularis as the cause of this disease was established
in 1993 (107), and many features of the causal bacteria as
well as the immunopathogenesis remain to be elucidated.
The vaccine strain was cultivated from a clinical isolate, and
there are no phenotypic or genotypic characteristics to separate this strain from wild-type strains. Following oral administration of the vaccine, there appear to be no or delayed
fecal shedding of bacteria and a low or absent induction of
systemic humoral or cell-mediated immunity, but fecal shedding upon challenge is reduced and weight gain is increased
compared to unvaccinated pigs (67, 90). The vaccine has
been licensed to improve weight gain and to reduce growth
variability associated with ileitis in pigs and is administered
through drinking water.
496
MEEUSEN ET AL.
CLIN. MICROBIOL. REV.
TABLE 2. Recently commercialized veterinary bacterial vaccines
Target pathogen(s)
Target
animal
Brand name
Lawsonia intracellularis
Pigs
Enterisol Ileitis
Porphyromonas gulae,
P. denticanis, and
P. salivosa
Yersinia ruckeri
Dogs
Periovac
Fish
AquaVac ERM
Aeromonas salmonicida
Fish
Vibrio anguillarum
Fish
Streptococcus equi
Chlamydophila abortus
Distributor
Characteristic(s)
Boehringer-Ingelheim
Vetmedica
Pfizer Animal Health
Live oral vaccine
Killed oral vaccine
Horses
Sheep
AquaVac
Furuvac
AquaVac
Vibrio
Equilis StrepE
Ovilis Enzovax
Schering-Plough Animal
Health
Schering-Plough Animal
Health
Schering-Plough Animal
Health
Intervet
Intervet
Mycoplasma synoviae
Chickens
Vaxsafe MS
Bioproperties
Mycoplasma
gallisepticum
Bordetella avium
Chickens
Vaxsafe MG
Bioproperties
Turkeys
Art Vax
Actinobacillus
pleuropneumoniae
Actinobacillus
pleuropneumoniae
Salmonella
Pigs
PleuroStar APP
Schering-Plough Animal
Health
Novartis Animal Health
Pigs
Porcilis APP
Intervet
Chickens and
hens
Cattle
Megan Vac1
MeganEgg
RB-51
Lohman Animal Health
International
Colorado Serum Company
CZ Veterinaria
Brucella abortus
Conventional Inactivated Vaccines
An interesting new addition to the repertoire is a vaccine
consisting of inactivated bacterins of Porphyromonas gulae, P.
denticanis, and P. salivosa for vaccination against periodontal
disease in dogs (Periovac). The vaccine is based on research
identifying these three bacteria as being the most common
black-pigmenting anaerobic bacteria in periodontal pockets of
dogs and were all pathogenic in a mouse model (70). A vaccine
prepared from P. gulae and administered subcutaneously to
mice was able to significantly reduce alveolar bone loss in this
model (71). There are no published details on the performance
of the trivalent vaccine in dogs, but efficacy and potency trials
are ongoing with, e.g., a clinical trial running at the University
of Minnesota Veterinary Medical Center. Despite the lack of
published efficacy data, the vaccine is currently fully licensed in
New Zealand and conditionally licensed in the United States.
A killed oral vaccine (AquaVac ERM) against enteric redmouth disease caused by Yersinia ruckeri in rainbow trout has
been available in United Kingdom since 2001 and is now further approved for a number of European countries. Enteric
redmouth disease is a serious infectious disease of farmed
rainbow trout in many countries characterized by congestive or
hemorrhagic zones in various tissues and organs, particularly
around the mouth and in the intestines. The disease has a very
high mortality rate, and Y. ruckeri is able to form biofilms on
fish tank surfaces and thus persist and remain infective in the
aquatic environment, with the possibility of recurrent infections (39). Immersion of fry for 30 s into a vaccine soup at the
hatchery provides initial protection for fingerlings but rarely
lasts throughout the production cycle. Follow-up booster vaccination by injection is effective, but this is time-consuming and
labor-intensive and may be stressful for the handled fish. The
oral vaccine protocol recommends a primary immersion vac-
Reference(s)
67, 90
Killed vaccine against periodontitis
64
Killed oral vaccine
Killed oral vaccine
Live submucosal vaccine; deletions in aroA gene
Live temperature-sensitive mutant strain for
subcutaneous or intramuscular injection
Live temperature-sensitive mutant strain; eye drop
administration
Live temperature-sensitive mutant strain; eye drop
administration
Live temperature-sensitive mutant strain; spray
inhalation or drinking water
Recombinant ApxII, TbpB, CysL, OmlA(1), and
OmlA(2) proteins
Extracted ApxI, ApxII, ApxIII, and outer membrane
proteins
Double gene-deleted S. enterica serovar Typhimurium
strain
Spontaneous rifampin-resistant rough mutant
80
34
119
10
79
186
35
5
118
cination followed 4 to 6 months later by an oral booster of the
vaccine, which is mixed and absorbed into the feed pellets.
Both the primary and booster vaccine formulations are inactivated bacterial cultures, but for oral vaccination, the bacteria
are incorporated into an “antigen protection vehicle,” bypassing the acidic environment of the gut and delivering the antigens to the area of the hindgut (64). There are no data available on the nature of the antigen protection vehicle, but the
product résumé claims the presence of lecithin and fish oil,
indicating that killed bacteria are likely incorporated into liposome structures (61). Similar vaccines against furunculosis
caused by Aeromonas salmonicida and vibriosis caused by
Vibrio anguillarum have also been developed, and an oral vaccine against infectious pancreatic necrosis virus is registered in
Chile for use in salmon. To our knowledge, these are the only
licensed inactivated mucosal vaccines against bacterial diseases
in veterinary medicine.
Gene-Deleted Vaccines
Traditionally, attenuation of bacteria for the preparation of
live vaccines has been performed by multiple passages in various media in the hope that some random mutation would
deliver a nonvirulent, but replicable, type of the agent. With
currently used molecular methods, the obtained deletions/mutations can be identified, but this technology also allows a more
targeted design of live vaccines with specific deletions of predetermined known genes. Good targets for these deletions are
genes responsible for key metabolic processes that inhibit the
spread of the infection but allow the development of immune
responses against virulence factors. Alternatively, deletions of
virulence-associated genes are targets, but this may be more
problematic when a protective immune response is desired.
VOL. 20, 2007
Gene-deleted vaccines have been produced against strangles, a highly contagious disease in horses caused by infection
with Streptococcus equi subsp. equi. The disease is characterized by fever, profuse nasal discharge, and abscess formation in
the lymph nodes of the head and the neck. The pus discharged
from bursting abscesses is highly infectious, and the swelling of
involved lymph nodes may, in severe cases, cause airway restriction, hence the name. Commercial bacterin or protein
extract vaccines for parenteral administration can induce high
levels of serum bactericidal antibodies, but the protective effects of these antibodies are questionable (177), and the protective efficacy of inactivated vaccines in the field has been
disappointing (174). A live intranasal vaccine based on a nonencapsulated attenuated strain (Pinnacle IN) has been widely
used in North America since it was launched in 1998. However,
the attenuating mutations of this strain have not been defined,
and the vaccine strain sometimes reverts to an aggressive mucoid phenotype indistinguishable from that of wild-type strains.
The Pinnacle strain has since been refined into a more stable
hyaluronate synthase-defective mutant (191). It is, however,
not clear if this new strain has replaced the original vaccine
strain in the commercial product. Recently, the Equilis StrepE
vaccine, a live recombinant bacterial vaccine prepared from
the S. equi TW928 deletion mutant lacking bp 46 to 978 of the
aroA gene (80, 84), was licensed in Europe. This mutant was
constructed by the electroporation of gene knockout and gene
deletion constructs. No foreign DNA such as antibiotic resistance markers was introduced, but the vaccine strain can allegedly be identified by an aroA PCR identifying the partial
gene deletion (84). The live gene-deleted attenuated vaccine
strain was originally developed for intranasal application, but
protection was accomplished only by intramuscular injections,
which in turn resulted in the local swelling of muscle tissue and
the eventual formation of abscesses at the vaccination site (80).
However, submucosal administration of the vaccine in the upper lip was shown to confer protection comparable to that of
intramuscular administration but with only minimal local reactions (80), and it is with this unusual route of administration
that the vaccine is now licensed.
Chlamydiae are obligate intracellular bacteria with a wide
host range and with a wide spectrum of diseases, several of
which are zoonotic. The most important veterinary species are
Chlamydophila psittaci, causing respiratory infections in poultry (psittacosis/ornithosis), and Chlamydophila abortus (formerly Chlamydia psittaci serotype 1), causing ovine enzootic
abortion, one of the most important causes of ovine and caprine abortion worldwide. Both infections are zoonotic. While
no vaccines are available for birds and poultry, inactivated
vaccines against ovine enzootic abortion have been available
for many years (reviewed in reference 145). More recently, a
temperature-sensitive mutant strain, TS1B, of the C. abortus
reference strain AB7 obtained by nitroguanidine mutagenesis
(148) is used to prevent abortion in sheep (Ovilis Enzovax).
The temperature-sensitive mutant strain has an optimal
growth temperature at 38°C, but at the restrictive temperature,
39.5°C, growth is impaired. The normal body temperature of
adult sheep is 38.5 to 40.0°C. The vaccine induces good and
long-lasting protection in sheep (34), goats (149), and mice
(even though the body temperature of mice is within the permissive growth range). However, the vaccine is licensed only
VETERINARY VACCINES
497
for sheep, not goats, and there is continued research into the
development of an effective subunit-based vaccine (59, 190).
Temperature-sensitive-mutant vaccines have also been developed and marketed as eye drop, spray, or inhalation vaccines.
These include vaccines against Mycoplasma synoviae and M.
gallisepticum in chickens (Vaxsafe MS and Vaxsafe MG, respectively) (10, 119) and Bordetella avium rhinotracheitis
(coryza) in turkeys (Art Vax) (79).
Gene-deleted live bacteria with well-defined targeted attenuations also offer an attractive option as mucosal vectors for
passenger antigens, with many potential advantages over traditionally injectable vaccines. Unlike viral vaccines, there are at
present no commercialized vector vaccines based on a bacterial
backbone carrier delivering antigens from other pathogens,
although several bacterial vectors have shown very promising
results (reviewed in references 61 and 108).
Subunit Vaccines
Porcine contagious pleuropneumonia is a widespread and
severe disease of pigs with hemorrhagic necrotizing pneumonia and high mortality in the acute form. The disease is caused
by Actinobacillus pleuropneumoniae, and prevention by vaccination with whole-cell bacterin vaccines has been severely restricted by the prevalence of 15 different serotypes. A second
generation of acellular A. pleuropneumoniae subunit vaccines
has been developed with four extracted (Porcilis APP) or five
recombinant (PleuroStar APP) proteins, which confer some
degree of cross-protection against all serotypes. Most of the
pathological consequences of A. pleuropneumoniae infection
are caused by pore-forming RTX (repeats in the structural
toxin) exotoxins ApxI, ApxII, ApxIII, and APxIV, of which at
least a combination of two are expressed in all serotypes. The
serotypes expressing both ApxI and ApxII are particularly virulent (58). Vaccination with RTX toxins alone protects against
mortality but does not reduce the typical lung lesions. The
pentavalent recombinant vaccine containing only the ApxII
toxin but supplemented with other common antigens such as
transferring-binding proteins appears to provide protection
that is at least as good as or better than that of the vaccine with
three extracted Apx toxins supplemented with a single outer
membrane protein (35, 69, 186). However, the precautions
needed when such subunit vaccines are to be designed is evidenced by a study of vaccination against PalA of the peptidoglycan-associated protein family and the most “immunopredominant” outer membrane protein of A. pleuropneumoniae
(and related to, e.g., the P6 protein of Haemophilus influenza).
Antibodies induced against PalA alone aggravated the consequences of a challenge infection, and PalA vaccination in combination with RTX toxins even counteracted the protective
effect of anti-ApxI and anti-ApxII antibodies (182).
Vaccines against Zoonotic Bacteria
Clinical salmonellosis in animals is often due to host-restricted serotypes such as Salmonella enterica serovar Choleraesuis in pigs, Salmonella enterica serovar Gallinarum in poultry, and Salmonella enterica serovar Dublin in young cattle with
severe systemic infections, which may result in the death of the
animal. In contrast, non-host-specific Salmonella serotypes
498
MEEUSEN ET AL.
usually induce a self-limiting gastrointestinal infection but with
the capability of causing systemic infections in a wide range of
host animals, including humans. The desired immunity of vaccines against zoonotic infections not only requires the induction of a local mucosal immunity, preventing colonization of
the gut of the individual animal, but should ideally also prevent
or eliminate the presence of the bacteria in the flock as a whole
to prevent cross-contamination of meat products at the slaughterhouse. This is a very difficult task, and available vaccines
have so far yielded variable success rates (reviewed for poultry
in reference 184).
It is generally recognized that cell-mediated immunity is
more important than humoral responses in protection against
Salmonella, and together with the need for local mucosal immunity, this calls for live, attenuated vaccines as the most
effective type. This is supported by a comparison of a live
double-gene-deleted Salmonella enterica serovar Typhimurium
vaccine (MeganVac 1) with an inactivated Salmonella enterica
serovar Enteritidis vaccine (Poulvac SE), which showed reduced fecal shedding following live vaccination, while chickens
receiving a killed vaccine experienced inhibited cell-mediated
immune responses, enhanced antibody responses, and an increased bacterial load (5). The MeganVac 1 organism has
recently been reformulated for immunization of laying hens
(MeganEgg). The Megan vaccines for broilers and hens were
licensed by the USDA in 1998 and 2003, respectively, but
worldwide, there are at least 10 other live Salmonella vaccines
available for Salmonella enterica serovar Enteritidis, Salmonella enterica serovar Typhimurium, or Salmonella enterica serovar Gallinarum infection in poultry.
Campylobacter jejuni is one of the most important causes of
food-borne human bacterial gastroenteritis. Although several
vaccines aimed at preventing human disease are in the pipeline, an effective vaccination intervention strategy for infected
poultry flocks would be the most effective means of preventing
human disease. Similar to the requirements of a vaccine
against non-host-specific Salmonella serotypes, such a vaccine
must, however, be able to provide a very high degree of protection in the flock to eliminate the subsequent contamination
of meat products. Experimental vaccines, mainly killed wholecell cultures or flagellum preparations, have been tested in
poultry but provide only partial protection against a challenge
with Campylobacter, and the development of an attenuated live
strain may be more promising although not yet commercially
available.
Brucellosis continues to be a major zoonotic threat to humans and a common cause of animal disease, especially in
developing countries. In many industrialized countries, a testand-slaughter policy has been effective for the eradication of
the disease, while vaccines, although providing a fairly high
level of protection, also induce antibodies that interfere in
subsequent surveillance programs. Numerous attempts to produce a protective killed vaccine have so far been disappointing,
and the most successful vaccines against brucellosis have been
those employing live, attenuated Brucella spp. (158). Of these,
Brucella abortus strain 19 (first described in 1930) and Brucella
melitensis Rev.1 (first described in 1957) vaccines have been
widely used in cattle and in small ruminants, respectively. The
S19 and Rev.1 vaccines are, however, far from perfect, as
absolute protection is not achieved, allowing for subclinical
CLIN. MICROBIOL. REV.
carrier animals, and both strains have retained some virulence
and may induce abortions with variable frequency. Furthermore, both of these vaccines are infectious for humans (Rev.1
is also resistant to streptomycin), and they will induce antibodies against smooth lipopolysaccharide, making them incompatible with test-and-slaughter procedures in countries with an
ongoing eradication program. More recently, a vaccine based
on a stable spontaneous rifampin-resistant rough mutant of B.
abortus, named RB-51 (157), has replaced S19 in many countries including the United States. RB-51 carries IS711 inserted
into the wboA glycosyl transferase gene (188), but experimental data with other wboA mutants indicate that additional unknown defects are carried in this strain (118). Rough strains do
not carry smooth lipopolysaccharide, and therefore, vaccination with RB-51 does not induce antibodies that are detectable
in routine serological tests. This is an obvious advantage in
many cases but may also result in the late diagnosis of accidental human infections, although RB-51 appears to be much
less virulent for humans than S19 and Rev.1 vaccines (3). At
present, several million animals have been vaccinated with the
RB-51 mutant strain, but the protective efficacy in cattle compared to S19 remains controversial (118, 124, 158), and the
protection against Brucella suis in pigs (172) and against B.
abortus in elk (89) is very limited, if present at all.
Rickettsia Vaccines
The rickettsiae Ehrlichia, Anaplasma, and Coxiella are all
small obligate intracellular pathogens that cause significant
animal diseases. With the exception of Coxiella, all are transmitted by arthropod vectors (e.g., ticks, mites, lice, or fleas).
Heartwater is the most important tick-borne disease of domestic and wild ruminants in sub-Saharan Africa and the West
Indies, which is caused by Ehrlichia ruminantium. The only
commercially available vaccination procedure is based on the
controlled infection of animals with cryopreserved infected
sheep blood, followed by antibiotic treatments with tetracyclines when fever develops. A nonvirulent strain has recently
been generated through in vitro cultivation and shown to confer good protection (198). Progress in developing cost-effective
in vitro cultivation processes may lead to the development of
inactivated vaccines (103).
Bovine anaplasmosis is another tick-borne disease caused by
Anaplasma marginale infection of red blood cells. Transmission
can occur by mechanical means via blood contamination or
through blood-sucking arthropods and transplacentally from
cow to calf. Cattle that survive acute infection are resistant to
the disease but develop persistent, cyclic, low-level infections
and therefore remain as “carriers.” Calves are less susceptible
to infection and clinical disease than adult cattle. Infected
blood containing a less pathogenic isolate or subspecies of A.
marginale, generally referred to as Anaplasma centrale, remains
the most widely used live vaccine in Africa, Australia, Israel,
and Latin America. Infection with A. marginale followed by
treatment of the patent infections with low doses of tetracycline drugs has also been used but requires close supervision
for timely treatment. Following large-scale production of A.
marginale antigen from infected bovine blood, a killed vaccine
was effectively marketed and used in the United States until
withdrawal in 1999 (88). Apart from its higher cost and need
VOL. 20, 2007
VETERINARY VACCINES
499
TABLE 3. Available veterinary live protozoal vaccines
Host
Brand name(s)
Distributor(s)
Characteristic(s)
Referencea
Eimeria spp.
Poultry
Coccivac, Immucox, Paracox,
Advent, Nobilis Cox ATM
Sporulated oocysts of several
or all of the avian species
164
Eimeria spp.
Poultry
Inovocox
Shering-Plough, Vetech Labs,
Novus International,
Intervet
Embrex
164
E. tenella
Poultry
Livacox
BIOPHARM
Theileria parva
Cattle
Theileria annulata and
T. hirci
Toxoplasma gondii
Cattle
In ovo delivery using
proprietary platform
injection system
Precocious and egg-passaged
lines
Infection followed by drug
treatment
Culture-derived schizonts
30
Babesia bovis and
B. bigemina
Cattle
S48 strain with a lost ability
to form cysts after
passages in mice
Infected blood from
splenectomized calves
Pathogen(s)
a
Sheep
Centre for Ticks and Tickborne Disease, Malawi
Local veterinary institutes
Ovilis Toxovax
Intervet
Local veterinary institutes
196
23
165
48
See also company websites.
for yearly boosters, the killed vaccine was generally less effective in inducing protective immunity than live vaccines.
VETERINARY PARASITE VACCINES
Protozoal Vaccines
Protozoal infections in animals cause significant production
losses and are a major impediment to the introduction of
high-productivity breeds in poorer, mainly tropical areas
around the world. Many also cause zoonotic diseases in humans or have close relationships to human parasites, increasing their significance as infection reservoirs or animal models
for human diseases. While no vaccines for human protozoa are
available as yet, several veterinary vaccines have been on the
market or have been produced by agriculture/veterinary departments for local use for many decades. Most of these vaccines are based on live organisms; however, an increasing number of killed subunit vaccines have been developed and
commercialized in recent years. The following overview will
exemplify currently used protozoal vaccines according to in-
creasing sophistication of vaccine production. A list of currently used protozoal vaccines is provided in Tables 3 and 4.
Live protozoal parasite vaccines. Protozoal parasites have a
high degree of genetic complexity. The difficulty of vaccine
development for these organisms is further exacerbated by the
antigenic diversity displayed by their different life cycle stages
within the host as well as between different species and strains
and, in the case of hemoprotozoal parasites, even within the
same life cycle stage. While most protozoal infections induce
various degrees of immunity after previous infections, the immunological mechanisms involved in protection and the stages
involved have mostly not been defined. It is therefore not
surprising that most vaccines make use of the live organism
itself to elicit the required protective immune response. Depending on the characteristics of infection, these vaccines can
take several formats, as discussed below.
(i) Vaccines based on complete life cycle infections. Vaccination with low doses of infective organisms has been used
extensively in the poultry industry to combat coccidiosis, the
major economic parasitic disease of poultry worldwide. Coc-
TABLE 4. Available veterinary killed/subunit protozoal vaccines
Pathogen(s)
Host
Brand name(s)
Distributor(s)
Neospora caninum
Giardia duodenalis
Cattle
Dogs
Bovilis, Neoguard
Giardiavax
Intervet
Fort Dodge
Sarcocystis neurona
Horses
Epm vaccine
Fort Dodge
Babesia canis
Dogs
Leishmania donovani
Dogs
Pirodog and Nobivac
Piro
Leishmune
Merial and Intervet
(respectively)
Fort Dodge
Eimeria maxima
Poultry
CoxAbic
Novartis AH
a
Reference or
sourcea
Characteristic(s)
Killed tachyzoites, reduces abortion
Cultured trophozoites, reduces disease
and cyst shedding
In vitro-cultured merozoites,
chemically inactivated
In vitro-cultured supernatant antigens,
reduce clinical disease
Native fucose-mannose-ligand antigen
complex
Gametocyte antigen(s); transmission
blocking through maternal antibody
transfer
Heuer et al.,b 151
128
104
117, 156
21
192
See also company websites.
C. Heuer, C. Nicholson, D. Russell, and J. Weston, presented at the 19th International Conference of the World Association for the Advancement of Veterinary
Parasitology, New Orleans, LA, 2003.
b
500
MEEUSEN ET AL.
cidiosis in poultry is caused by the obligate intracellular protozoal parasite Eimeria species, which undergoes a defined
number of asexual cycles of merozoite production in gut epithelial cells (three to four merogenic cycles) before the final
sexual stages develop and produce the infective oocysts. The
infection is therefore self-limiting, and vaccination with small
doses of oocysts, while producing minimal pathology, induces
solid protection against homologous challenge. More recently
developed live vaccines contain oocysts selected from naturally
occurring “precocious” Eimeria strains that produce less merogenic cycles and are therefore safer to use. Although there are
many problems with this kind of vaccine, including the need for
simultaneous administration to prevent infection of susceptible
birds by vaccine-produced oocysts and species- and strain-specific immunity, live coccidian vaccines have been used successfully for over 50 years and are produced as a commercial product
by many animal health companies (Table 3) (reviewed in reference 164). The commercial success lies primarily in breeder and
layer flocks where anticoccidial drugs have to be withdrawn to
prevent the carryover of drugs into eggs.
(ii) Vaccines based on drug-abbreviated infections. Hemoprotozoal parasite infections are not self-limiting, and parasites
can proliferate continuously in the blood stages if not checked
by the immune response or drug treatment. In contrast to most
hemoprotozoal pathogens, including the closely related Theileria annulata, Theileria parva causes a highly fatal disease in
cattle by transforming infected lymphocytes, while the erythrocyte stage of this parasite is much less pathogenic. Solid,
sterile immunity develops after primary infection, and vaccination of cattle by infection with pathogenic wild-type T. parva
followed by drug treatment (long-acting tetracyclines) has
been used for many years to control East Coast fever. This
vaccination regimen confers solid protection against homologous challenge and limited protection against heterologous
challenge but is expensive to administer. Resistance is thought
to be conferred mainly by cell-mediated immunity, more specifically, CD8⫹ cytotoxic T cells, against the intracellular
schizont (106), and the targets of the protective cytotoxic-Tlymphocyte (CTL) response are currently being defined (65).
(iii) Vaccines based on infections with parasites with a truncated life cycle. Several protozoal parasites produce cysts
within the host that are a persistent source of infection when
eaten by carnivores. These cysts can also cause reinfection
when the immune system is compromised or can be reactivated
during pregnancy, causing congenital disease and abortion.
Toxoplasma gondii infects a wide variety of hosts, including
humans, and is the major cause of abortion in sheep and goats.
As immunity to primary infection develops, the intracellularly
replicating tachyzoites become encysted in a dormant stage
(zoitocysts), which can persist for several years, containing
hundreds of infective bradyzoites. T. gondii parasites that were
continuously passaged in mice to produce diagnostic antigens
were later found to have lost their ability to form cysts. The
“incomplete” S48 strain of T. gondii now forms the basis of a
commercial vaccine conferring long-lasting immunity (⬃18
months) of susceptible ewes against Toxoplasma-induced abortion when administered prior to mating (30).
(iv) Vaccines based on infection with virulence-attenuated
strains. Continuous passage of the tick-borne piroplasms Babesia
bovis and Babesia bigemina in splenectomized calves was shown
CLIN. MICROBIOL. REV.
to result in attenuated infections while still inducing immunity
in young calves. Live vaccines using infected blood collected
from acute infections of splenectomized calves were developed
in Australia several decades ago (31, 41) and are still used in
most countries to protect against babesiosis, usually produced
by local departments of agriculture or veterinary institutions
(reviewed in reference 48). In some cases, this is supplemented
with A. centrale-infected blood where A. marginale is enzootic.
To increase shelf life and allow more rigorous safety testing,
several veterinary institutes now produce frozen-blood vaccines stored in liquid nitrogen using either dimethyl sulfoxide
or glycerol as the cryoprotectant. For reasons that are still
unknown, young cattle up to 9 months of age are more resistant to Babesia infections, but vaccination of susceptible adult
cattle often requires additional drug treatment even using the
attenuated strains. Continuous exposure to natural tick infections is generally required to ensure continuous and longlasting immunity.
A live, attenuated Theileria annulata vaccine has been produced by continuous in vitro passaging of the intracellular
macroschizont stage and is used in many tropical and subtropical countries for the control of tropical theileriosis in cattle.
In contrast to T. parva, immunity to the erythrocytic pathogen T. annulata is short-lived and wanes after 6 months in
the absence of natural challenge infections (reviewed in
references 140 and 165).
Killed or subunit protozoal parasite vaccines. Several inactivated vaccines consisting of crude whole organisms or, more
recently, defined antigenic structures have been registered and
target mostly the companion animal market (Table 4). In general, these vaccines are not as effective as live organisms but
can ameliorate disease or transmission to various degrees.
They may also form the basis for the development of recombinant vaccines.
The final host of the coccidial parasite Neospora caninum is
the dog, but its economic impact is felt mostly in the intermediate cattle host, where it is a major cause of abortion (51, 78).
A crude N. caninum vaccine has been licensed in the United
States to aid in the reduction of N. caninum-induced abortion
in healthy pregnant cattle and prevent the transmission of the
parasite to calves in utero. The vaccine consists of inactivated
N. caninum tachyzoites with an adjuvant administered subcutaneously. A large field study in Costa Rica (151), where infection is highly prevalent in diary herds, demonstrated an
overall twofold (46%) reduction in abortion rates through vaccination (49/438 versus 91/438 in saline-injected controls). As
also reported in a multiherd vaccination trial in New Zealand
(C. Heuer, C. Nicholson, D. Russell, and J. Weston, presented
at the 19th International Conference of the World Association
for the Advancement of Veterinary Parasitology, New Orleans,
LA, 2003), there was a high variability in efficacy between
farms, which is likely due to abortions being caused by other
infections or by noninfectious causes (87). Timing of vaccination is also likely to play a role in preventing abortion and
transmission (78).
A vaccine to alleviate a neurological disease in horses caused
by infection with Sarcocystis neurona, equine protozoal myeloencephalitis, has recently been released and is being tested
under conditional USDA license by Fort Dodge Animal
Health. It consists of in vitro-cultured merozoites, originally
VOL. 20, 2007
obtained from the spinal cord of a horse, which are chemically
inactivated and mixed with a proprietary adjuvant for intramuscular injection (104).
Giardia lamblia (synonyms, Giardia duodenalis and Giardia
intestinalis) is an enteric parasite of many animal species. Infection is generally self-limiting, but severe gastrointestinal
disease can develop in young and immunocompromised individuals. Its importance is mainly in animal-to-human transmission, and Giardia is a major cause of outbreaks of waterborne
infections. Only one commercial vaccine has been licensed for
use in dogs and cats in the United States (GiardiaVax). It is
licensed to prevent clinical disease in dogs and significantly
reduce the incidence, severity, and duration of cyst shedding.
The vaccine consists of a crude preparation of disrupted, axenically cultured G. duodenalis trophozoites (sheep isolate)
and has been shown to eliminate most clinical signs of infection
and significantly reduce the total number of cysts shed in the
feces in puppies and, to a lesser extent, in kittens. Some efficacy
in the clearing of chronic infections resistant to chemotherapeutic agents may also be achieved through vaccination, but
this requires more extensive testing (128, 129). It is thought
that the vaccine acts mainly through the neutralization of parasite toxins by antibodies.
Two subunit vaccines have been developed to protect dogs
against canine babesiosis caused by Babesia canis (Table 4).
Both vaccines consist of soluble parasite antigens (SPA) released into the culture supernatant by in vitro-cultured parasites, combined with adjuvant. The first vaccine released, Pirodog, contains SPA from B. canis cultures only (117), while
the recently released NobivacPiro contains SPA from B. canis
and Babesia rossi in an attempt to broaden the strain-specific
immunity. The protective effect of this vaccine seems to be
based on the antibody-dependent neutralization of a soluble
parasite substance that causes hypotension and clinical disease,
rather than acting through reducing parasitemia per se (156).
This vaccine approach was also evaluated in cattle but did not
confer sufficient protection (165).
A killed subunit vaccine has been developed against coccidiosis in poultry by ABIC Veterinary Products, Israel, particularly for use in the broiler industry (192, 193). Interestingly,
this vaccine does not target the merozoite stages, as most live
vaccines are thought to do, but rather targets the final sexual,
macrogametocyte stages that develop to form the diseasetransmitting oocysts. The principle behind this vaccine strategy
is that it will still allow immunity against the asexual stages to
be generated by natural infections while reducing oocyst shedding and parasite transmission. Added advantages of this approach are that the laying hens, rather than the chicks, are
immunized, transferring protective immunoglobulins into the
egg yolk and subsequently the hatchlings. Considering that
each hen lays more than 100 eggs in her lifetime, this considerably reduces the number of vaccinations and animal handling. In contrast to the species and strain specificity of live
vaccines, this gametocyte vaccine was shown to confer partial
protection across the three major Eimeria species. A major
disadvantage of the vaccine is that it is expensive to produce,
consisting of affinity-purified native gametocyte antigens derived from infected chickens, and is still a fairly complex preparation (15). Three major components of affinity-purified
native gametocyte antigens have recently been cloned and
VETERINARY VACCINES
501
characterized with a view to identifying the protective components and develop a recombinant vaccine (16). It remains to be
seen if the translation of native vaccine to recombinant vaccine
will be successful, as this has been a major stumbling block for
much of the parasite development area (123).
Human visceral leishmaniasis, or kala-azar, is a devastating
human disease caused by the intracellular parasite Leishmania
chagasi or Leishmania infantum and transmitted through sand
flies. Dogs are the principal carriers of the disease and are also
clinically affected. Recently, a subunit vaccine against canine
visceral leishmaniasis, based on a strongly antigenic surface
glycoprotein complex, fucose mannose ligand, or FML antigen,
from Leishmania donovani and saponin adjuvant has been
developed in Brazil. Vaccine efficacy was reported to be 76 to
80% against both homologous and heterologous challenge
with L. chagasi and to last for at least 3.5 years (21, 44). A
concomitant reduction in human incidence of the disease was
also reported, which is likely due to the transmission-blocking
properties of the vaccine (42, 125). The vaccine may also have
a therapeutic effect on infected dogs (22).
Helminth and Ectoparasite Vaccines
Multicellular parasites are the most complex pathogens, with
genome sizes that approach those of their hosts. Apart from
their genetic complexity, they are also the only pathogens that,
due to their physical size, cannot be internalized by phagocytic
cells of the immune system or killed by classical cytotoxic T
cells (Fig. 1). In fact, the immune system had to develop a
whole new mechanism to deal with these parasites, which is
generally referred to as the type 2 or allergic-type immune
response, typified by the recruitment and activation of potent
effector leukocytes, mast cells, and eosinophils (9, 102).
There are three different families of helminths or worms,
nematodes (roundworms), trematodes (flatworms), and cestodes (tapeworms), that infect both animals and humans. At
present, only one worm vaccine is on the market in Europe for
the cattle lung nematode Dictyocaulus viviparous (Bovilis
Lungworm), consisting of irradiated infective L3 larvae that
cannot develop into the adult stage (7). Vaccination with irradiated L3 larvae of the economically important gastrointestinal
nematodes has been attempted but was not successful due
mainly to their lack of efficacy in inducing immunity in young
animals (reviewed in reference 6). The increasing drug resistance of gastrointestinal nematodes has renewed intense interest in developing vaccines for these important veterinary
pathogens (reviewed in references 19, 123, and 189).
Tapeworms have a larval stage in intermediate hosts that is
uniquely susceptible to immune killing after a single infection.
Antigens from this early larval stage (oncospheres) were the
first to confer protection against a multicellular pathogen as
recombinant proteins (82). Commercial or field application of
anticestode vaccines is, however, still in progress (reviewed in
reference 98).
The most important veterinary trematode species are liver
flukes (Fasciola hepatica and Fasciola gigantica). Vaccine development against these parasites is hindered by the fact that
they do not seem to induce immunity in their natural ruminant
hosts, even after repeated infections. Recently, a unique breed
of sheep (Indonesian thin tail) was shown to develop immunity
502
MEEUSEN ET AL.
against F. gigantica, and further dissection of this protective
mechanism may offer new approaches to vaccine development
(109).
Ectoparasitic arthropods would seem to be the ultimate
challenge in vaccine development, as they not only are large
and complex but also spend most of their life outside or on the
surface of the host. Interestingly, the only recombinant parasite antigen vaccine commercially available is against a tick
parasite, Boophilus microplus, and was first introduced commercially in Australia in 1994 (TickGUARD; Fort Dodge Australia) and later in Cuba and a few South American countries
(Gavac; Heber Biotec SA, Cuba). This vaccine is unique in that
it is not based on natural antigens recognized by the immune
system during infection but takes advantage of the ferocious
blood-feeding habits of the tick. High antibody levels are generated by vaccinating cattle against a tick gut membrane-bound
protein, Bm86, using a recombinant protein in a potent adjuvant. These antibodies bind to the tick’s gut surface when
taking a blood meal, causing the rupture of gut wall and tick
death. The vaccine induces significant levels of protection
against tick infestation and, in some cases, against tick-borne
diseases (195). However, as the molecule is not seen during
natural infection (“hidden” or “concealed” antigen), antibody
levels are not boosted by infection and need to be maintained
at high levels by repeated immunization. The vaccine is best
used in conjunction with drug administration, which limits its
practical and commercial appeal. The presence of a tick immunoglobulin excretion system seems to hamper the effectiveness of this vaccine approach in other ticks (126).
VETERINARY VACCINES FOR
NONINFECTIOUS DISEASES
Allergy Vaccines
As is the case in humans, there is a genetic predisposition in
some animals, especially cats, dogs, and horses, to develop
allergic skin disease or atopic dermatitis in response to environmental allergens such as grass pollen, weeds, mold spores,
and house dust mites. This can be exacerbated by secondary
bacterial or yeast infections resulting in urticaria. The most
common treatment against atopic dermatitis is vaccination
with an allergen extract to which the animal has been shown to
react, as determined by intradermal injection or allergen-specific serum immunoglobulin E assays. This “allergen-specific
immunotherapy” (ASIT) consists of administering gradually
increasing amounts of the allergen extract, either aqueous or
precipitated with alum, over a period of several months, followed by yearly boosters. The reported effectiveness of this
treatment varies widely, from 20% to close to 100% in dogs,
depending on such factors as study design, parameters used,
source of vaccine, and concurrent treatment for secondary
infections (37). It is clear that a more rigorous evaluation of
ASIT vaccine effectiveness is required, which would be aided
greatly by a better understanding of the mechanisms by which
ASIT works to reduce allergies. In parallel to human studies, it
is likely that this involves the induction of specific regulatory T
cells and/or immunoglobulin G antibodies that compete with
and mask the allergens (94, 180). The identification of the
exact mechanisms and mediators associated with successful
CLIN. MICROBIOL. REV.
ASIT may provide more reliable correlates of vaccine effectiveness and more rational and standardized vaccination protocols.
Cancer Vaccines
With longer life spans of domestic pets and higher value
placed on the animals by their owners, treatment of spontaneous cancers has become of increasing interest. Canine malignant melanoma (CMM) is the most common oral tumor in
dogs. CMM is similar to some malignant melanomas in humans, and despite treatment, most dogs die within a year of
diagnosis. Several groups have anticancer vaccines against
CMM in phase III clinical trials, and Merial launched a CMM
DNA vaccine under conditional license from the USDA in
2006. These experimental vaccines are based primarily on studies for human cancer vaccines and include immunizations with
canine tumor cell lines transfected with human granulocytemacrophage colony-stimulating factor (75) or human gp100 (1)
or DNA vaccination with human tyrosinase (18). The latter
two immunizations with human melanocyte-specific proteins
are based on the demonstration that immune tolerance against
self-antigens can be broken through cross-reaction between a
xenogeneic antigen and a self-antigen. The overall response
rate in these studies was estimated to be around 17%, with
occasional complete remission in individual dogs and prolongation of survival times. The experimental designs of the studies are, however, limited by small sample sizes, differences in
breeds and clinical status, and comparisons to historical, stagematched controls. No clear correlations between immune parameters and the likelihood of tumor control could be established.
Local vaccination with bacillus Calmette-Guérin (BCG) has
long been used as a therapeutic treatment for superficial cancer of the urinary tract in humans and has been shown to be
effective in the treatment of equine sarcoids and, to a lesser
extent, bovine ocular squamous cell carcinoma (105, 153). The
mode of action of this vaccination regimen is unknown but may
involve the upregulation of tumor-specific antigens through
local inflammation and activation of the innate immune system
(162).
VETERINARY VACCINES FOR FERTILITY AND
PRODUCTION CONTROL
Immunocontraceptive vaccination is a fast-moving area of
vaccine research and development in the human and animal
health areas, with a number of products for livestock and
companion animals recently brought to the market.
Since before written history, humans have practiced neutering of animals used for food and transport and to be kept as
pets. This has been termed “man’s first attempt at bioengineering” (175). Following the discovery of the reproductive hormone system, attempts were made to control reproduction by
immunization against key hormones in both humans and animals. Many early attempts gave encouraging results but were
variable due to a lack of knowledge of how to consistently elicit
an effective neutralizing immune response against self-proteins.
There are two goals of reproductive control vaccines that
VOL. 20, 2007
VETERINARY VACCINES
503
responses can be induced with high efficacy and potency, provided that the elements of T-cell help against a foreign antigen,
in conjunction with self-epitopes, are presented in combination
with an appropriate and strong adjuvant.
Vaccines against Reproductive Hormones
FIG. 3. The key hormones of the hypothalmic-pituitary-gonadal
axis. Tissues are in orange, and hormones are in green. *, hormones
and gametes that have been targeted in constructing experimental and
commercial vaccines.
can be simply categorized as (i) immunocontraception and (ii)
immunoneutering. Immunocontraceptive vaccines aim to prevent either fertilization of the oocyte by sperm or implantation
of the fertilized egg yet retain sexual behavior patterns and
competition in mating; this approach is most suited to the
control of feral animal pests and native wildlife. Immunoneutering vaccines aim to prevent all sexual behaviors in both male
and female animals as well as controlling fertility; these outcomes are suitable for companion animals, livestock, and, in
some instances, feral animal pest control.
Design of Reproduction Control Vaccines
The hormone cascade involved in reproduction is shown in
Fig. 3. T-cell help has been incorporated into vaccine formulations by using whole proteins or defined T-cell helper
epitopes as peptides (36, 63, 92); however, all commercialized
vaccines to date have been based on carrier protein-peptide
conjugates. Commercialized peptide-carrier protein vaccines
have used bacterial toxoids, including tetanus and diphtheria
toxoids or ovalbumin as carriers, to which peptides of the
self-antigens being targeted are conjugated. The main criterion
for the selection of a carrier has been to provide strong antibody responses and potency, and the relative effectivenesses of
different carriers have been identified (57). Other important
factors for the selection of carrier proteins are abundance for
large-scale manufacture, cost, and compliance with regulatory
requirements. In some instances, the target sequence and carrier have been produced as a recombinant fusion protein and
have shown good efficacy in species as diverse as cats and cattle
(38, 147).
Variable results from studies using anti-luteinizing hormone-releasing hormone (LHRH) vaccines under late-stage
commercial development in pigs (52) and horses (173) have
shown efficacies as low as 66 to 75%, leading to the view that
it remains difficult to consistently stimulate a strong immune
response to self-antigens. While this may still be the case for
the efficacious induction of anti-self-T-cell responses due to
tolerance and apoptosis of autoreactive T cells, recently commercialized vaccines have shown that strong anti-self-antibody
The targeting of specific hormones involved in sexual development and function has resulted in the most scientifically and
commercially successful approach for the control of reproduction by vaccination. The key hormone targets have been those
of the hypothalamic-pituitary-gonad axis (Fig. 3).
The best-studied and best-characterized hormone, used as
a vaccine target, has been LHRH, also known as gonadotropin-releasing hormone and gonadotropin-releasing factor.
LHRH is the key hormone controlling reproductive function
and development and is released from the hypothalamus. It is
a simple 10-amino-acid peptide that is conserved across all
species of mammals, with variants identified in other organisms
from lampreys to birds and fish. Immunoneutralization of this
pivotal hormone of the pituitary-gonad axis prevents reproductive function, provides contraception in all mammals, and controls estrus behavior in females and sexual and aggressive behaviors in males. Because of its simple structure and central
controlling role, LHRH was the target of vaccine research
soon after its discovery (36). Since then, there have been many
research programs for the development of anti-LHRH vaccines both in academia and commercially; however, the commercial successes have been relatively few, as summarized in
Table 5, and will be discussed further here.
The first commercial vaccine developed against LHRH was
Vaxstrate, comprising a conjugate of ovalbumin and LHRH
peptide, presented in an oil emulsion adjuvant (76). It was sold
for use as an immunospaying vaccine for extensively grazed
female cattle in northern Australia. It was launched in the late
1980s and withdrawn from the market in 1996 due to poor
sales, resulting mainly from being highly reactogenic (about
40% of animals with abscesses) and poor efficacy in the field.
The two doses required for the administration of Vaxstrate
prevented its wider use, as this did not fit well with the single
annual mustering of cattle in northern Australia.
A more advanced anti-LHRH vaccine, Improvac, was developed for use in entire male pigs to control boar taint (Table 5).
The formulation comprises a carrier protein conjugated to a
modified form of LHRH peptide with a water-soluble adjuvant. This vaccine was launched in 1998 and has been sold
since then in Australia and New Zealand and was recently
launched in the Philippines, Mexico, Brazil, and South Africa.
To date, it is the most successful of all the reproduction control
vaccines. Improvac is given as two doses, with the first dose at
least 8 weeks prior to slaughter and the second dose 4 weeks
before slaughter, which is sufficient to induce an anamnestic
anti-LHRH antibody response that in turn suppresses LHRH
production, levels of gonadotrophins, and testicular function
and allows the washout of the taint steroid androstenone and
other taint compounds such as skatole, which are fat soluble.
The main feature that distinguishes Improvac from the many
noncommercialized vaccines is that it achieves a very high level
of efficacy in the field (53). Another key feature that has ensured commercial success is that there is no impact on growth
504
MEEUSEN ET AL.
CLIN. MICROBIOL. REV.
TABLE 5. Commercialized reproduction control vaccines
Target antigen
Target species
Brand name
Distributor
Characteristic(s)
LHRH
Female cattle
Vaxstrate
LHRH
Male pigs
Improvac
Websters Animal Health
(withdrawn in 1996)
CSL Ltd. (now Pfizer Animal
Health)
CSL Ltd. (now Pfizer Animal
Health)
LHRH
Female horses
Equity
LHRH
Male dogs
Pfizer Animal Health
LHRH
Deer, bison,
horses
Canine gonadotropinreleasing factor
immunotherapeutic
GonaCon
ZP (ZPC/ZP3)
antigen
Several species
SpayVac
Androstenedione
Ewes
Fecundin
Androstenedione
Androstenedione
Ewes
Ewes
Androvax
Ovastim
ImmunoVaccine Technologies,
Canada (no longer
available)
Coopers Animal Health
(withdrawn)
Agvax Pty. Ltd. (now Intervet)
Virbac
USDA (registration reported
to be in progress)
rates and more efficient use of feed over the last 4 weeks after
the second dose. This is despite highly suppressed levels of the
anabolic hormone testosterone for this period (53). The production advantages are probably a result of behavior modification resulting from the suppression of testosterone and have
been shown to be significant compared to raising boars and are
more pronounced than those of castrated boars, such as those
that are raised in most pig-producing countries.
An anti-LHRH vaccine, Equity, has also been developed for
use in female horses (Table 5). This product is used for the
control of estrus and estrus-related behavior during the breeding season and was commercialized in 2001 in Australia. It
comprises a peptide-protein conjugate and the Iscom-related
immunostimulating complex adjuvant. This formulation is an
advance over other commercial formulations trialed in mares
and stallions that were reactogenic (50, 178).
An anti-LHRH vaccine was also conditionally licensed in the
United States in 2004 for the treatment of benign prostatic
hyperplasia in entire male dogs and together with Improvac
are the only anti-LHRH vaccines commercialized outside of
Australia and New Zealand; the dog vaccine is labeled canine
gonadotropin-releasing factor immunotherapeutic under a
USDA conditional license. Benign prostatic hyperplasia is very
common in entire male dogs over 4 to 5 years of age, and the
condition is dependent on the conversion of testosterone to
dihydrotestosterone by cells in the prostate gland. Suppression
of testosterone via an anti-LHRH response leads to a reduction in dihydrotestosterone and indirectly controls prostatic
hyperplasia. A related application for anti-LHRH vaccines in
men is for treatment of prostatic cancer, and a number of
phase I/II studies have shown some degree of efficacy in men
with this tumor (168).
Control of wildlife through an anti-LHRH formulation has
been pursued by researchers at the National Wildlife Research
Center of the USDA (86, 112). This vaccine, termed GonaCon,
is based on a peptide-keyhole limpet hemocyanin carrier protein conjugate antigen formulated in a commercially available
vaccine for Johne’s disease in an oil-based adjuvant (AdjuVac). This formulation has the effect of making the skin of
LHRH peptide conjugated to ovalbumin; oil
emulsion adjuvant
Peptide-protein conjugate and water-miscible
adjuvant; control of boar taint
Peptide-protein conjugate and proprietary adjuvant
(immunostimulating complex); control of estrus
and estrus-related behavior
Peptide-protein conjugate and water-miscible
adjuvant; treatment of benign prostatic
hyperplasia
Peptide conjugated to keyhole limpet hemocyanin
in mycobacterium-oil adjuvant (AdjuVac);
contraceptive vaccine to control wildlife
Crude ZPA preparation; supplied to research
groups only
Reference
or source
76
53
54
USDA
112
27
Linked to human serum albumin; increased
ovulation/twinning
Increased ovulation/twinning
Increased ovulation/twinning
vaccinated animals test positive for Mycobacterium avium. Its
advantage is that it is effective with a single vaccination, and
efficacy has been shown in valued wildlife such as deer, bison,
and horses (112) and in controlling feral pigs (86). Registration
of this formulation is reportedly being undertaken by the Wildlife Research Group of the USDA through the EPA, as this
agency is able to register products that would be restricted to
use in wildlife.
Vaccines against Gamete Antigens: Wildlife Control
For the control of wildlife, the widely held view is that the
maintenance of libido and sexual behavior would be optimal to
achieve this goal, and hence, the hormone system that drives
those behaviors has not been generally targeted. The exception
to this is the control of native animal species by an anti-LHRH
vaccine (see above). Alternate strategies to control wildlife
have been to develop vaccines that prevent the fertilization of
the oocyte by sperm or to prevent the implantation of the
embryo and allow immunized animals to continue to compete
in mating rituals. With this approach, antigens of the gametes
(sperm and oocytes) have been widely targeted to prevent
fertilization.
Sperm antigens. Over 20 sperm antigens have been identified and characterized, and many have been tested as vaccine
candidates in animals. Most of these are surface proteins and
include sperm antigen 10 (SP10), SP17, FA-1, LDH-C4, and
PH-20 (47). While some effect could be expected in vaccinated
male animals, the large number of sperm in the male reproductive tract and observed autoimmune-mediated orchitis
have focused efforts instead on vaccinating the female. Fertility
levels in vaccinated females are generally reduced from levels
around 75 to 80% to 25 to 30% in a range of species including
mice (95), baboons (127, 171), and guinea pigs (179). The
potency of the range of antigens is similar, and no one sperm
antigen gives an exceptional contraceptive effect.
Oocyte antigens. A family of surface antigens from the zona
pellucida (ZP) has been identified as providing effective immunocontraception. These surface antigens have been re-
VOL. 20, 2007
VETERINARY VACCINES
ferred to by a variety of terms that may vary between species.
The major antigens are ZPA (also termed ZP2), ZPB (ZP1),
and ZPC (ZP3). Most work has focused on ZPC, with a range
of approaches. Vaccine studies have used formulations containing porcine ZPC, as it cross-reacts with the ZPC of many
other species.
For a period between approximately 2002 and 2005, a vaccine called SpayVac was commercially available (Table 5),
which was based on a crude porcine ZP antigen preparation,
probably purified from pig ovaries. This was shown to have
efficacy in a number of species (27). SpayVac was supplied to
researchers for experimental wildlife population control and
should not be considered to be a major commercialized vaccine product.
Many of the experimental ZP-based vaccines have induced
reasonably high levels of efficacy sufficient to engender strong
interest in further development and commercialization, with
ZP antigens alone or in combination with sperm antigens to
increase efficacy. Such combination vaccines as recombinant
fusion antigens have been tested in a range of species to good
effect (95).
Despite considerable scientific advances, there has been only
very limited commercial success of gamete antigen-based vaccines. This approach has some major difficulties for wild or
feral animal populations, including developing a delivery system to mass vaccinate wild animal populations without capture
or restraint and being capable of delivering a booster dose, i.e.,
allow revaccination; ensuring the specificity of the delivery
system to ensure vaccination of the target species only and to
prevent unintentional vaccination and downregulation of fertility in bystander and native animal species; ensuring reasonable duration of efficacy (the duration required would be related to the frequency and effectiveness of boost vaccinations);
and being able to induce and maintain high levels of antibody
in the female reproductive tract.
Currently, these issues remain unresolved, and it is unlikely
that fertility control vaccines will be used in wildlife management programs or commercialized until such technical hurdles
are overcome. For application of gamete antigen vaccines in
humans, the safety of the formulation would need to be demonstrated. Many constructs of ZP-based vaccines resulted in
inflammation and immunopathology of the ovaries. The use of
sperm antigens in the female would be less likely to induce
safety problems.
Vaccines To Increase Fertility
There have been three fecundity vaccines for sheep that
have been commercialized, all based on stimulating an immune
response to the steroid androstenedione. Vaccination of ewes
against this intermediate steroid leads to a reduction in estrogen levels, and estrogen (␤-estradiol) has a negative-feedback
effect on the production of follicle-stimulating hormone. Thus,
immunoneutralization of androstenedione leads to the increased production of follicle-stimulating hormone, and this
has the effect of increasing the frequency of multiple ovulations. The immunogen in the first available vaccine, Fecundin,
was polyandroalbumin that contained androstenedione linked
to human serum albumin. Similar vaccines, Androvax and
Ovastim, are now marketed in New Zealand and Australia,
505
respectively. Vaccination is carried out 5 and 2 weeks before
mating for 6 to 8 weeks; in subsequent years, a booster dose is
given to the flock 2 weeks before mating. The claimed increase
in twinning is about 20 to 25% across a flock of ewes. The
actual increased yield of lambs achieved with Fecundin was
variable, and the vaccine was withdrawn from market. For
these vaccines that increase fecundity, the correct nutritional
maintenance of ewes with twins is not always easily managed,
and vaccination will not correct underlying fertility problems.
CONCLUSION AND FUTURE DIRECTIONS
Vaccinology has become a recognized science that combines
disciplines of immunology, microbiology, protein chemistry,
and molecular biology with practical considerations of production costs, regulatory affairs, and commercial returns. The ultimate aim of any new vaccine is to provide a product that will
be used to protect animals and humans against disease. More
recently, vaccines have also found applications in animal production and reproduction processes. Veterinary vaccines have
already made enormous impacts not only on animal health,
welfare, and production but also on human health. A continuous interchange between animal and human disease control
agencies and scientists will be essential to be prepared for the
ever-present threat of new, emerging diseases (83). This is
exemplified most recently with the advent of avian influenza
virus, where poultry and wildfowl are identified as the major
carriers of the disease, but recent data have shown that both
wild and domestic cats can also become infected and may
present a source of disease for humans (91). Pigs are susceptible to both avian and human influenza viruses, and it is
speculated that coinfection of pigs with highly pathogenic
avian influenza virus and human influenza virus may create
viral reassortant strains with the ability for human-to-human
transmission (40). Increasing animal travel and wildlife-human
interactions promoted by global climate changes will also require sustained surveillance for the spread of diseases in different parts of the world, with both domestic, production, and
wild animals forming important reservoirs of many vectorborne human diseases; e.g., the emergence of WNV in the
United States and Europe requires continuous surveillance
and control programs for the presence of the virus in birds and
horses as well as humans (72). A novel addition to veterinary
vaccines for human disease is a cattle vaccine against Escherichia coli O157:H7 that recently received a conditional license
for distribution from the Canadian Food Inspection Agency. E.
coli O157:H7 is a leading cause of food-borne disease in humans worldwide, and ruminant livestock are considered to be
its major reservoir.
As highlighted in this review, much progress has been made
in expanding the range of veterinary vaccines available as well
as increasing efficacy and reducing side effects of existing vaccines. Many problems remain to be resolved, and there is
ample scope to incorporate new knowledge and technologies
into vaccine design. In particular, most vaccines are still based
on live, attenuated pathogen strains. Apart from the obvious
dangers involved with this type of immunization, this approach
is not generally desirable for commercial companies, as it exposes them to risks of mitigation, and the short shelf life and
strain/region specificity of many vaccines make them uneco-
506
MEEUSEN ET AL.
nomical to produce. While several variably defined subunit
vaccines are available on the veterinary market, they are generally much less protective than live organisms. A better understanding of the molecular and immunological disease processes is likely to be required to improve the effectiveness of
killed or subunit vaccines. In particular, while it is well established that the immune system has several effector mechanisms
to deal with different pathogens depending on their individual
life cycles and microenvironments (Fig. 1), most killed and
subunit vaccines still rely predominantly on the induction of
neutralizing antibodies (93). An increased ability to target
pathogens at different stages of their life cycle is likely to open
up new avenues for antigen discovery and increase the effectiveness of killed or subunit vaccines. One way that this may be
achieved is through novel delivery systems such as plasmid
DNA, liposomes, nano- or microparticles, and live vectors that
introduce the vaccine antigens into the intracellular compartment (reviewed in references 4, 25, 61, and 154). Another
major advance in immunology that will have an impact on an
often neglected part of vaccine development is the increased
awareness of the central role that innate immunity plays in the
action of vaccine adjuvants (144). The recently discovered innate immune receptors are currently being screened for active
novel adjuvant compounds (134), and their corresponding ligands (pathogen-associated molecular patterns) are being
used to increase or modulate vaccine responses (77, 85, 169).
The use of adjuvants in veterinary vaccinology is much less
restricted than that in human vaccines, and a large number of
different types and formulations of adjuvants are currently
used in licensed veterinary vaccines, compared to only three
adjuvants licensed for human vaccine use (134). In many cases,
the details of the veterinary adjuvants are unfortunately withheld as proprietary information, but hopefully, this area will be
reviewed in the near future.
Apart from the scientific challenges that are being addressed, the development of a commercially successful veterinary vaccine also needs to meet the regulatory hurdles that
pave the route to the marketplace. For example, under current
U.S. law, vaccines that target noninfectious disease (e.g., production gains and reproduction) come under the more stringent jurisdiction of the FDA and are treated as pharmaceuticals, whereas most animal vaccines come under the USDA,
with more rapid and lower-cost routes to registration. In the
European Union, regulatory matters are based on European
Union legislation, and company dossiers are assessed and legalized by the European Medicines Evaluation Agency. In
principle, three different procedures can be used to register a
vaccine. During the centralized procedure, new and innovative
vaccines are assessed and legalized in all member states in one
procedure. During the mutual recognition procedure, the company selects a single reference country to evaluate the vaccine
dossier, which is followed by an application in the relevant
countries to have the vaccine registered afterwards. The third
possibility is to apply for the recently introduced decentralized
procedure, which can be chosen when a more expedient registration is desired. In this case, the vaccine dossier is reviewed
by all selected countries at the same time to save the first step
in the mutual recognition procedure. The Veterinary International Committee for Harmonization brings together the regulatory authorities of the European Union, Japan, and the
CLIN. MICROBIOL. REV.
United States and representatives from the animal health industry in the three regions to harmonize technical requirements for the registration of veterinary products. The Veterinary International Committee for Harmonization harmonizes
guidelines that represent scientific consensus regarding regulatory requirements for the three regions. Expert working
groups, under the supervision of the Steering Committee, are
created to draft and recommend the harmonized guidelines.
Research and development form the basis for the generation
of new and improved veterinary vaccines. Animal scientists can
borrow heavily from medical research, particularly in the areas
of welfare and geriatric medicine for companion animals,
which are becoming increasingly lucrative markets for animal
health companies (166). On the other hand, animal research
scientists can also significantly contribute to human vaccine
development, as they are able to bridge the gap between results
obtained in small-rodent models, which are often not directly
translatable to humans. Due to their similar sizes and anatomies, large-animal models are particularly useful for the testing of different delivery systems (160, 197) and have been
extensively used to optimize the uptake of plasmid DNA for
effective DNA vaccination (85, 155, 183). New animal health
vaccines are also likely to be therapeutic rather than prophylactic, with cancer and osteoarthritis in longer-lived companion
animals being obvious targets. Expected reductions in the cost
of recombinant antibodies should make the passive immunotherapy of dogs and cats feasible. Due to their less stringent
regulatory requirements and quicker route to the market, veterinary vaccines are also at the forefront of the testing and
commercialization of innovative technologies, as exemplified
by the recent successful licensing of two DNA vaccines for
horses and fish and the conditional license of a DNA vaccine
against CMM.
ACKNOWLEDGMENTS
We thank all the companies that provided up-to-date information
for their products and the scientific reviewers of the manuscript for
their useful comments and corrections.
REFERENCES
1. Alexander, A. N., M. K. Huelsmeyer, A. Mitzey, R. R. Dubielzig, I. D.
Kurzman, E. G. Macewen, and D. M. Vail. 2006. Development of an
allogeneic whole-cell tumor vaccine expressing xenogeneic gp100 and its
implementation in a phase II clinical trial in canine patients with malignant
melanoma. Cancer Immunol. Immunother. 55:433–442.
2. Allan, G. M., F. McNeilly, J. Ellis, S. Krakowka, A. Botner, K. McCullough,
H. Nauwynck, S. Kennedy, B. Meehan, and C. Charreyre. 2004. PMWS:
experimental model and co-infections. Vet. Microbiol. 98:165–168.
3. Ashford, D. A., J. di Pietra, J. Lingappa, C. Woods, H. Noll, B. Neville, R.
Weyant, S. L. Bragg, R. A. Spiegel, J. Tappero, and B. A. Perkins. 2004.
Adverse events in humans associated with accidental exposure to the livestock brucellosis vaccine RB51. Vaccine 22:3435–3439.
4. Azad, N., and Y. Rojanasakul. 2006. Vaccine delivery—current trends and
future. Curr. Drug Deliv. 3:137–146.
5. Babu, U., R. A. Dalloul, M. Okamura, H. S. Lillehoj, H. Xie, R. B.
Raybourne, D. Gaines, and R. A. Heckert. 2004. Salmonella enteritidis clearance and immune responses in chickens following Salmonella vaccination
and challenge. Vet. Immunol. Immunopathol. 101:251–257.
6. Bain, R. K. 1999. Irradiated vaccines for helminth control in livestock. Int.
J. Parasitol. 29:185–191.
7. Bain, R. K., and G. M. Urquhart. 1988. Parenteral vaccination of calves
against the cattle lungworm Dictyocaulus viviparus. Res. Vet. Sci. 45:270–
271.
8. Balamurugan, V., R. M. Kumar, and V. V. Suryanarayana. 2004. Past and
present vaccine development strategies for the control of foot-and-mouth
disease. Acta Virol. 48:201–214.
9. Balic, A., V. M. Bowles, and E. N. Meeusen. 2000. The immunobiology of
VOL. 20, 2007
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
gastrointestinal nematode infections in ruminants. Adv. Parasitol. 45:181–
241.
Barbour, E. K., S. K. Hamadeh, and A. Eidt. 2000. Infection and immunity
in broiler chicken breeders vaccinated with a temperature-sensitive mutant
of Mycoplasma gallisepticum and impact on performance of offspring. Poult.
Sci. 79:1730–1735.
Baron, M. D., A. C. Banyard, S. Parida, and T. Barrett. 2005. The Plowright
vaccine strain of rinderpest virus has attenuating mutations in most genes.
J. Gen. Virol. 86:1093–1101.
Barrett, T., P.-P. Pastoret, and W. Taylor. 2006. Rinderpest and peste des
petits ruminants, virus plagues of large and small ruminants. Elsevier,
London, United Kingdom.
Beer, M., I. Reimann, B. Hoffmann, and K. Depner. 4 January 2007, posting
date. Novel marker vaccines against classical swine fever. Vaccine doi:
10.1016/j.vaccine.2006.12.036.
Belknap, E. B., L. M. Walters, C. Kelling, V. K. Ayers, J. Norris, J.
McMillen, C. Hayhow, M. Cochran, D. N. Reddy, J. Wright, and J. K.
Collins. 1999. Immunogenicity and protective efficacy of a gE, gG and US2
gene-deleted bovine herpesvirus-1 (BHV-1) vaccine. Vaccine 17:2297–2305.
Belli, S. I., M. Lee, P. Thebo, M. G. Wallach, B. Schwartsburd, and N. C.
Smith. 2002. Biochemical characterisation of the 56 and 82 kDa immunodominant gametocyte antigens from Eimeria maxima. Int. J. Parasitol.
32:805–816.
Belli, S. I., K. Mai, C. D. Skene, M. T. Gleeson, D. M. Witcombe, M. Katrib,
A. Finger, M. G. Wallach, and N. C. Smith. 2004. Characterisation of the
antigenic and immunogenic properties of bacterially expressed, sexual stage
antigens of the coccidian parasite, Eimeria maxima. Vaccine 22:4316–4325.
Bergman, J. G., M. Muniz, D. Sutton, R. Fensome, F. Ling, and G. Paul.
2006. Comparative trial of the canine parvovirus, canine distemper virus
and canine adenovirus type 2 fractions of two commercially available modified live vaccines. Vet. Rec. 159:733–736.
Bergman, P. J., J. McKnight, A. Novosad, S. Charney, J. Farrelly, D. Craft,
M. Wulderk, Y. Jeffers, M. Sadelain, A. E. Hohenhaus, N. Segal, P. Gregor,
M. Engelhorn, I. Riviere, A. N. Houghton, and J. D. Wolchok. 2003. Longterm survival of dogs with advanced malignant melanoma after DNA vaccination with xenogeneic human tyrosinase: a phase I trial. Clin. Cancer
Res. 9:1284–1290.
Bethony, J. M., A. Loukas, P. J. Hotez, and D. P. Knox. 2006. Vaccines
against blood-feeding nematodes of humans and livestock. Parasitology
133:S63–S79.
Blanchard, P., D. Mahe, R. Cariolet, A. Keranflec’h, M. A. Baudouard, P.
Cordioli, E. Albina, and A. Jestin. 2003. Protection of swine against postweaning multisystemic wasting syndrome (PMWS) by porcine circovirus
type 2 (PCV2) proteins. Vaccine 21:4565–4575.
Borja-Cabrera, G. P., N. N. Correia Pontes, V. O. da Silva, E. Paraguai de
Souza, W. R. Santos, E. M. Gomes, K. G. Luz, M. Palatnik, and C. B.
Palatnik de Sousa. 2002. Long lasting protection against canine kala-azar
using the FML-QuilA saponin vaccine in an endemic area of Brazil (Sao
Goncalo do Amarante, RN). Vaccine 20:3277–3284.
Borja-Cabrera, G. P., A. Cruz Mendes, E. Paraguai de Souza, L. Y. H.
Okada, F. A. de A Trivellato, J. K. Kawasaki, A. C. Costa, A. B. Reis, O.
Genaro, L. M. Batista, M. Palatnik, and C. B. Palatnik-de-Sousa. 2004.
Effective immunotherapy against canine visceral leishmaniasis with the
FML-vaccine. Vaccine 22:2234–2243.
Boulter, N., and R. Hall. 1999. Immunity and vaccine development in the
bovine theilerioses. Adv. Parasitol. 44:41–97.
Bouma, A. 2005. Determination of the effectiveness of Pseudorabies marker
vaccines in experiments and field trials. Biologicals 33:241–245.
Bramwell, V. W., and Y. Perrie. 2006. Particulate delivery systems for
vaccines: what can we expect? J. Pharm. Pharmacol. 58:717–728.
Brochier, B., M. P. Kieny, F. Costy, P. Coppens, B. Bauduin, J. P. Lecocq,
B. Languet, G. Chappuis, P. Desmettre, K. Afiademanyo, et al. 1991. Largescale eradication of rabies using recombinant vaccinia-rabies vaccine. Nature 354:520–522.
Brown, R. G., W. D. Bowen, J. D. Eddington, W. C. Kimmins, M. Mezei,
J. L. Parsons, and B. Pohajdak. 1997. Temporal trends in antibody production in captive grey, harp and hooded seals to a single administration
immunocontraceptive vaccine. J. Reprod. Immunol. 35:53–64.
Bryans, J. T., E. R. Doll, J. C. Wilson, and W. H. McCollum. 1966. Immunization for equine influenza. J. Am. Vet. Med. Assoc. 148:413–417.
Bublot, M., N. Pritchard, D. E. Swayne, P. Selleck, K. Karaca, D. L. Suarez,
J. C. Audonnet, and T. R. Mickle. 2006. Development and use of fowlpox
vectored vaccines for avian influenza. Ann. N. Y. Acad. Sci. 1081:193–201.
Buxton, D., and E. A. Innes. 1995. A commercial vaccine for ovine toxoplasmosis. Parasitology 110:S11–S16.
Callow, L. L., R. J. Dalgliesh, and A. J. de Vos. 1997. Development of
effective living vaccines against bovine babesiosis—the longest field trial?
Int. J. Parasitol. 27:747–767.
Reference deleted.
Carter, P. B. 2003. The current state of veterinary vaccines: is there hope
for the future? J. Vet. Med. Ed. 30:152–154.
Chalmers, W. S., J. Simpson, S. J. Lee, and W. Baxendale. 1997. Use of a
VETERINARY VACCINES
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
507
live chlamydial vaccine to prevent ovine enzootic abortion. Vet. Rec. 141:
63–67.
Chiers, K., I. van Overbeke, P. De Laender, R. Ducatelle, S. Carel, and F.
Haesebrouck. 1998. Effects of endobronchial challenge with Actinobacillus
pleuropneumoniae serotype 9 of pigs vaccinated with inactivated vaccines
containing the Apx toxins. Vet. Q. 20:65–69.
Clarke, I. J., H. M. Fraser, and A. S. McNeilly. 1978. Active immunization
of ewes against luteinizing hormone releasing hormone, and its effects on
ovulation and gonadotrophin, prolactin and ovarian steroid secretion. J.
Endocrinol. 78:39–47.
Colombo, S., P. B. Hill, D. J. Shaw, and K. L. Thoday. 2005. Effectiveness
of low dose immunotherapy in the treatment of canine atopic dermatitis: a
prospective, double-blinded, clinical study. Vet. Dermatol. 16:162–170.
Cook, R. B., J. D. Popp, J. P. Kastelic, S. Robbins, and R. Harland. 2000.
The effects of active immunization against gnRH on testicular development, feedlot performance, and carcass characteristics of beef bulls. J.
Anim. Sci. 78:2778–2783.
Coquet, L., P. Cosette, L. Quillet, F. Petit, G. A. Junter, and T. Jouenne.
2002. Occurrence and phenotypic characterization of Yersinia ruckeri strains
with biofilm-forming capacity in a rainbow trout farm. Appl. Environ. Microbiol. 68:470–475.
Cyranoski, D. 2005. Bird flu spreads among Java’s pigs. Nature 435:390–
391.
Dalgliesh, R. J., L. L. Callow, L. T. Mellors, and W. McGregor. 1981.
Development of a highly infective Babesia bigemina vaccine of reduced
virulence. Aust. Vet. J. 57:8–11.
Dantas-Torres, F. 2006. Leishmune vaccine: the newest tool for prevention
and control of canine visceral leishmaniosis and its potential as a transmission-blocking vaccine. Vet. Parasitol. 141:1–8.
Darteil, R., M. Bublot, E. Laplace, J. F. Bouquet, J. C. Audonnet, and M.
Riviere. 1995. Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection
against an IBDV virulent challenge in chickens. Virology 211:481–490.
da Silva, V. O., G. P. Borja-Cabrera, N. N. Correia Pontes, E. P. de Souza,
K. G. Luz, M. Palatnik, and C. B. Palatnik de Sousa. 2000. A phase III trial
of efficacy of the FML-vaccine against canine kala-azar in an endemic area
of Brazil (Sao Goncalo do Amaranto, RN). Vaccine 19:1082–1092.
Davis, B. S., G. J. Chang, B. Cropp, J. T. Roehrig, D. A. Martin, C. J.
Mitchell, R. Bowen, and M. L. Bunning. 2001. West Nile virus recombinant
DNA vaccine protects mouse and horse from virus challenge and expresses
in vitro a noninfectious recombinant antigen that can be used in enzymelinked immunosorbent assays. J. Virol. 75:4040–4047.
Day, M. J. 2006. Vaccine side effects: fact and fiction. Vet. Microbiol.
117:51–58.
Delves, P. J., T. Lund, and I. M. Roitt. 2002. Antifertility vaccines. Trends
Immunol. 23:213–219.
de Waal, D. T., and M. P. Combrink. 2006. Live vaccines against bovine
babesiosis. Vet. Parasitol. 138:88–96.
Doel, T. R. 2003. FMD vaccines. Virus Res. 91:81–99.
Dowsett, K. F., W. A. Pattie, L. M. Knott, A. E. Jackson, R. M. Hoskinson,
R. P. Rigby, and B. A. Moss. 1991. A preliminary study of immunological
castration in colts. J. Reprod. Fertil. Suppl. 44:183–190.
Dubey, J. P., and D. S. Lindsay. 1996. A review of Neospora caninum and
neosporosis. Vet. Parasitol. 67:1–59.
Dufour, R., C. Roulet, C. Chouvet, and M. B. Bonneau. December 1996.
Method for improving the organoleptic qualities of the meat from uncastrated male domestic animals, vaccines which are usable in this method,
new peptide, in particular, for producing these vaccines and vaccination kit
relating thereto. U.S. patent 5573767.
Dunshea, F. R., C. Colantoni, K. Howard, I. McCauley, P. Jackson, K. A.
Long, S. Lopaticki, E. A. Nugent, J. A. Simons, J. Walker, and D. P.
Hennessy. 2001. Vaccination of boars with a GnRH vaccine (Improvac)
eliminates boar taint and increases growth performance. J. Anim. Sci.
79:2524–2535.
Elhay, M., A. Newbold, A. Britton, P. Turley, K. Dowsett, and J. Walker.
2007. Suppression of behavioural and physiological oestrus in the mare by
vaccination against GnRH. Aust. Vet. J. 85:35–45.
Fenaux, M., T. Opriessnig, P. G. Halbur, F. Elvinger, and X. J. Meng. 2004.
A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of
the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of
the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs. J. Virol. 78:6297–6303.
Ferrari, M., A. Brack, M. G. Romanelli, T. C. Mettenleiter, A. Corradi, N.
Dal Mas, M. N. Losio, R. Silini, C. Pinoni, and A. Pratelli. 2000. A study of
the ability of a TK-negative and gI/gE-negative pseudorabies virus (PRV)
mutant inoculated by different routes to protect pigs against PRV infection.
J. Vet. Med. B Infect. Dis. Vet. Public Health 47:753–762.
Ferro, V. A., and W. H. Stimson. 1998. Investigation into suitable carrier
molecules for use in an anti-gonadotrophin releasing hormone vaccine.
Vaccine 16:1095–1102.
Frey, J. 1995. Virulence in Actinobacillus pleuropneumoniae and RTX toxins. Trends Microbiol. 3:257–261.
508
MEEUSEN ET AL.
59. Garcia de la Fuente, J. N., C. B. Gutierrez-Martin, N. Ortega, E. F.
Rodriguez-Ferri, M. L. del Rio, O. R. Gonzalez, and J. Salinas. 2004.
Efficacy of different commercial and new inactivated vaccines against ovine
enzootic abortion. Vet. Microbiol. 100:65–76.
60. Reference deleted.
61. Gerdts, V., G. K. Mutwiri, S. K. Tikoo, and L. A. Babiuk. 2006. Mucosal
delivery of vaccines in domestic animals. Vet. Res. 37:487–510.
62. Gerhardt, R. 2006. West Nile virus in the United States (1999–2005). J Am.
Anim. Hosp. Assoc. 42:170–177.
63. Ghosh, S., J. Walker, and D. C. Jackson. 2001. Identification of canine
helper T-cell epitopes from the fusion protein of canine distemper virus.
Immunology 104:58–66.
64. Gould, C. 2003. Successful oral vaccination. Skretting Outlook 20:10–11.
65. Graham, S. P., R. Pelle, Y. Honda, D. M. Mwangi, N. J. Tonukari, M.
Yamage, E. J. Glew, E. P. de Villiers, T. Shah, R. Bishop, E. Abuya, E.
Awino, J. Gachanja, A. E. Luyai, F. Mbwika, A. M. Muthiani, D. M.
Ndegwa, M. Njahira, J. K. Nyanjui, F. O. Onono, J. Osaso, R. M. Saya, C.
Wildmann, C. M. Fraser, I. Maudlin, M. J. Gardner, S. P. Morzaria, S.
Loosmore, S. C. Gilbert, J. C. Audonnet, P. van der Bruggen, V. Nene, and
E. L. Taracha. 2006. Theileria parva candidate vaccine antigens recognized
by immune bovine cytotoxic T lymphocytes. Proc. Natl. Acad. Sci. USA
103:3286–3291.
66. Grubman, M. J. 2005. Development of novel strategies to control foot-andmouth disease: marker vaccines and antivirals. Biologicals 33:227–234.
67. Guedes, R. M., and C. J. Gebhart. 2003. Onset and duration of fecal
shedding, cell-mediated and humoral immune responses in pigs after challenge with a pathogenic isolate or attenuated vaccine strain of Lawsonia
intracellularis. Vet. Microbiol. 91:135–145.
68. Reference deleted.
69. Haesebrouck, F., F. Pasmans, K. Chiers, D. Maes, R. Ducatelle, and A.
Decostere. 2004. Efficacy of vaccines against bacterial diseases in swine:
what can we expect? Vet. Microbiol. 100:255–268.
70. Hardham, J., K. Dreier, J. Wong, C. Sfintescu, and R. T. Evans. 2005.
Pigmented-anaerobic bacteria associated with canine periodontitis. Vet.
Microbiol. 106:119–128.
71. Hardham, J., M. Reed, J. Wong, K. King, B. Laurinat, C. Sfintescu, and
R. T. Evans. 2005. Evaluation of a monovalent companion animal periodontal disease vaccine in an experimental mouse periodontitis model.
Vaccine 23:3148–3156.
72. Hayes, E. B., and D. J. Gubler. 2006. West Nile virus: epidemiology and
clinical features of an emerging epidemic in the United States. Annu. Rev.
Med. 57:181–194.
73. Heppell, J., and H. L. Davis. 2000. Application of DNA vaccine technology
to aquaculture. Adv. Drug Deliv. Rev. 43:29–43.
74. Reference deleted.
75. Hogge, G. S., J. K. Burkholder, J. Culp, M. R. Albertini, R. R. Dubielzig,
N. S. Yang, and E. G. MacEwen. 1999. Preclinical development of human
granulocyte-macrophage colony-stimulating factor-transfected melanoma
cell vaccine using established canine cell lines and normal dogs. Cancer
Gene Ther. 6:26–36.
76. Hoskinson, R. M., R. D. Rigby, P. E. Mattner, V. L. Huynh, M. D’Occhio,
A. Neish, T. E. Trigg, B. A. Moss, M. J. Lindsey, G. D. Coleman, et al. 1990.
Vaxstrate: an anti-reproductive vaccine for cattle. Aust. J. Biotechnol.
4:166–170, 176.
77. Huleatt, J. W., A. R. Jacobs, J. Tang, P. Desai, E. B. Kopp, Y. Huang, L.
Song, V. Nakaar, and T. J. Powell. 2007. Vaccination with recombinant
fusion proteins incorporating Toll-like receptor ligands induces rapid cellular and humoral immunity. Vaccine 25:763–775.
78. Innes, E. A., S. Wright, P. Bartley, S. Maley, C. Macaldowie, I. EstebanRedondo, and D. Buxton. 2005. The host-parasite relationship in bovine
neosporosis. Vet. Immunol. Immunopathol. 108:29–36.
79. Jackwood, M. W., and Y. M. Saif. 1985. Efficacy of a commercial turkey
coryza vaccine (Art-Vax) in turkey poults. Avian Dis. 29:1130–1139.
80. Jacobs, A. A., D. Goovaerts, P. J. Nuijten, R. P. Theelen, O. M. Hartford,
and T. J. Foster. 2000. Investigations towards an efficacious and safe strangles vaccine: submucosal vaccination with a live attenuated Streptococcus
equi. Vet. Rec. 147:563–567.
81. Jarosinski, K. W., B. K. Tischer, S. Trapp, and N. Osterrieder. 2006.
Marek’s disease virus: lytic replication, oncogenesis and control. Expert
Rev. Vaccines 5:761–772.
82. Johnson, K. S., G. B. Harrison, M. W. Lightowlers, K. L. O’Hoy, W. G.
Cougle, R. P. Dempster, S. B. Lawrence, J. G. Vinton, D. D. Heath, and
M. D. Rickard. 1989. Vaccination against ovine cysticercosis using a defined
recombinant antigen. Nature 338:585–587.
83. Kahn, L. H. 2006. Confronting zoonoses, linking human and veterinary
medicine. Emerg. Infect. Dis. 12:556–561.
84. Kelly, C., M. Bugg, C. Robinson, Z. Mitchell, N. Davis-Poynter, J. R.
Newton, K. A. Jolley, M. C. Maiden, and A. S. Waller. 2006. Sequence
variation of the SeM gene of Streptococcus equi allows discrimination of the
source of strangles outbreaks. J. Clin. Microbiol. 44:480–486.
85. Kennedy, N. J., T. W. Spithill, J. Tennent, P. R. Wood, and D. Piedrafita.
2006. DNA vaccines in sheep: CTLA-4 mediated targeting and CpG motifs
CLIN. MICROBIOL. REV.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
enhance immunogenicity in a DNA prime/protein boost strategy. Vaccine
24:970–979.
Killian, G., L. Miller, J. Rhyan, and H. Doten. 2006. Immunocontraception
of Florida feral swine with a single-dose GnRH vaccine. Am. J. Reprod.
Immunol. 55:378–384.
Kirkbride, C. A. 1993. Diagnoses in 1,784 ovine abortions and stillbirths. J
Vet. Diagn. Investig. 5:398–402.
Kocan, K. M., J. de la Fuente, A. A. Guglielmone, and R. D. Melendez.
2003. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin. Microbiol. Rev. 16:698–712.
Kreeger, T. J., W. E. Cook, W. H. Edwards, P. H. Elzer, and S. C. Olsen.
2002. Brucella abortus strain RB51 vaccination in elk. II. Failure of high
dosage to prevent abortion. J. Wildl. Dis. 38:27–31.
Kroll, J. J., M. B. Roof, and S. McOrist. 2004. Evaluation of protective
immunity in pigs following oral administration of an avirulent live vaccine
of Lawsonia intracellularis. Am. J. Vet. Res. 65:559–565.
Kuiken, T., G. Rimmelzwaan, D. van Riel, G. van Amerongen, M. Baars, R.
Fouchier, and A. Osterhaus. 2004. Avian H5N1 influenza in cats. Science
306:241.
Ladd, A. E., C. Y. Wang, and T. J. Zamb. January 1998. Immunogenic
LHRH peptide constructs and synthetic universal immune stimulators for
vaccines. U.S. patent 5843446.
Lambert, P. H., M. Liu, and C. A. Siegrist. 2005. Can successful vaccines
teach us how to induce efficient protective immune responses? Nat. Med.
11:S54–S62.
Larche, M., C. A. Akdis, and R. Valenta. 2006. Immunological mechanisms
of allergen-specific immunotherapy. Nat. Rev. Immunol. 6:761–771.
Lea, I. A., E. E. Widgren, and M. G. O’Rand. 2002. Analysis of recombinant
mouse zona pellucida protein 2 (ZP2) constructs for immunocontraception.
Vaccine 20:1515–1523.
Lehman, J. R., R. M. Weigel, A. M. Siegel, L. G. Herr, A. C. Taft, and W. F.
Hall. 1993. Progress after one year of a pseudorabies eradication program
for large swine herds. J. Am. Vet. Med. Assoc. 203:118–121.
Liang, R., J. V. van den Hurk, L. A. Babiuk, and S. van Drunen Littel-van
den Hurk. 2006. Priming with DNA encoding E2 and boosting with E2
protein formulated with CpG oligodeoxynucleotides induces strong immune responses and protection from bovine viral diarrhea virus in cattle.
J. Gen. Virol. 87:2971–2982.
Lightowlers, M. W., and D. D. Heath. 2004. Immunity and vaccine control
of Echinococcus granulosus infection in animal intermediate hosts. Parasitologia 46:27–31.
Lorenzen, N., and S. E. LaPatra. 2005. DNA vaccines for aquacultured fish.
Rev. Sci. Tech. 24:201–213.
Mackowiak, M., J. Maki, L. Motes-Kreimeyer, T. Harbin, and K. Van
Kampen. 1999. Vaccination of wildlife against rabies: successful use of a
vectored vaccine obtained by recombinant technology. Adv. Vet. Med.
41:571–583.
Maes, R. K., M. D. Sussman, A. Vilnis, and B. J. Thacker. 1997. Recent
developments in latency and recombination of Aujeszky’s disease (pseudorabies) virus. Vet. Microbiol. 55:13–27.
Maizels, R. M., A. Balic, N. Gomez-Escobar, M. Nair, M. D. Taylor, and
J. E. Allen. 2004. Helminth parasites—masters of regulation. Immunol.
Rev. 201:89–116.
Marcelino, I., M. F. Sousa, C. Verissimo, A. E. Cunha, M. J. Carrondo, and
P. M. Alves. 2006. Process development for the mass production of Ehrlichia ruminantium. Vaccine 24:1716–1725.
Marsh, A. E., J. Lakritz, P. J. Johnson, M. A. Miller, Y. W. Chiang, and
H. J. Chu. 2004. Evaluation of immune responses in horses immunized
using a killed Sarcocystis neurona vaccine. Vet. Ther. 5:34–42.
Martens, A., A. De Moor, L. Vlaminck, F. Pille, and M. Steenhaut. 2001.
Evaluation of excision, cryosurgery and local BCG vaccination for the
treatment of equine sarcoids. Vet. Rec. 149:665–669.
McKeever, D. J., E. L. Taracha, W. I. Morrison, A. J. Musoke, and S. P.
Morzaria. 1999. Protective immune mechanisms against Theileria parva:
evolution of vaccine development strategies. Parasitol. Today 15:263–267.
McOrist, S., S. Jasni, R. A. Mackie, N. MacIntyre, N. Neef, and G. H.
Lawson. 1993. Reproduction of porcine proliferative enteropathy with pure
cultures of ileal symbiont intracellularis. Infect. Immun. 61:4286–4292.
Medina, E., and C. A. Guzman. 2001. Use of live bacterial vaccine vectors
for antigen delivery: potential and limitations. Vaccine 19:1573–1580.
Meeusen, E. N., and D. Piedrafita. 2003. Exploiting natural immunity to
helminth parasites for the development of veterinary vaccines. Int. J. Parasitol. 33:1285–1290.
Reference deleted.
Reference deleted.
Miller, L. A., J. C. Rhyan, and M. Drew. 2004. Contraception of bison by
GnRH vaccine: a possible means of decreasing transmission of brucellosis
in bison. J. Wildl. Dis. 40:725–730.
Minke, J. M., J. C. Audonnet, and L. Fischer. 2004. Equine viral vaccines:
the past, present and future. Vet. Res. 35:425–443.
Monath, T. P., J. Arroyo, C. Miller, and F. Guirakhoo. 2001. West Nile
virus vaccine. Curr. Drug Targets Infect. Disord. 1:37–50.
VOL. 20, 2007
115. Monath, T. P., J. Liu, N. Kanesa-Thasan, G. A. Myers, R. Nichols,
A. Deary, K. McCarthy, C. Johnson, T. Ermak, S. Shin, J. Arroyo, F.
Guirakhoo, J. S. Kennedy, F. A. Ennis, S. Green, and P. Bedford. 2006. A
live, attenuated recombinant West Nile virus vaccine. Proc. Natl. Acad. Sci.
USA 103:6694–6699.
116. Moormann, R. J., A. Bouma, J. A. Kramps, C. Terpstra, and H. J. De Smit.
2000. Development of a classical swine fever subunit marker vaccine and
companion diagnostic test. Vet. Microbiol. 73:209–219.
117. Moreau, Y., E. Vidor, G. Bissuel, and N. Dubreuil. 1989. Vaccination
against canine babesiosis: an overview of field observations. Trans. R. Soc.
Trop. Med. Hyg. 83(Suppl.):95–96.
118. Moriyon, I., M. J. Grillo, D. Monreal, D. Gonzalez, C. Marin, I. LopezGoni, R. C. Mainar-Jaime, E. Moreno, and J. M. Blasco. 2004. Rough
vaccines in animal brucellosis: structural and genetic basis and present
status. Vet. Res. 35:1–38.
119. Morrow, C. J., J. F. Markham, and K. G. Whithear. 1998. Production of
temperature-sensitive clones of Mycoplasma synoviae for evaluation as live
vaccines. Avian Dis. 42:667–670.
120. Mortensen, S., R. Stryhn, A. Boklund, K. D. Stark, J. Christensen, and P.
Willeberg. 2002. Risk factors for infection of sow herds with porcine reproductive and respiratory syndrome (PRRS) virus. Prev. Vet. Med. 53:83–101.
121. Murphy, F. A., E. P. J. Gibbs, M. C. Horzinek, and M. J. Studdert. 1999.
Veterinary virology, 3rd ed. Academic Press, London, United Kingdom.
122. Murtaugh, M. P., M. R. Elam, and L. T. Kakach. 1995. Comparison of the
structural protein coding sequences of the VR-2332 and Lelystad virus
strains of the PRRS virus. Arch. Virol. 140:1451–1460.
123. Newton, S. E., and E. N. Meeusen. 2003. Progress and new technologies for
developing vaccines against gastrointestinal nematode parasites of sheep.
Parasite Immunol. 25:283–296.
124. Nielsen, K., D. R. Ewalt, B. Garin-Bastuji, A. P. MacMillan, J. Stack, and
P. Wright. 2004. Bovine brucellosis, p. 409–438. In Office International des
Epizooties (ed.), Manual of diagnostic tests and vaccines for terrestrial
animals. Office International des Epizooties, Paris, France.
125. Nogueira, F. S., M. A. Moreira, G. P. Borja-Cabrera, F. N. Santos, I. Menz,
L. E. Parra, Z. Xu, H. J. Chu, C. B. Palatnik-de-Sousa, and M. C. Luvizotto.
2005. Leishmune vaccine blocks the transmission of canine visceral leishmaniasis: absence of Leishmania parasites in blood, skin and lymph nodes
of vaccinated exposed dogs. Vaccine 23:4805–4810.
126. Nuttall, P. A., A. R. Trimnell, M. Kazimirova, and M. Labuda. 2006.
Exposed and concealed antigens as vaccine targets for controlling ticks and
tick-borne diseases. Parasite Immunol. 28:155–163.
127. O’Hern, P. A., C. S. Bambra, M. Isahakia, and E. Goldberg. 1995. Reversible contraception in female baboons immunized with a synthetic epitope of
sperm-specific lactate dehydrogenase. Biol. Reprod. 52:331–339.
128. Olson, M. E., H. Ceri, and D. W. Morck. 2000. Giardia vaccination. Parasitol. Today 16:213–217.
129. Olson, M. E., D. W. Morck, and H. Ceri. 1997. Preliminary data on the
efficacy of a Giardia vaccine in puppies. Can. Vet. J. 38:777–779.
130. Paillot, R., D. Hannant, J. H. Kydd, and J. M. Daly. 2006. Vaccination
against equine influenza: quid novi? Vaccine 24:4047–4061.
131. Paoletti, E. 1996. Applications of pox virus vectors to vaccination: an update. Proc. Natl. Acad. Sci. USA 93:11349–11353.
132. Pardo, M. C., and M. Mackowiak. 1999. Efficacy of a new canine-origin,
modified-live virus vaccine against canine coronavirus. Canine Practice
24:6–8.
133. Park, M. S., J. Steel, A. Garcia-Sastre, D. Swayne, and P. Palese. 2006.
Engineered viral vaccine constructs with dual specificity: avian influenza
and Newcastle disease. Proc. Natl. Acad. Sci. USA 103:8203–8208.
134. Pashine, A., N. M. Valiante, and J. B. Ulmer. 2005. Targeting the innate
immune response with improved vaccine adjuvants. Nat. Med. 11:S63–S68.
135. Pastoret, P. P., and B. Brochier. 1999. Epidemiology and control of fox
rabies in Europe. Vaccine 17:1750–1754.
136. Pastoret, P. P., and P. Jones. 2004. Veterinary vaccines for animal and
public health. Dev. Biol. (Basel) 119:15–29.
137. Pensaert, M., G. Labarque, H. Favoreel, and H. Nauwynck. 2004. Aujeszky’s
disease vaccination and differentiation of vaccinated from infected pigs.
Dev. Biol. (Basel) 119:243–254.
138. Perrin, B., M. Perrin, A. Moussa, and M. Coudert. 1996. Evaluation of a
commercial gE blocking ELISA test for detection of antibodies to infectious bovine rhinotracheitis virus. Vet. Rec. 138:520.
139. Philippon, V. 2006. Modified vaccinia Ankara (MVA) vector vaccines.
University of California San Francisco School of Medicine, San Francisco,
CA. http://chi.ucsf.edu/vaccines/vaccines?page⫽vc-01-04.
140. Pipano, E., and V. Shkap. 2000. Vaccination against tropical theileriosis.
Ann. N. Y. Acad. Sci. 916:484–500.
141. Plowright, W. 1972. The production and use of rinderpest cell culture
vaccine in developing countries. World Anim. Rev. 1:14–18.
142. Pluimers, F. H. 2004. Foot-and-mouth disease control using vaccination:
the Dutch experience in 2001. Dev. Biol. (Basel) 119:41–49.
143. Powell, K. 2004. DNA vaccines—back in the saddle again? Nat. Biotechnol.
22:799–801.
144. Pulendran, B., and R. Ahmed. 2006. Translating innate immunity into
VETERINARY VACCINES
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
509
immunological memory: implications for vaccine development. Cell 124:
849–863.
Rank, R. G. 1999. Models of immunity, p. 239–295. In R. S. Stephens (ed.),
Chlamydia: intracellular biology, pathogenesis, and immunity. American
Society for Microbiology, Washington, DC.
Rautenschlein, S., C. Kraemer, J. Vanmarcke, and E. Montiel. 2005. Protective efficacy of intermediate and intermediate plus infectious bursal
disease virus (IBDV) vaccines against very virulent IBDV in commercial
broilers. Avian Dis. 49:231–237.
Robbins, S. C., M. D. Jelinski, and R. L. Stotish. 2004. Assessment of the
immunological and biological efficacy of two different doses of a recombinant GnRH vaccine in domestic male and female cate (Felis catus). J.
Reprod. Immunol. 64:107–119.
Rodolakis, A. 1983. In vitro and in vivo properties of chemically induced
temperature-sensitive mutants of Chlamydia psittaci var. ovis: screening in
a murine model. Infect. Immun. 42:525–530.
Rodolakis, A., and A. Souriau. 1986. Response of goats to vaccination with
temperature-sensitive mutants of Chlamydia psittaci obtained by nitrosoguanidine mutagenesis. Am. J. Vet. Res. 47:2627–2631.
Roeder, P. 2006. Rinderpest eradication—is it feasible? p. 61–62. In I.
Olsen and T. Gjøen (ed.), Proceedings of the International Veterinary
Vaccine and Diagnostics Conference, Oslo, Norway. Reprosentralen, University of Oslo, Oslo, Norway.
Romero, J. J., E. Perez, and K. Frankena. 2004. Effect of a killed whole
Neospora caninum tachyzoite vaccine on the crude abortion rate of Costa
Rican dairy cows under field conditions. Vet. Parasitol. 123:149–159.
Rupprecht, C. E., C. A. Hanlon, and D. Slate. 2004. Oral vaccination of
wildlife against rabies: opportunities and challenges in prevention and control. Dev. Biol. (Basel) 119:173–184.
Rutten, V. P., W. R. Klein, W. A. De Jong, W. Misdorp, P. A. Steerenberg,
W. H. De Jong, W. Den Otter, and E. J. Ruitenberg. 1991. Immunotherapy
of bovine ocular squamous cell carcinoma by repeated intralesional injections of live bacillus Calmette-Guerin (BCG) or BCG cell walls. Cancer
Immunol. Immunother. 34:186–190.
Scheerlinck, J. P., and D. L. Greenwood. 2006. Particulate delivery systems
for animal vaccines. Methods 40:118–124.
Scheerlinck, J. P., J. Karlis, T. E. Tjelle, P. J. Presidente, I. Mathiesen, and
S. E. Newton. 2004. In vivo electroporation improves immune responses to
DNA vaccination in sheep. Vaccine 22:1820–1825.
Schetters, T. 2005. Vaccination against canine babesiosis. Trends Parasitol.
21:179–184.
Schurig, G. G., R. M. Roop II, T. Bagchi, S. Boyle, D. Buhrman, and N.
Sriranganathan. 1991. Biological properties of RB51; a stable rough strain
of Brucella abortus. Vet. Microbiol. 28:171–188.
Schurig, G. G., N. Sriranganathan, and M. J. Corbel. 2002. Brucellosis
vaccines: past, present and future. Vet. Microbiol. 90:479–496.
Schynts, F., E. Baranowski, M. Lemaire, and E. Thiry. 1999. A specific PCR
to differentiate between gE negative vaccine and wildtype bovine herpesvirus type 1 strains. Vet. Microbiol. 66:187–195.
Sedgmen, B. J., S. A. Lofthouse, and E. N. Meeusen. 2006. The ovine nasal
mucosa: an alternative tissue site for mucosal immunization. Methods 38:
112–116.
Seregin, A., R. Nistler, V. Borisevich, G. Yamshchikov, E. Chaporgina,
C. W. Kwok, and V. Yamshchikov. 2006. Immunogenicity of West Nile virus
infectious DNA and its noninfectious derivatives. Virology 356:115–125.
Seya, T., T. Akazawa, J. Uehori, M. Matsumoto, I. Azuma, and K. Toyoshima. 2003. Role of Toll-like receptors and their adaptors in adjuvant
immunotherapy for cancer. Anticancer Res. 23:4369–4376.
Shams, H. 2005. Recent developments in veterinary vaccinology. Vet. J.
170:289–299.
Shirley, M. W., A. L. Smith, and F. M. Tomley. 2005. The biology of avian
Eimeria with an emphasis on their control by vaccination. Adv. Parasitol.
60:285–330.
Shkap, V., and E. Pipano. 2000. Culture-derived parasites in vaccination of
cattle against tick-borne diseases. Ann. N. Y. Acad. Sci. 916:154–171.
Shryock, T. R. 2004. The future of anti-infective products in animal health.
Nat. Rev. Microbiol. 2:425–430.
Simard, N., C. Lyngoy, V. Funk, G. Traxler, S. LaPatra, and K. Salonius.
2006. Research to market: meeting safety and efficacy requirements for a
DNA vaccine used in Atlantic salmon, p. 46. In I. Olsen and T. Gjøen (ed.),
Proceedings of the International Veterinary Vaccine and Diagnostics Conference, Oslo, Norway. Reprosentralen, University of Oslo, Oslo, Norway.
Simms, M. S., D. P. Scholfield, E. Jacobs, D. Michaeli, P. Broome, J. E.
Humphreys, and M. C. Bishop. 2000. Anti-GnRH antibodies can induce
castrate levels of testosterone in patients with advanced prostate cancer.
Br. J. Cancer 83:443–446.
Singh, M., and D. T. O’Hagan. 2003. Recent advances in veterinary vaccine
adjuvants. Int. J. Parasitol. 33:469–478.
Slate, D., C. E. Rupprecht, J. A. Rooney, D. Donovan, D. H. Lein, and R. B.
Chipman. 2005. Status of oral rabies vaccination in wild carnivores in the
United States. Virus Res. 111:68–76.
510
MEEUSEN ET AL.
171. Stevens, V. C. 1997. Some reproductive studies in the baboon. Hum. Reprod. Update 3:533–540.
172. Stoffregen, W. C., S. C. Olsen, and B. J. Bricker. 2006. Parenteral vaccination of domestic pigs with Brucella abortus strain RB51. Am. J. Vet. Res.
67:1802–1808.
173. Stout, T. A., and B. Colenbrander. 2004. Suppressing reproductive activity
in horses using GnRH vaccines, antagonists or agonists. Anim. Reprod. Sci.
82–83:633–643.
174. Sweeney, C. R., J. F. Timoney, J. R. Newton, and M. T. Hines. 2005.
Streptococcus equi infections in horses: guidelines for treatment, control,
and prevention of strangles. J. Vet. Intern. Med. 19:123–134.
175. Taylor, G. 2000. Castration—an abbreviated history of western manhood.
Routledge, New York, NY.
176. Taylor, J., B. Meignier, J. Tartaglia, B. Languet, J. VanderHoeven, G.
Franchini, C. Trimarchi, and E. Paoletti. 1995. Biological and immunogenic properties of a canarypox-rabies recombinant, ALVAC-RG (vCP65)
in non-avian species. Vaccine 13:539–549.
177. Timoney, J. F., and D. Eggers. 1985. Serum bactericidal responses to Streptococcus equi of horses following infection or vaccination. Equine Vet. J.
17:306–310.
178. Tshewang, U., K. F. Dowsett, L. M. Knott, and T. E. Trigg. 1997. Preliminary study of ovarian activity in fillies treated with a GnRH vaccine. Aust.
Vet. J. 75:663–667.
179. Tung, K. S., P. Primakoff, L. Woolman-Gamer, and D. G. Myles. 1997.
Mechanism of infertility in male guinea pigs immunized with sperm PH-20.
Biol. Reprod. 56:1133–1141.
180. Umetsu, D. T., and R. H. DeKruyff. 2006. The regulation of allergy and
asthma. Immunol. Rev. 212:238–255.
181. van Aarle, P. 2003. Suitability of an E2 subunit vaccine of classical swine
fever in combination with the E(rns)-marker-test for eradication through
vaccination. Dev. Biol. (Basel) 114:193–200.
182. van den Bosch, H., and J. Frey. 2003. Interference of outer membrane
protein PalA with protective immunity against Actinobacillus pleuropneumoniae infections in vaccinated pigs. Vaccine 21:3601–3607.
183. van Drunen Littel-van den Hurk, S., S. Babiuk, and L. A. Babiuk. 2006.
Needle-free delivery of veterinary DNA vaccines. Methods Mol. Med. 127:
91–105.
184. Van Immerseel, F., U. Methner, I. Rychlik, B. Nagy, P. Velge, G. Martin, N.
Foster, R. Ducatelle, and P. A. Barrow. 2005. Vaccination and early protection against non-host-specific Salmonella serotypes in poultry: exploitation of innate immunity and microbial activity. Epidemiol. Infect. 133:959–
978.
185. van Oirschot, J. T., M. J. Kaashoek, and F. A. Rijsewijk. 1996. Advances in
the development and evaluation of bovine herpesvirus 1 vaccines. Vet.
Microbiol. 53:43–54.
CLIN. MICROBIOL. REV.
186. Van Overbeke, I., K. Chiers, R. Ducatelle, and F. Haesebrouck. 2001. Effect
of endobronchial challenge with Actinobacillus pleuropneumoniae serotype
9 of pigs vaccinated with a vaccine containing Apx toxins and transferrinbinding proteins. J. Vet. Med. B Infect. Dis. Vet. Public Health 48:15–20.
187. Veits, J., D. Wiesner, W. Fuchs, B. Hoffmann, H. Granzow, E. Starick, E.
Mundt, H. Schirrmeier, T. Mebatsion, T. C. Mettenleiter, and A. RomerOberdorfer. 2006. Newcastle disease virus expressing H5 hemagglutinin
gene protects chickens against Newcastle disease and avian influenza. Proc.
Natl. Acad. Sci. USA 103:8197–8202.
188. Vemulapalli, R., J. R. McQuiston, G. G. Schurig, N. Sriranganathan, S. M.
Halling, and S. M. Boyle. 1999. Identification of an IS711 element interrupting the wboA gene of Brucella abortus vaccine strain RB51 and a PCR
assay to distinguish strain RB51 from other Brucella species and strains.
Clin. Diagn. Lab. Immunol. 6:760–764.
189. Vercruysse, J., D. P. Knox, T. P. Schetters, and P. Willadsen. 2004. Veterinary parasitic vaccines: pitfalls and future directions. Trends Parasitol.
20:488–492.
190. Vretou, E., E. Psarrou, M. Kaisar, I. Vlisidou, V. Salti-Montesanto, and D.
Longbottom. 2001. Identification of protective epitopes by sequencing of
the major outer membrane protein gene of a variant strain of Chlamydia
psittaci serotype 1 (Chlamydophila abortus). Infect. Immun. 69:607–612.
191. Walker, J. A., and J. F. Timoney. 2002. Construction of a stable non-mucoid
deletion mutant of the Streptococcus equi Pinnacle vaccine strain. Vet.
Microbiol. 89:311–321.
192. Wallach, M. 1997. The importance of transmission-blocking immunity in
the control of infections by apicomplexan parasites. Int. J. Parasitol. 27:
1159–1167.
193. Wallach, M., N. C. Smith, M. Petracca, C. M. Miller, J. Eckert, and R.
Braun. 1995. Eimeria maxima gametocyte antigens: potential use in a subunit maternal vaccine against coccidiosis in chickens. Vaccine 13:347–354.
194. Whetstone, C. A., J. M. Miller, B. S. Seal, L. J. Bello, and W. C. Lawrence.
1992. Latency and reactivation of a thymidine kinase-negative bovine herpesvirus 1 deletion mutant. Arch. Virol. 122:207–214.
195. Willadsen, P. 2004. Anti-tick vaccines. Parasitology 129:S367–S387.
196. Williams, R. B. 2002. Fifty years of anticoccidial vaccines for poultry (1952–
2002). Avian Dis. 46:775–802.
197. Yen, H. H., J. P. Scheerlinck, S. Gekas, and P. Sutton. 2006. A sheep
cannulation model for evaluation of nasal vaccine delivery. Methods 38:
117–123.
198. Zweygarth, E., A. I. Josemans, M. F. Van Strijp, L. Lopez-Rebollar, M. Van
Kleef, and B. A. Allsopp. 2005. An attenuated Ehrlichia ruminantium (Welgevonden stock) vaccine protects small ruminants against virulent heartwater challenge. Vaccine 23:1695–1702.
CLINICAL MICROBIOLOGY REVIEWS, July 2007, p. 511–532
0893-8512/07/$08.00⫹0 doi:10.1128/CMR.00004-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 20, No. 3
Laboratory Diagnostic Techniques for Entamoeba Species
R. Fotedar,1 D. Stark,1* N. Beebe,2 D. Marriott,1 J. Ellis,3 and J. Harkness1
St. Vincent’s Hospital, Department of Microbiology, Sydney, Australia1; University of Technology Sydney, Institute for the
Biotechnology of Infectious Diseases, Broadway, Australia2; and University of Technology Sydney, Department of
Medical and Molecular Biosciences, Broadway, Australia3
INTRODUCTION .......................................................................................................................................................511
Entamoeba histolytica...............................................................................................................................................512
Entamoeba dispar .....................................................................................................................................................512
Entamoeba moshkovskii ...........................................................................................................................................512
IMPORTANCE OF DIAGNOSIS .............................................................................................................................512
CLINICAL MANIFESTATIONS ..............................................................................................................................513
Asymptomatic Colonization...................................................................................................................................513
Dysentery/Amebic Colitis .......................................................................................................................................513
Extraintestinal Amebiasis......................................................................................................................................513
LABORATORY DIAGNOSIS....................................................................................................................................514
Microscopy ...............................................................................................................................................................514
Culture Methods .....................................................................................................................................................514
Isoenzyme Analysis .................................................................................................................................................516
Antibody Detection Tests .......................................................................................................................................516
Antigen Detection Tests .........................................................................................................................................517
Immunochromatographic Assays..........................................................................................................................519
DNA-BASED DIAGNOSTIC TESTS........................................................................................................................519
Complexity of Fecal Samples ................................................................................................................................519
Methods of DNA Extraction..................................................................................................................................519
Manual methods .................................................................................................................................................519
Automated methods ............................................................................................................................................520
Conventional PCR ..................................................................................................................................................520
Real-Time PCR .......................................................................................................................................................523
Microarray Development .......................................................................................................................................523
Typing Methods ......................................................................................................................................................524
CONCLUSION............................................................................................................................................................527
REFERENCES ............................................................................................................................................................527
imately 50 million people have invasive disease, resulting in
100,000 deaths per year (81, 210). Although the parasite has a
worldwide distribution, high prevalence rates of more than
10% of the population have been reported from various developing countries (173). Entamoeba histolytica-related diarrheal illnesses have recently been reported to have a negative
impact on the growth of children (114). Despite the availability
of effective therapy, morbidity and mortality associated with
amebic infection have persisted, suggesting that interventions
designed to limit or to eliminate disease are ineffective. As
humans appear to be the only host, an appropriate control
program could potentially eradicate amebiasis.
New approaches to the identification of E. histolytica are
based on detection of E. histolytica-specific antigen and DNA
in stool and other clinical samples. Several molecular diagnostic tests, including conventional and real-time PCR, have been
developed for the detection and differentiation of E. histolytica,
E. dispar, and E. moshkovskii in clinical samples. These molecular methods have led to a reevaluation of the epidemiology of
amebiasis in terms of prevalence and morbidity, particularly in
those geographical areas with high endemic rates.
The purpose of this review is to discuss the methods that
exist for the identification of E. histolytica, E. dispar, and E.
moshkovskii which are available to the clinical diagnostic lab-
INTRODUCTION
The genus Entamoeba contains many species, six of which
(Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii, Entamoeba polecki, Entamoeba coli and Entamoeba
hartmanni) reside in the human intestinal lumen. Entamoeba
histolytica is the only species definitely associated with pathological sequelae in humans; the others are considered nonpathogenic (31, 57). Although recent studies highlight the recovery of E. dispar and E. moshkovskii from patients with
gastrointestinal symptoms (52, 73, 130, 189, 201), there is still
no definitive evidence of a causal link between the presence of
these two species and the symptoms of the host.
Entamoeba histolytica is the causative agent of amebiasis and
is globally considered a leading parasitic cause of human mortality (77, 81, 210). Clinical features of amebiasis due to E.
histolytica range from asymptomatic colonization to amebic
dysentery and invasive extraintestinal amebiasis, which is manifested most commonly in the form of liver abscesses. Approx-
* Corresponding author. Mailing address: Department of Microbiology, St. Vincent’s Hospital, Sydney, Darlinghurst, NSW 2010,
Australia. Phone: 61 2 8382 9196. Fax: 61 2 8382 2989. E-mail: dstark
@stvincents.com.au.
511
512
FOTEDAR ET AL.
oratory. To address the need for a specific diagnostic test for
amebiasis, a substantial amount of work has been carried out
over the last decade in different parts of the world, and molecular diagnostic tests are increasingly being used for both
clinical and research purposes.
Entamoeba histolytica
Entamoeba histolytica was first described by Fedor Lösch in
1875 in St. Petersburg, Russia. He described intestinal amebiasis in detail, and the species name E. histolytica was first
coined by Fritz Schaudinn in 1903 (155). Entamoeba histolytica
is the pathogenic species of Entamoeba that causes amebic
dysentery and a wide range of other invasive diseases, including amebic liver abscess, respiratory tract infections, and cerebral and genitourinary amebiasis.
Entamoeba dispar
In 1925, Brumpt formulated the theory that the difference
between many asymptomatic amebic infections and those of
individuals with amebic disease could be correlated with the
existence of two distinct but morphologically identical species,
namely, E. histolytica (which is capable of causing invasive
disease) and E. dispar (which never causes disease). This hypothesis was dismissed at that time, but subsequently evidence
which gave support to Brumpt’s findings began accumulating.
In 1993, 68 years after the original discovery of E. dispar, E.
histolytica and E. dispar were formally accepted as different yet
closely related species on the basis of extensive genetic, immunological, and biochemical analyses (43, 177, 188).
Although E. dispar was previously considered to be nonpathogenic E. histolytica and was regarded as a commensal
species, intestinal symptoms in patients infected with this species have been reported (95). In a recent study from India by
Parija and Khairnar (130), 68 fecal specimens in which Entamoeba species were demonstrated on microscopy were tested
using PCR. Eleven patients positive for E. dispar and E. moshkovskii (in association) had mild gastrointestinal discomfort;
however, the study failed to clarify whether other parasites or
bacterial or viral pathogens were detected in these 11 samples.
Entamoeba dispar can produce variable focal intestinal lesions in animals (28, 48, 202) and can destroy epithelial cell
monolayers in vitro (49). There is also some evidence that
following infection with E. dispar, pathological changes may
occur in some humans (111). However Koch’s postulates have
not been fulfilled, and no large case-controlled studies have
been undertaken to assess the true pathogenic potential of this
organism.
Entamoeba moshkovskii
Entamoeba moshkovskii is another species of Entamoeba
and is morphologically indistinguishable from E. histolytica and
E. dispar. This species was first described from Moscow sewage
by Tshalaia in 1941 (193) and was thereafter reported to occur
in many different countries (30, 160). Entamoeba moshkovskii
was initially thought to be a free-living environmental strain.
However in 1961 an E. histolytica-like strain was isolated from
a resident of Laredo, TX, who presented with diarrhea, weight
CLIN. MICROBIOL. REV.
loss, and epigastric pain (46). This strain was named the E.
histolytica Laredo strain and shared many biological features
with E. moshkovskii. Both the Laredo strain and E. moshkovskii grow at room temperature, are osmotolerant, and are
resistant to emetine. These characteristics distinguished them
from E. histolytica and E. dispar (30, 34). Subsequent molecular
studies have confirmed that the E. histolytica Laredo strain is a
strain of E. moshkovskii (30). The exact taxonomic classification of the species has yet to emerge, as E. moshkovskii seems
to be a complex of at least two species (30). Although the early
isolations of this species have been from sewage, recent studies
have reported the recovery of E. moshkovskii from human
feces (8, 30, 52, 73, 130, 189).
Reports on detection of E. moshkovskii from human specimens to date have come from North America, Italy, South
Africa, Bangladesh, India, Iran, Australia, and Turkey (8, 30,
52, 73, 130, 171, 176, 189). Although previous reports on the
identification of E. moshkovskii in fecal samples have not
shown any association with clinical illness (30), recent studies
from Bangladesh and India have reported E. moshkovskii as a
sole potential enteropathogen in patients presenting with gastrointestinal symptoms and/or dysentery, highlighting the need
for further study to investigate the pathogenic potential of this
organism (73, 130).
IMPORTANCE OF DIAGNOSIS
The epidemiology of E. histolytica, E. dispar, and E. moshkovskii parasitoses remains uncertain, because most of the existing data were obtained using methods incapable of distinguishing among the three morphologically identical species.
Entamoeba dispar appears to be about 10 times more common
than E. histolytica, with most of the 500 million people infected
with E. histolytica/E. dispar carrying E. dispar (91). Little is
known about the epidemiology and incidence of E. moshkovskii infections, as only a few studies have used molecular
methods to identify this parasite.
Most morbidity and mortality due to amebiasis occur in
developing regions such as Central and South America, Africa,
and the Indian subcontinent (203). In Bangladesh, where diarrheal diseases are the leading cause of childhood death,
approximately 50% of children have serological evidence of
exposure to E. histolytica by 5 years of age (74).
In developed countries, high-risk groups include travelers,
immigrants from areas of endemicity, and men who have sex
with men (MSM) (122, 125–127, 185, 186). It is estimated that
20% to 30% of MSM are colonized with E. dispar in Western
countries, which is attributed to oral-anal sex practices (10). In
addition, a few reports describe cases of invasive amebiasis in
homosexual men from Taiwan and Korea (88, 124) and Australia (52, 175). Early detection of infection in these high-risk
individuals by using molecular diagnostic methods will improve
understanding of the public health issues and expedite the
initiation of control measures (125–127, 175, 176).
The existence of these morphologically indistinguishable
species of Entamoeba led the World Health Organization
(WHO) to recommend the development and application of
improved methods for the specific diagnosis of E. histolytica
infection (210). Epidemiological surveys of amebiasis should
include tools to diagnose E. histolytica and E. dispar individu-
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
ally, simultaneously, and accurately. Identification of E. histolytica remains an important goal of the clinical parasitology
laboratory, and molecular diagnostics represent an important
confirmatory diagnostic step in the management of patients
who may be infected with E. histolytica and require specific
therapy (210).
Techniques developed for the identification of E. histolytica
include the detection of E. histolytica-specific antibodies and
specific antigen in stool and other clinical samples. In addition,
several molecular diagnostic tests, including conventional,
nested, and real-time PCR, have been developed for diagnosis
of E. histolytica, E. dispar, and E. moshkovskii by clinical laboratories.
CLINICAL MANIFESTATIONS
Asymptomatic Colonization
Asymptomatic cyst passage, with 90% of human infections
either asymptomatic or mildly symptomatic, is considered to be
the most common manifestation of E. histolytica. However,
these studies have been based on the microscopic examination
of fecal samples (203, 210). Patients can clear their infection
without any signs of disease. In stool samples, cysts are usually
detected, and trophozoites, which are rarely seen, lack ingested
red blood cells (RBCs). Individuals harboring E. histolytica
(asymptomatic carriers) can develop antibody titers in the absence of invasive disease (60, 93, 145). Asymptomatic colonization with E. histolytica, if left untreated, can lead to amebic
dysentery and a wide range of other invasive diseases, but more
often the infection resolves spontaneously without the development of diseases (19, 20, 60, 75).
Dysentery/Amebic Colitis
When followed for 1 year, 4 to 10% of asymptomatic individuals colonized with E. histolytica developed colitis or extraintestinal disease (60, 75); therefore, it is recommended that
asymptomatic cyst carriers should be treated. Symptoms commonly attributed to E. histolytica colitis include abdominal pain
or tenderness with watery, bloody, or mucous diarrhea. Eighty
percent of patients complain of localized abdominal pain;
some patients may have only intermittent diarrhea alternating
with constipation. Microscopically, trophozoites are readily detected in submucosal tissue or fecal samples by permanent
stains. Since E. histolytica invades the colonic mucosa, feces are
almost universally positive for occult blood. The presence of
Charcot-Leyden crystals and blood is the most common finding
in the acute stage. In addition to the RBCs, macrophages and
polymorphonuclear cells (PMNs) can also be seen on microscopy in cases of amebic dysentery. Fever is unusual, occurring
in ⬍40% of patients (4). Occasionally individuals develop fulminant amebic colitis, with profuse bloody diarrhea, fever,
pronounced leukocytosis, and widespread abdominal pain, often with peritoneal signs and extensive involvement of the
colon (184). Toxic megacolon, ameboma (5), cutaneous amebiasis (112), and rectovaginal fistulae (108) can occur as complications of intestinal amebiasis.
513
Extraintestinal Amebiasis
The most common extraintestinal manifestation is amebic
liver abscess (ALA), which is associated with significant
morbidity and mortality. This was a progressive and almost
invariably fatal disease little more than a century ago, but
since the introduction of effective medical treatment and
rapid diagnosis, mortality rates have fallen to 1 to 3% (22,
166). ALA is caused by hematogenous spread of the invasive
trophozoites from the colon, which reach the liver via the
portal vein. This explains the frequent occurrence of abscesses in the right hepatic lobe, which receives most of the
blood draining the cecum and ascending colon (154). Some
individuals presenting with ALA have concurrent amebic
colitis, but more often they have no bowel symptoms, and
stool microscopy is usually negative for E. histolytica trophozoites and cysts (5, 152, 190). Individuals can present with
ALA months to years after travel or residency in an area of
endemicity, so a careful travel history is mandatory (14, 102,
166). The disease should be suspected in anyone with an
appropriate exposure history (residency or travel in an area
of endemicity) presenting with fever, right upper quadrant
pain, and substantial hepatic tenderness. Cough may be
present, and dullness and rales in the right lung base are not
infrequent (5, 14, 166, 190). Jaundice is unusual. Symptoms
are usually acute (⬍10 days in duration) but can be chronic,
with anorexia and weight loss as prominent features. Leukocytosis without eosinophilia, mild anemia, a raised concentration of alkaline phosphatase, and a high rate of erythrocyte sedimentation are the most common laboratory
findings (5, 14, 166, 190). The most serious complication of
ALA is rupture, particularly into the pericardium, and superinfection with bacteria. Rupture into the pleura is relatively common and usually has a good prognosis. With early
diagnosis and therapy, the mortality from uncomplicated
ALA is less than 1% (5). Complications of extraintestinal
amebiasis include pleuroplumonary amebiasis secondary to
ALA rupture through the diaphragm, brain abscess, and
genitourinary amebiasis. Diagnosis of brain abscess is usually made by the microscopic detection of parasites on brain
biopsy or at autopsy; however, a recent study has highlighted
the first diagnosis of E. histolytica encephalitis using PCR
(172).
Diagnosis of liver abscess is confirmed by a positive serological test, as amebic serology is highly sensitive (⬎94%) and
highly specific (⬎95%) for diagnosis. A false-negative serological test can be obtained early during infection (within the first
7 to 10 days), but a repeat test is usually positive. Abdominal
ultrasound or computed tomography scan does not provide
specificity for ALA. However, a positive serological test in
combination with abdominal imaging is helpful for diagnosis
where PCR is not routinely available. A recent study confirms
that in the majority of successfully treated ALA patients the
abscess completely resolves; however, in 7.1% of patients residual lesions are detected, with the unique sonographic appearance of round or oval hypo- or isoechoic areas surrounded
by the hyperchoic wall (21). The successful use of PCR methods in detection of E. histolytica DNA in patients with ALA has
shown high sensitivity (100%) (52, 182, 214, 215).
514
FOTEDAR ET AL.
CLIN. MICROBIOL. REV.
FIG. 1. Cysts and trophozoites of Entamoeba species.
LABORATORY DIAGNOSIS
Microscopy
Microscopic techniques employed in a diagnostic clinical
laboratory include wet preparation, concentration, and permanently stained smears for the identification of E. histolytica/E.
dispar/E. moshkovskii in feces. Microscopic examination of a
direct saline (wet) mount is a very insensitive method (⬍10%)
which is performed on a fresh specimen (90). The sample
should be examined within 1 h of collection to search for
motile trophozoites which may contain RBCs. However, in
patients who do not present with acute dysentery, trophozoites
will not contain RBCs. Patients with asymptomatic carriage
generally have only cysts in the fecal sample. Although the
concentration technique is helpful in demonstrating cysts, the
use of permanently stained smears (trichrome or iron hematoxylin) is an important method for recovery and identification
of Entamoeba species.
Microscopy is a less reliable method of identifying Entamoeba species than either culture or antigen detection tests
(80, 104). The sensitivity of microscopy can be poor (60%) and
confounded with false-positive results due to misidentification
of macrophages as trophozoites, PMNs as cysts (especially
when lobed nuclei of PMNs break apart), and other Entamoeba species (67, 72, 76, 80, 188) (Fig. 1; Table 1).
As Entamoeba trophozoites generally degenerate rapidly in
unfixed fecal specimens (137) and refrigeration is not recommended, specimens should be preserved with a fixative which
prevents the degradation of the morphology of the parasite
and allows concentration and permanent smears to be performed. Fixatives used for the concentration procedure include
Schaudinn’s fluid, merthiolate iodine-formalin, sodium acetate-acetic acid-formalin (SAF), or 5% or 10% formalin. The
fixatives for the permanently stained smears include trichrome,
iron hematoxylin, Ziehl-Neelsen stains, modified polyvinyl alcohol (PVA) (containing mercury compounds), and SAF.
Examination for ova and parasites in a minimum of three
stool samples over no more than 10 days is recommended, as
these organisms may be excreted intermittently or may be
unevenly distributed in the stool. This improves the detection
rate to 85 to 95% (107). The presence of RBCs in the cytoplasm is still considered diagnostic for E. histolytica in patients
with dysentery and may be used to distinguish between E.
histolytica and E. dispar. However, trophozoites containing ingested RBCs are not present in the majority of patients (67,
178). The specificity of this finding was further reduced when it
was demonstrated that in some patients E. dispar also contains
RBCs (80). In vitro studies have also confirmed the ability of E.
dispar to ingest RBCs (191). In one study, the specificity of E.
histolytica/E. dispar as determined by microscopy (formalinether concentrates and permanent stains) was only 9.5% in
community laboratories compared with the Entamoeba test
and ProSpecT enzyme immunoassay (EIA) antigen detection
tests (134).
Culture Methods
Culture techniques for the isolation of Entamoeba species
have been available for over 80 years. Culture media include
xenic (diphasic and monophasic) and axenic systems. Xenic
cultivation is defined as the growth of the parasite in the
presence of an undefined flora (35). The xenic culture of E.
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
515
TABLE 1. Characteristics of trophozoites and cysts of common intestinal Entamoeba speciesa
Characteristics
Size, nuclei, and motility
Trophozoites
Cysts
Other features
Trophozoites
Chromatin (stained)
E. hartmanni
E. coli
E. polecki
15–20 ␮m, 1 nucleus (difficult
to see in unstained
preparations), actively
motile with finger shaped
pseudopodia
10–15 ␮m, mature cyst with 4
nuclei, immature cyst has 1
or 2 nuclei (nuclear
characters difficult to see
on wet prepn)
8–10 ␮m, 1 nucleus (usually
not seen in unstained
prepn), usually
unprogressive
20–25 ␮m, 1 nucleus (often
visible in unstained prepn);
sluggish, short, and blunt
pseudopodia
15–20 ␮m, 1 nucleus
(occasionally seen on wet
prepn), sluggish
6–8 ␮m, mature cyst with 4
nuclei, immature cyst has 1
or 2 nuclei, two nucleated
cysts very common
15–25 ␮m, mature cyst has 8
nuclei, occasionally 16 or
more nuclei
10–15 ␮m, mature cyst with
1 nucleus, rarely 2 or 4
nuclei
Chromatin peripheral, may
have beaded appearance
Nucleus may stain more darkly
than E. histolytica, chromatin
may appear as solid ring
rather than beaded
(trichrome)
Karyosome usually small and
compact; centrally located or
eccentric
Chromatin clumped and
unevenly arranged, appears
as solid ring with no beads
Chromatin finely granular,
chromatin may also be
clumped at one or both
edges of membrane
Karyosome large, not compact,
may or may not be eccentric,
may be diffuse or darkly
stained
Cytoplasm granular with
differentiation into
cytoplasm and endoplasm,
vacuolated; bacteria, yeast,
and other debris may be
present
Karyosome small and
usually centrally located
Karyosome
(stained)
Karyosome small, compact,
centrally located but may
be eccentric
Cytoplasm (stained)
Cytoplasm is fine, granular,
may contain bacteria;
presence of RBCs
diagnostic for E. histolytica,
although some E. dispar
strains may very
occasionally contain RBCs
Cytoplasm finely granular, may
contain bacteria, no RBCs
Chromatin peripheral with
fine uniform granules,
evenly distributed
Chromatin granules evenly
distributed (nuclear
characteristics may be
difficult to see)
Karyosome is small, compact,
usually centrally located
Chromatin coarsely granular,
may be clumped and
unevenly arranged
Chromatin finely granular
Karyosome large, eccentric,
occasionally centrally located
Karyosome small and
usually centrally located
Usually present; chromatoidal
bodies usually elongate with
blunt, rounded, smooth
edges; may be round or
oval; chromatin may or may
not be present
May be present (less frequent
than in E. histolytica),
splinter shaped with rough
pointed ends, may be diffuse
or absent in mature cysts,
clumped mass occasionally
seen in mature cysts
Abundant chromatoidal
bodies with angular
pointed ends, thread-like
chromatoidal bodies may
also be present, half of
the cysts contain spherical
or ovoidal inclusion mass
Cysts
Chromatin (stained)
Karyosome
(stained)
Cytoplasm (stained)
a
E. histolytica/E. dispar/
E. moshkovskii
Karyosome is small, compact,
usually centrally located
but occasionally eccentric
May be present;
chromatoidal bodies
usually elongate with blunt,
rounded, smooth edges;
may be round or oval;
chromatin may be diffuse
or absent in mature cyst;
clumped chromatin mass
may be present in early
cysts
Cytoplasm is finely granular,
may contain ingested
bacteria
Data are from references 57, 73, and 188.
histolytica was first introduced by Boeck and Drbohlav in 1925
in a diphasic egg slant medium, and a modification of this
medium (Locke-egg) is still used today (35). Different
monophasic media that were developed for E. histolytica are
the egg yolk infusion medium of Balamuth (12), Jones’s medium (96), and TYSGM-9 (41). Of the different media developed for the xenic cultivation of E. histolytica, only three media, diphasic Locke-egg, Robinson’s medium (150), and the
monophasic TYSGM-9 (41), are in common use (for details,
see reference 35).
Axenic cultivation involves the cultivation of parasites in the
absence of any other metabolizing cells (35). The axenic cultivation of E. histolytica was first achieved by Diamond in 1961
(39). The monophasic medium TP-S-1 was developed and used
widely for culture of E. histolytica in different research laboratories (35, 40). Currently TYI-S-33 (45) and YI-S (44) are the
most widely used media for axenic cultivation of E. histolytica
(35).
Culture of E. histolytica can be performed from fecal specimens, rectal biopsy specimens, or liver abscess aspirates. As
the liver abscess aspirates of ALA patients are usually sterile
(98% cases) (19), addition of a bacterium or a trypanosomatid
is necessary before inoculation of amebae into xenic culture
(35, 53, 204).
The success rate for culture of E. histolytica is between 50
and 70% in reference laboratories (35). As culture of E. histolytica from clinical samples such as feces or liver abscesses
has a significant false-negative rate and is technically difficult,
it is not undertaken in a routine clinical laboratory.
Entamoeba dispar can be grown in xenic culture; however,
most isolates grow poorly in monoxenic culture, and the
growth of only a few strains has been reported to be viable in
516
FOTEDAR ET AL.
axenic culture, suggesting that E. dispar may be less able than
E. histolytica to obtain nutrients in a particle-free medium (29,
103). The use of different media for the culture of E. dispar has
been investigated, and these studies indicate that YI-S may not
be a suitable medium for the culture of E. dispar (35, 103).
For E. moshkovskii strains, culture media employed include
TTY-SB-monophasic with the trypanosomatid, TP-S-1-GM
monophasic for the axenic culture of amebae (40), and the
TP-S-1-GM monophasic medium (42). Other media containing bovine serum used for culture of E. moshkovskii include
axenic medium TYI-S-33 with 10% bovine serum at 24°C (45)
or xenic medium TYSGM-9 with 5% bovine serum at either
24°C or 37°C (41).
Culture of E. histolytica in a clinical diagnostic laboratory is
not feasible as a routine procedure and is less sensitive than
microscopy as a detection method (35). Parasite cultures are
difficult, expensive, and labor-intensive to maintain in the diagnostic laboratory (35). Overgrowth of bacteria, fungi, or
other protozoans during culture is the main problem encountered, and therefore culture is not recommended as a routine
diagnostic procedure for the detection of Entamoeba species
(35).
Isoenzyme Analysis
The pioneering work of Sargeaunt et al. (158) demonstrated
that isoenzyme analysis of cultured amebae would enable the
differentiation of Entamoeba species. A zymodeme is defined
as a group of ameba strains that share the same electrophoretic
pattern and mobilities for several enzymes. Zymodemes consist of electrophoretic patterns of malic enzyme, hexokinase,
glucose phosphate isomerase, and phosphoglucomutase isoenzyme (159). A total of 24 different zymodemes have been
described, of which 21 are from human isolates (9 of E. histolytica and 12 of E. dispar). The presence of starch in the medium influences the most variable zymodeme patterns (16),
and many zymodemes “disappear” upon removal of bacterial
floras, suggesting that at least some of the bands are of bacterial rather than amebal origin (94). If the zymodemes defined
by stable bands alone are counted, only three remain for E.
histolytica (II, XIV, and XIX) and one for E. dispar (I). Isoenzyme (zymodeme) analysis of cultured amebae enables differentiation of E. histolytica from E. dispar and was considered the
gold standard for diagnosing amebic infection prior to development of newer DNA-based techniques.
Zymodeme analysis has a number of disadvantages, including the difficulty of performing the test. It is a time-consuming
procedure and relies on establishing the amebae in culture,
with a large number of cells needed for the enzyme analysis.
This process is not always successful. The cultivation of amebae may lead to selection bias, and one species or strain may
outgrow the other, which is not desirable when studying zymodemes. Furthermore, the amebic cultures and therefore isoenzyme analyses are negative for many microscopy-positive stool
samples (67, 76, 80, 178). Zymodeme analysis is not easily
incorporated into routine clinical laboratory work because of
the expertise required to culture the parasites, the complexity
of the diagnostic process, and the cost. Isoenzyme analysis has
been superseded by DNA-based methods as the method of
choice for studying Entamoeba species.
CLIN. MICROBIOL. REV.
Antibody Detection Tests
Serological tests for the identification of E. histolytica infection may be helpful from a diagnostic perspective in industrialized nations, where infections due to E. histolytica are not
common (127, 207). However, in areas where infection is endemic and people have been exposed to E. histolytica, the
inability of serological tests to distinguish past from current
infection makes a definitive diagnosis difficult (26, 60).
Detection of antibodies can be helpful in the case of ALA
where patients do not have detectable parasites in feces. The
sensitivity for detection of antibodies to E. histolytica in serum
in patients with ALA is reported to be about 100% (215). In
contrast, a study from a area of high endemicity, Hue in Vietnam, revealed that 82.6% (38/46) of individuals who were
infected with E. histolytica even when asymptomatic had significant antiameba antibody titers. These results were confirmed by real-time PCR studies (18, 19).
Many different assays have been developed for the detection of
antibodies, including indirect hemagglutination (IHA), latex
agglutination, immunoelectrophoresis, counterimmunoelectrophoresis (CIE), the amebic gel diffusion test, immunodiffusion,
complement fixation, indirect immunofluorescence assay (IFA),
and enzyme-linked immunosorbent assay (ELISA). A variety of
antibody assays for detection of E. histolytica antibodies in human
serum are also commercially available (Table 2).
Complement fixation tests appear to be less sensitive than
others, cost more to perform, and are not used by most laboratories. IHA is simple to perform and has been shown to be a
highly specific (99.1%) diagnostic tool in human immunodeficiency virus-infected patients presenting with gastrointestinal
symptoms (88). However, the lower sensitivity may lead to
false-negative results compared to ELISA (156). The latex
agglutination test appears to detect the same antibody as IHA.
Commercial kits are available, and the test can be performed
in 10 min. However, due to nonspecific reactions, the specificity of this test appears to be disappointing (156).
Immunoelectrophoresis, CIE, and immunodiffusion use the
property of antibody and antigen precipitation in agar gel membrane. Sheehan et al. (168) reported that detection of antibody to
extraintestinal E. histolytica by CIE is time-consuming but has a
high sensitivity (100%) in patients with invasive amebiasis.
Detection of antibodies using the IFA test was shown to be
rapid, reliable, and reproducible and helps to differentiate
ALA from other nonamebic etiologies (56). In addition to this,
IFA tests have been shown to differentiate between past
(treated) and present disease (56). A study conducted by Jackson et al. (92) indicated that monitoring of immunoglobulin M
(IgM) levels using the IFA can be of clinical value in cases of
invasive amebiasis. The IgM levels become negative in a short
period of time after infection, with more than half of the
subjects having negative results at 6 months or 100% becoming
negative by 46 weeks after treatment. In ALA the sensitivity of
the IFA is reported to be 93.6%, with a specificity of 96.7%,
making it more sensitive than the ELISA (165). A negative test
therefore indicates that a patient never had invasive amebiasis.
However, this test requires skills in culture and subsequent
antigen preparation, making it difficult to undertake in a routine clinical laboratory (131).
ELISA is the most popular assay in diagnostic laboratories
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
517
TABLE 2. Commercially available antibody assays for diagnosis of amebiasis
Sensitivity, %
(reference)
Antibody assay
Specificity, %
(reference)
Manufacturer
Cellognost-Amoebiasis (IHA)
100a (134), 99 (84)
90.9–100a (134), 99.8 (84)
Novagnost Entamoeba IgG
⬎95b
⬎95b
Bichro-Latex Amibe
93.3 (194), 98.3 (149)
95.5 (194), 96.1 (149)
I.H.A. Amoebiasis
93.4 (149)
97.5 (149)
Amoeba-Spot IF
Amebiasis Serology microplate
ELISA
Amebiasis Serology microwell EIA
(HK-9 antigen, axenic)
RIDASCREEN Entamoeba (IgG
detection)
NAc (61)
95b
NA (61)
97b
Dade Behring Marburg GmbH,
Marburg, Germany
NovaTec Immundiagnostica GmbH,
Dietzenbach, Germany
Fumouze Diagnostics, Levallois-Perret
Cedex, France
Fumouze Diagnostics, Levallois-Perret
Cedex, France
bioMérieux, Marcy-l’Etoile, France
Light Diagnostics
97.9 (84), 92.5 (169)
94.8 (84), 91.3 (169)
LMD Laboratories, Inc., Carlsbad, CA
b
100 , 97.7–100 (100)
b
95.6 , 97.4 (100)
R-Biopharma AG, Darmstadt,
Germany
For the titer of ⱖ1:64, 100% sensitive and 90. 9% specific; for the titer of ⱖ1:512, 100% sensitive and 100% specific.
As recommended by the manufacturer.
c
NA, not available.
a
b
throughout the world and has been used to study the epidemiology of asymptomatic disease (66) and the diagnosis of
symptomatic amebiasis after fecal examination. This method is
widely thought to be sufficient for clinical purposes, particularly for diagnosis of patients with ALA, and can be easily
performed in a clinical laboratory. It may also be useful in the
evaluation of intestinal and extraintestinal infections where
amebiasis is suspected but organisms cannot be detected in
feces (152). A microtiter ELISA to detect antibodies to E.
histolytica (LMD Laboratories, Inc., Carlsbad, CA) has been
shown to be 97.9% sensitive and 94.8% specific for detection of
E. histolytica antibodies in ALA patients (84).
Serum IgG antibodies persist for years after E. histolytica
infection, whereas the presence of IgM antibodies is shortlived and can be detected during the present or current infection. An ELISA for detection of serum IgM antibodies to
amebic adherence lectin was successfully used with patients
suffering from acute colitis for less than 1 week, as 45% had
detectable antilectin IgM antibodies (1). In another study, it
was shown that an assay based on the detection of anti-LC3
(recombinant cysteine-rich portion of the E. histolytica galactose-inhibitable lectin’s 170-kDa subunit) antibodies in saliva is
a more sensitive and specific test for diagnosis of ALA and
acute amebic colitis than detection of serum anti-LC3 IgG
antibodies (2). Of the recommended serological tests such as
ELISA, those that demonstrate the presence of serum antilectin antibodies are the most frequently used for diagnosis of
patients with ALA (145).
A high ELISA antibody titer is helpful in the diagnosis of
amebiasis in patients with detectable parasites in stool, as it has
a sensitivity of 95%. Since there is no cross-reaction with other,
non-E. histolytica parasites, it is a useful test for the diagnostic
clinical laboratory (23, 64, 68, 144, 165, 188).
Antigen Detection Tests
Several investigators have developed ELISAs for the detection of antigens in fecal samples. These antigen detection tests
have a sensitivity approaching that of stool culture and are
rapid to perform. Antigen-based ELISA kits that are specific
for E. histolytica use monoclonal antibodies against the Gal/
GalNAc-specific lectin of E. histolytica (E. histolytica II;
TechLab, Blacksburg, VA) or monoclonal antibodies against
serine-rich antigen of E. histolytica (Optimum S kit; Merlin
Diagnostika, Bornheim-Hersel, Germany). Other ELISA kits
for antigen detection include the Entamoeba CELISA PATH
kit (Cellabs, Brookvale, Australia), which uses a monoclonal
antibody specific for lectin of E. histolytica, and the ProSpecT
EIA (Remel Inc.; previously manufactured by Alexon-Trend,
Inc., Sunnyvale, CA), which detects E. histolytica-specific antigen in fecal specimens (Table 3). In addition to the abovementioned clinical assays, research-based detection tests have
included the use of monoclonal antibodies against a lectin-rich
surface antigen (132), a lipophospholglycan (113), a 170-kDaadherence lectin amebic antigen detected in saliva (2), and an
uncharacterized antigen (209).
The E. histolytica TechLab kit was designed in 1993 to detect
specifically E. histolytica in feces (72, 76). This antigen detection test captures and detects the parasite’s Gal/GalNAc lectin
in stool samples. The lectin is conserved and highly immunogenic, and because of the antigenic differences in the lectins of
E. histolytica and E. dispar, the test enables specific identification of the disease-causing E. histolytica. The level of detection
of amebic antigens is quite high, requiring approximately 1,000
trophozoites per well (78, 113). However, this test suffers from
the disadvantage that the antigens detected are denatured by
fixation of the stool sample, therefore limiting testing to fresh
or frozen samples. Nevertheless, this test has demonstrated
good sensitivity and specificity for detection of E. histolytica
antigen in stool specimens of people suffering from amebic
colitis and asymptomatic intestinal infection (72, 76, 80).
The TechLab ELISA for detection of E. histolytica antigen
in stool specimens from people suffering from diarrhea was
shown to have an excellent correlation with nested PCR (72),
and in other studies this test was found to be more sensitive (80
to 94%) and specific (94 to 100%) than microscopy and culture
(76, 80). In contrast, Gonin and Trudel (65) found that
TechLab ELISA was less sensitive than microscopy (concen-
518
FOTEDAR ET AL.
CLIN. MICROBIOL. REV.
TABLE 3. Commercially available antigen assays for the diagnosis of amebiasis
Sensitivity, %
(reference)
Specificity, %
(reference)
96.9–100,b 14.2 (61),c
87.5 (76),d 86
(76),e 71 (201), 95
(80),f 79 (153)g
95–100b
94.7–100,b 98.3 (61),c
100 (76),d 98 (76),e
100 (201), 93.0
(80),f 96 (153)g
93–100b
Optimum S Entamoeba
histolytica antigen ELISAa
100 (134)
NPh
Triage parasite paneli
96.0 (58),j 68.3
(133),k 100 (167)l
87,m 54.5 (61),c 78
(128)n
99.1 (58),j 100
(133),k 100 (167)l
99,m 94 (61),c 99
(128)n
Test
TechLab E. histolytica IIa
Entamoeba CELISA-PATHa
ProSpecT Entamoeba histolytica
microplate assayi
Manufacturer
Detection limit
TechLab, Blacksburg, VA
0.2–0.4 ng of adhesion
per well
Cellabs Pty Ltd.,
Brookvale, Australia
Merlin Diagnostika,
Berheim-Hersel,
Germany
BIOSITE Diagnostics, San
Diego, CA
REMEL Inc., Lenexa, KSo
0.2–0.4 ng of adhesion
per well
Not given
Not given
40 ng/ml of E. histolyticaspecific antigen
a
Specific for E. histolytica.
Sensitivity and specificity compared to culture/zymodeme, as cited by the manufacturer.
Sensitivity and specificity compared to culture and microscopy.
d
Compared to isoenzyme analysis.
e
Compared to culture.
f
Compared to culture and microscopy.
g
Compared to real-time PCR.
h
NP, not published.
i
Cannot distinguish between E. histolytica and E. dispar.
j
Compared to permanent staining with trichrome and modified acid-fast stains.
k
Compared to ProSpecT Entamoeba histolytica microplate assay.
l
Compared to ovum and parasite examination.
m
As mentioned by the manufacturer, related to ovum and parasite identifications.
n
Compared to microscopy (wet mounts and concentration).
o
Previously manufactured by Alexon-Trend, Inc., Sunnyvale, CA.
b
c
tration and permanent staining) and PCR in differentiating E.
histolytica from E. dispar from fecal samples. In another comparative study on the use of ELISA and PCR for the detection
of E. histolytica and E. dispar, PCR was found to be 100 times
more sensitive than ELISA for the differentiation of the two
species (113). This kit has been discontinued by the manufacturer and has been replaced by a second-generation TechLab
E. histolytica II kit, which has been found to be sensitive (86%
to 95%) and specific (93% to 100%) compared with microscopy (wet mount with 0.9% saline and Lugol’s iodine) and
culture for identification of E. histolytica as a screening method
in areas of Bangladesh with high endemicity (76, 80). The
TechLab II ELISA compared to real-time PCR as a reference
test also demonstrated good levels of sensitivity and specificity
for the diagnosis of E. histolytica (71 to 79% and 96 to 100%,
respectively) (153, 201). However, another study demonstrated
much lower sensitivity (14.3%) and specificity (98.4%) for E.
histolytica compared to culture and zymodeme identification
(61). In addition to this, cross-reactivity of samples is an issue
with this assay, since samples positive by PCR for E. dispar may
give false-positive results (55, 201). No specific antigen tests
are available for the detection of E. dispar and E. moshkovskii
from clinical samples.
The TechLab E. histolytica II kit can also be used for the
detection of E. histolytica lectin antigen in the serum and liver
abscess pus of patients with liver disease (79). In Bangladesh,
96% (22/23) and 100% (3/3) of patients with ALA had detectable levels of lectin antigen in their serum and liver abscess pus
samples, respectively, before treatment with metronidazole.
However, the sensitivities of this method were only 33% (32/
98) and 41% (11/27) for serum and liver abscess pus, respectively, after a few days of treatment with metronidazole (79),
which is probably associated with a decrease in the amount of
antigen in the serum or pus following therapy.
Results of antigen detection using both the TechLab kits
suggest that more specific and sensitive diagnostic tests, such as
PCR, are needed to establish the actual worldwide distribution
of E. histolytica and E. dispar (61, 65). Detection of specific
antigens of E. histolytica and E. dispar in feces by ELISA could
be useful for clinical and epidemiological studies where molecular assays cannot be used (76, 78). Importantly, of the four
diagnostic methods, i.e., antigen detection, antibody detection,
microscopy, and isoenzyme analysis, only antigen detection
using ELISA is both rapid and technically simple to perform
and can be used in laboratories that do not have molecular
facilities, thus making it appropriate for use in the developing
world, where amebiasis is most prevalent. In all cases, the
combination of serological tests with detection of the parasite
(by antigen detection or PCR) offers the best approach to
diagnosis. However, as reported by Mirelman et al. (113),
improvements in automation and simplification of PCR procedures for clinical sampling directly from feces suggest that a
comparison with ELISA needs to be performed.
The ProSpecT EIA (Remel Inc.) is a microplate EIA which
detects both E. histolytica and E. dispar. However, this assay
cannot differentiate between E. histolytica and E. dispar. The
advantage of this test is that it can be performed on fresh,
frozen, or Cary-Blair specimens but not on formalin-fixed fecal
samples. The sensitivity of the ProSpecT EIA was compared
with that of conventional microscopy (using wet mounts and
concentration methods) for the diagnosis of E. histolytica/E.
dispar, and a sensitivity of 78% and specificity of 99% were
reported (128). In another study, by Gatti et al. (61), the
reported sensitivity and specificity of ProSpecT ELISA were
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
54.5% and 94%, respectively, compared to culture and zymodeme identification for E. histolytica/E. dispar.
Immunochromatographic Assays
The Triage parasite panel (TPP) (Biosite Diagnostic Inc.,
San Diego, CA) is the first immunochromatographic assay for
the simultaneous detection of antigens specific for Giardia
lamblia, E. histolytica/E. dispar, and Cryptosporidium parvum.
The immunochromatographic strip used in this assay is coated
with monoclonal antibodies specific for the 29-kDa surface
antigen (E. histolytica/E. dispar), alpha-1-giardin (G. lamblia),
and protein disulfide isomerase (C. parvum). By using specific
antibodies, antigens specific for these organisms from the stool
samples are captured and immobilized on a membrane. A high
sensitivity (96% to 100%) and specificity (99.1% to 100%) of
the TPP kit compared to microscopy (stool ovum and parasite
examination) for E. histolytica/E. dispar were reported (58,
167). In another study, although the specificity of the Triage kit
was high (100%), the sensitivity was low (68.3%) compared to
that of the ProSpecT test (133). A recent study from Sweden
has compared the TPP test with PCR and demonstrated a low
sensitivity for TPP assay (106).
The advantage of the TPP method is that it can be performed in approximately 15 min with fresh or frozen, unfixed
human fecal specimens. The TPP provides diagnostic laboratories with a simple, convenient alternative method for performing simultaneous, discrete detection of Giardia-, Cryptosporidium-, and E. histolytica/E. dispar-specific antigens in
patient fecal specimens. However, the inability of this test to
differentiate between E. histolytica, E. dispar, and E. moshkovskii makes it not a method of choice for the diagnostic
laboratory. Only fresh or fresh-frozen unpreserved stool samples can be tested by the Triage assay, and to maintain the
integrity of the specimens, they need to be frozen or transported to the laboratory for testing as soon as possible after
collection.
519
methods for the isolation of parasitic DNA from feces have
been developed, which enhance detection and increase the
sensitivity of the PCR assay when used directly from clinical
samples. Recent approaches that attempt to eliminate fecal
inhibitors which copurify with the DNA consist of purification
methods prior to DNA extraction and/or direct removal of
inhibitors during DNA extraction (83, 206). However, many of
these methods include multiple steps that are time-consuming
and expensive, and so only a limited number of samples can be
processed at a time.
The QIAamp DNA stool kit (QIAGEN, Hilden, Germany)
has proved to be a successful and reliable method for the
recovery of DNA from fecal material (196). Improvement in
reproducibility and sensitivity has been obtained by modifying
the extraction kit method by optimizing the duration and temperature of proteinase K digestion and by adding an additional
wash step prior to DNA elution (153).
Transportation of fecal samples containing parasites at ambient temperatures may result in the rapid degeneration of
parasite DNA, especially for highly labile stages such as trophozoites. Consequently, the sensitivity of DNA assays using
unpreserved fecal specimens is time dependent (105). Specimens may be preserved by refrigeration or in PVA fixative,
SAF, or formalin. PVA and SAF preserve trophozoites and
cysts, and formalin preserves cysts for examination in wet
mounts. However, methods of fixation of feces with fixatives or
preservatives may result in a decreased sensitivity of PCR with
time (143, 192). A few groups have, however, shown good
results using formalin-fixed samples for PCR (147, 157). Ethanol is a simple transport medium that preserves amebic DNA.
The most widely used reagent for the preservation of fecal
samples is 10% buffered formalin solution (120); however, this
solution is reported to hamper product amplification by PCR
because of the interfering nature of the fixative, which perfuses
the organisms and reacts with DNA (143). Consequently,
freezing a fresh fecal specimen at ⫺20°C before extraction of
DNA is a better strategy, as it does not affect the sensitivity of
the molecular assays (52, 105, 123).
DNA-BASED DIAGNOSTIC TESTS
DNA-based assays are limited to research laboratories and
clinical laboratories in developed countries. In most tropical
and subtropical countries where amebiasis is responsible for
significant morbidity and mortality, the diagnosis is still made
by microscopic examination due to the lack of facilities to
conduct DNA-based tests.
Complexity of Fecal Samples
Over the last decade, many DNA-based methods for the
detection of viral, bacterial, and parasite DNA have been published. Fecal samples are considered to be among the most
complex specimens for direct PCR testing because of the presence of PCR inhibitors, such as heme, bilirubins, bile salts, and
complex carbohydrates, which are often coextracted along with
pathogen DNA (85). Therefore, optimization of the fecal
DNA extraction procedure is critical to the success of PCR
studies.
In the past, the isolation of DNA directly from fecal samples
was problematic and laborious. Recently, simple and effective
Methods of DNA Extraction
Manual methods. Earlier methods of DNA extraction relied
on the culture of microscopy-positive fecal samples in Robinson’s medium followed by subsequent extraction of DNA from
cultured trophozoites by the phenol-chloroform method (135,
181, 183). Later methods included direct extraction of DNA
from microscopy-positive fecal samples (151), and with modification this proved to be a successful strategy for formalinether-concentrated samples (3, 116, 147, 148, 179) and for
unpreserved stool samples and stool samples stored at 4°C or
⫺20°C (123, 141).
QIAamp tissue kit spin columns (QIAGEN, Hilden, Germany) have been used for the purification of DNA from microscopy-positive samples stored at ⫺20°C in phosphate-buffered saline (196, 199) and for DNA isolation using other
modifications (such as treatment with 2% polyvinylpolypyrrolidone [Sigma]) which improve the sensitivity of the PCR
(197). The use of the QIAamp stool kit for the extraction of
DNA from fecal samples was a major advance, and this has
proven to be the most widely accepted method for DNA ex-
520
FOTEDAR ET AL.
traction. Formalin-fixed fecal samples have also been used for
DNA extraction without a reduction in the ability to perform
amplification of E. histolytica and E. dispar (143). Other kits
used for the direct extraction of DNA from fecal samples
include the XTRAX DNA extraction kit (Gull Laboratories,
Salt Lake City, UT) (50), the Extract MasterFaecal DNA extraction kit (Epicenter Biotechnologies, WI), and the Genomic
DNA Prep Plus kit (A&A Biotechnology, Gdansk, Poland)
(118). Of the methods for DNA extraction from feces, those
based on the QIAamp stool kit (QIAGEN) have predominated (50, 51, 54, 65, 82, 129, 196, 199) and are now used
widely in clinical research laboratories in developed nations, as
they minimize the extraction time and the DNA can be extracted directly from the feces without the need to culture the
parasites.
Automated methods. A number of automated methods are
available for the extraction of DNA from fecal samples. The
MagNA Pure LC workstation is an automated “walkaway”
system for nucleic acid extraction. With a MagNA Pure LC
DNA isolation kit, genomic DNA from organisms lysed in
buffer containing guanidine isothiocyanate is bound to magnetic glass particles under chaotropic conditions. The magnetic
particles are washed to remove unbound substances and impurities. The washed DNA is eluted from the magnetic particles under conditions of low salt concentration and elevated
temperature. MagNA Pure LC total nucleic acid isolation kit
(Roche Applied Sciences) extraction technology has successfully been used for DNA extraction from microsporidia in fecal
specimens (208) and for extraction of bacterial and viral DNA
from clinical samples (87, 101). However, a reduction in PCR
sensitivity was reported using DNA extracted from wholeblood samples for detection of viral pathogens (161). This
reduction of the PCR activity was related to problems with
retrieval of DNA from the magnetic glass particles, where up
to 60% of the DNA could not be retrieved by use of the
MagNA Pure extraction system (161). Other available automated methods include the QIAGEN automated BioRobot
M48 (QIAGEN) and Nuclisens easyMAG (bioMerieux,
Marcy, l⬘Etoile, France), but so far there have been no published protocols using these automated systems for the successful recovery of Entamoeba DNA from feces.
Conventional PCR
PCR-based approaches are the method of choice for clinical
and epidemiological studies in the developed countries (27, 71,
81, 212) and have been strongly endorsed by the WHO. Entamoeba histolytica can be identified in a variety of clinical specimens, including feces, tissues, and liver abscess aspirate (188).
PCR of the small-subunit rRNA gene (18S rDNA) is reported
to be approximately 100 times more sensitive than the best
ELISA kit currently available (113, 192).
Edman et al. (47) used PCR to amplify the gene which
encodes the 125-kDa surface antigen, and this was subsequently adapted to distinguish among Entamoeba species by
restriction digestion (187). The initial studies by Edman et al.
(47) and Tannich and Burchard (187) were performed with
DNA extracted from laboratory-maintained control isolates of
Entamoeba species. PCR was subsequently used in an epidemiological study of E. histolytica/E. dispar infection, using
CLIN. MICROBIOL. REV.
DNA extracted from cultured trophozoites from feces, and the
PCR was performed using primers specific for highly repetitive
sequences present in pathogenic and nonpathogenic E. histolytica (now identified as E. dispar) strains defined previously
through their respective isoenzyme patterns (59, 151).
There is now a wide variety of PCR methods, targeting
different genes, which have been described for detection and
differentiation of the three Entamoeba species (Table 4). The
consistent genetic diversity detected between the 18S rDNAs
of E. histolytica and E. dispar initiated the use of 18S rDNA as
a target for differentiation of the two species (31, 32, 36, 138).
DNA extracted from laboratory-cultured trophozoites and
DNA recovered directly from microscopy-positive fecal samples using the manual and automated methods were tested,
and the PCR methods proved to be highly sensitive and specific
for detecting Entamoeba DNA (33, 34, 82, 116, 117, 141, 142, 192,
196, 199). PCR assays targeting 18S rDNA are widely used for the
detection and differentiation of Entamoeba species, as these targets are present on multicopy, extrachromosomal plasmids in the
amebae (15), making the 18S rDNA more easily detected than a
DNA fragment of a single-copy gene.
The successful use of PCR in studying the epidemiology of
Entamoeba infection was first reported by Acuña-Soto et al.
(3). Those authors used DNA extracted directly from feces,
avoiding the need to culture trophozoites, and the primers
were targeted to amplify the extrachromosomal circular DNA.
This gene target was subsequently used by other researchers
(6, 24). This PCR target, with colorimetric detection of the
product, was also used with DNA extracted from fecal samples,
using a modification of the QIAGEN kit (6, 196, 199).
Primers for the 29-kDa/30-kDa antigen gene have been used
for distinguishing among pathogenic and nonpathogenic species
of Entamoeba using conventional PCR (183). In research laboratories, this target has been used for analyses of microscopy-positive feces which have been cultured in the laboratory (135, 181) as
well as formalin-fixed fecal samples (146, 147, 148, 179).
Other gene targets for PCR include two protein-encoding
genes which have been shown to exhibit polymorphism in
the coding region. These are the serine-rich E. histolytica
protein (SREPH) gene (174) and the chitinase gene (38).
SREPH as a target was reported for the amplification of
DNA recovered from laboratory cultures and microscopypositive feces concentrated by the zinc-sulfate gradient floatation technique (141). A nested SREPH PCR approach was
recently used to investigate E. histolytica diversity in a single
human population, using DNA extracted from microscopypositive feces (11). PCR using the cysteine proteinase gene
and actin genes as targets was also used to study the epidemiology of amebiasis (54). In addition, a novel PCR assay
based on the E. histolytica hemolysin gene HLY6 (hemoPCR) was developed for the detection of E. histolytica DNA
with fecal and ALA samples and was shown to have 100%
sensitivity and specificity (216).
In an attempt to increase the sensitivity of the PCR assay, a
nested multiplex PCR was developed for the simultaneous
detection and differentiation of E. histolytica and E. dispar from
DNA extracted from microscopy-positive fecal samples (50, 72,
89, 97). Utilizing this multiplex technique, the sensitivity and
specificity were increased to 94% and 100%, respectively (123).
This method has been successfully used for detection of E.
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
521
TABLE 4. Primers used for conventional PCR for E. histolytica, E. dispar, and E. moshkovskii
PCR assay
Single tube
Gene target
Amplification
product (bp)
Primers
Sequence (5⬘33⬘)
M17
482
P1-S17a
P1-AS20a
GCAACTAGTGTTAGTTA
CCTCCAAGATATGTTTTAAC
63, 187, 214
30-kDa protein
100
P11a
P12a
GGAGGAGTAGGAAAGTTGAC
TTCTTGCAATTCCTGCTTCGA
69, 119, 135, 146, 147,
148, 157, 179, 181,
182, 183, 214, 216
101
P13b
P14b
AGGAGGAGTAGGAAAATTAGG
TTCTTGAAACTCCTGTTTCTAC
145
EHP1a
EHP2a
TCAAAATGGTCGTCGTCTAGGC
CAGTTAGAAATTATTGTACTTTGTA
133
EHNP1b
EHNP2b
GGATCCTCCAAAAAATAAAGT
CCACAGAACGATATTGGATACC
876
Psp Fa
Psp Ra
GGCCAATTCATTCAATGAATTGAG
CTCAGATCTAGAAACAATGCTTCTC
NPspFb
NPspRb
GGCCAATTTATGTAAGTAAATTGAG
CTTGGATTTAGAAACAATGTTTCTTC
145
P1a
P2a
TCAAAATGGTCGTCGTCTAGGC
CAGTTAGAAATTATTGTACTTTGTA
133
NP1b
NP2b
GGATCCTCCAAAAAATAAAGTTT
ATGATCCATAGGTTATAGCAAGACA
1,950
RD5c
GGAAGCTTATCTGGTTGATCCTGCC
AGTA
GGGATCCTGATCCTTCCGCAGGTTCAC
CTAC
141, 214
82, 192
DNA highly repetitive sequences
Small-subunit rRNA
Extrachromosomal circular DNA
Small-subunit rRNA
c
RD3
Nested
151
32, 105, 106, 116, 117
118, 119, 141, 142,
196
3, 6, 24, 214
880
Eh5a
Eh3a
GTACAAAATGGCCAATTCATTCAATG
CTCAGATCTAGAAACAATGCTTCTCT
880
Ed5b
Ed5b
GTACAAAGTGGCCAATTTATGTAAGT
ACTTGGATTTAGAAACAATGTTTCTTC
Hemolysin gene (HLY6) LSU
rRNA
256
EH6Fa
Eh6Ra
GACCTCTCCTAATATCCTCGT
GCAGAGAAGTACTGTGAAGG
216
30-kDa protein
374
HFc
HRc
AAGAAATTGATATTAATGAATATA
ATCTTCCAATTCCATCATCAT
86
Cysteine proteinase
242
Ehcp6Fa
Ehcp6Ra
GTTGCTGCTGAAGAAACTTG
GTACCATAACCAACTACTGC
54
Actin gene
300
Act3Fc
Act5Rc
GGGACGATATGGAAAAGATC
CAAGTCTAAGAATAGCA TGTG
Small-subunit rRNA
135
EH1a
ED1b
EHD 2c
GTACAAAATGGCCAATTCATTCAATG
TACAAAGTGGCCAATTTATGTAAGTA
ACTACCAACTGATTGATAGATCAG
27, 65
Small-subunit rRNA
900
EH-1c
EH-2c
TTTGTATTAGTACAAA
GTA(A/G)TATTGATATACT
11, 72, 97, 214, 216
Small-subunit rRNA
Duplex single
step
Reference(s)
Continued on following page
522
FOTEDAR ET AL.
CLIN. MICROBIOL. REV.
TABLE 4—Continued
PCR assay
Gene target
Amplification
product (bp)
Sequence (5⬘33⬘)
Reference(s)
EHP-1a
EHP-2a
EHN-1b
EHN-2b
AATGGCCAATTCATTCAATG
TCTAGAAACAATGCTTCTCT
AGTGGCCAATTTATGTAAGT
TTTAGAAACAATGTTTCTTC
E1c
E2c
TGCTGTGATTAAAACGCT
TTAACTATTTCAATCTCGG
427
Eh-La
Eh-Ra
ACATTTTGAAGACTTTATGTAAGTA
CAGATCTAGAAACAATGCTTCTCT
195
Ed-Lb
Ed-Rb
GTTAGTTATCTAATTTCGATTAGAA
ACACCACTTACTATCCCTACC
823
Outer 1Fc
Outer 1Rc
GAAATTCAGATGTACAAAGA
CAGAATCCTAGAATTTCAC
447
Eh1a
Eh2a
AAGCATTGTTTCTAGATCTG
CACGTTAAAAGAGGTCTAAC
603
Ed1b
Ed2b
AAACATTGTTTCTAAATCCA
ACCACTTACTATCCCTACC
553
SRPEh F
SRPEh Rc
CCTGAAAAGCTTGAAGAAGCTG
AACAATGAATGGACTTGATGCA
452
nSRPEh Fa
nSRPEh Ra
TGAAGATAATGAAGATGATGAAGATG
TATTATTATCGTTATCTGAACTACTT
CCTG
567
SRPEd Fb
SRPEd Rb
GTAGTTCATCAAACACAGGTGA
CAATAGCCATAATGAAAGCAA
Small-subunit rRNA
260
Em-1d
Em-2d
nEm-1d
nEm-2d
CTCTTCACGGGGAGTGCG
TCGTTAGTTTCATTACCT
GAATAAGGATGGTATGAC
AAGTGGAGTTAACCACCT
8, 52, 130, 171
Small-subunit rRNA
166
752
EntaFd
Ehrd
ATGCACGAGAGCGAAAGCAT
GATCTAGAAACAATGCTTCTCT
71
580
Edrd
Emrd
CACCACTTACTATCCCTACC
TGACCGGAGCCAGAGACAT
132
EhP1a
EhP2a
CGATTTTCCCAGTTAGAAATTA
CAAAATGGTCGTCGTCTAGGC
96
EdP1b
EdP2b
ATGGTGAGGTTGTAGCAGAGA
CGATATTGGATACCTAGTACT
900
900
Small-subunit rRNA
Small-subunit rRNA
Multiplex
Primers
Tandem repeats in
extrachromosomal circular
rDNA
1,076
50, 51, 129
89
141
123
a
Specific for E. histolytica.
Specific for E. dispar.
c
Specific for E. histolytica and E. dispar.
d
Specific for E. moshkovskii.
b
histolytica and E. dispar in formalin-fixed stool samples (129).
A PCR solution hybridization enzyme-linked immunoassay
targeting extrachromosomal circular DNA from E. histolytica
and E. dispar with specific primers and a biotin-conjugated
probe was shown to be sensitive for detection and differentiation of the two Entamoeba species in clinical samples (7, 11,
199).
PCR for the detection of E. histolytica DNA from liver
abscess samples was first employed using the gene encoding
the 30-kDa antigen, and 100% sensitivity was reported (182).
In another study, PCR performed on liver samples demonstrated only 33% sensitivity for the presence of E. histolytica
using primers specific for 18S rDNA of E. histolytica, whereas
the second pair, specific for the 30-kDa antigen gene (182),
showed a sensitivity of 100% (215). Direct amplification for
detection of E. histolytica DNA (without the extraction of
DNA) from ALA pus was reported using 10 different previously published primer pairs (used for amplification of E. his-
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
tolytica from liver and stool samples) (214). Of the 10 different
primer pairs tested, two pairs, i.e., P1-P2, targeting extrachromosomal circular DNA of E. histolytica (3), and P11-P12, targeting the 30-kDa antigen gene (182), gave 100% sensitivity.
Another PCR assay (hemo-PCR), based on the novel hemolysin gene HLY6 of E. histolytica, was analyzed for the liver
abscess samples. The hemo-PCR gave a positive result for 89%
of ALA samples, compared to 77% and 28% for the 30-kDa
antigen gene and 18S rDNA, respectively (216). The hemoPCR was found to be a valuable diagnostic tool for identification of E. histolytica in liver and fecal samples.
For the identification of E. moshkovskii in fecal specimens, a
riboprinting method was first reported by Haque et al. (72).
Subsequently, a PCR for the identification of E. moshkovskii in
fecal samples was developed as a nested 18S rDNA PCR followed by restriction endonuclease digestion (8). This method
has a high sensitivity and specificity (100%) with DNA extracted directly from stool samples using the QIAGEN stool
extraction kit (52).
Although PCR-based methods have been successfully used
for detection of all three Entamoeba species, their application
in routine diagnosis is still very limited. The introduction of
PCR-based methods has been hindered by difficulties in DNA
extraction from fecal samples (115). Moreover, the amplification and detection of DNA are time-consuming and expensive.
The shortcomings of PCR-based assays become apparent during practical applications. The generation of nonspecific DNA
fragments from environmental and clinical samples poses a
significant problem that often results in false-positive results.
Real-Time PCR
Real-time PCR is a new and a very attractive methodology
for laboratory diagnosis of infectious diseases because of its
characteristics that eliminate post-PCR analysis, leading to
shorter turnaround times, a reduction in the risk of amplicon contamination of laboratory environments, and reduced
reagent costs (99). This approach allows specific detection
of the amplicon by binding to one or two fluorescencelabeled probes during PCR, thereby enabling continuous
monitoring of amplicon (PCR product) formation throughout the reaction. An important aspect of real-time PCR is
enhanced sensitivity compared to conventional PCR, with
an ability to detect 0.1 cell per gram of feces (18). In addition, real-time PCR is a quantitative method and allows the
determination of the number of parasites in various samples.
Distinct real-time PCR protocols have recently been published for identification and differentiation of E. histolytica
from E. dispar (Table 5). These include a Light Cycler assay
utilizing hybridization probes to detect amplification of the 18S
rDNA from fecal samples (18, 27) and two TaqMan assays, one
targeting the 18S rDNA (98, 195, 198) and another targeting
the episomal repeats, using DNA extracted from fecal samples
collected from primates and humans (198, 200). A molecular
beacon-based real-time PCR targeting 18S rDNA of E. histolytica for use on fecal and ALA specimens was described (153).
A SYBR green real-time assay targeting the 18S rDNA was
described by Qvarnstrom et al. (139).
The sequences selected in the majority of these real-time
studies have included rDNA as the target for PCR. A recent
523
evaluation of three real-time PCR assays, focusing on the
weaknesses and strengths of each assay and their usefulness for
clinical laboratory diagnosis, was published by Qvarnstrom et
al. (139). This study highlighted major differences in detection
limits and assay performance that were observed among the
evaluated tests. Two of the assays in this study could not reliably distinguish E. histolytica from E. dispar, including the
Light Cycler assay (17) and the TaqMan assay targeting episomal repeats (198, 200). A multiplex real-time assay was subsequently developed for detection of different intestinal parasites with 100% sensitivity and specificity (195). This assay
allows detection of E. histolytica, G. lamblia, and C. parvum
and offers the possibility of introducing DNA detection in the
routine diagnosis of intestinal parasitic infections. The implementation of such multiplex assays and the development of
automated DNA isolation procedures could have a tremendous impact on routine parasitology practice. Accurate diagnosis necessitates that the same reaction conditions are used
for a standard and for the sample. Duplex or multiplex approaches with internal standardization provide a solution for
this problem.
A real-time PCR for detection of E. moshkovskii in clinical
samples has not yet been reported. Further research is therefore required to develop these methods for the detection of E.
moshkovskii.
Although real-time PCR assays are sufficiently sensitive to
detect a single cell, the limited number of probes that can be
applied in one reaction hinders its utility for confident multitarget detection and genotyping analysis (139). The overabundance of one species to be detected in a real-time PCR can
mask the ability to detect a second species when the same
amplification primers are shared in a duplex assay. Such duplex
(or multiplex) assays that distinguish between targets only by
use of different probes are not suitable for simultaneous detection of more than one microorganism in a single reaction. In
addition to this, real-time PCR is a costly procedure compared
with fecal microscopy and antigen-based detection tests. Thus,
poor regions of the world, where E. histolytica is most prevalent, will unfortunately be less likely to benefit from real-time
PCR. Instead, this technique will be feasible primarily in clinical laboratories in developed countries that need to diagnose
amebiasis in high-risk groups such as MSM, travelers, and
immigrants from regions of the world where E. histolytica is
endemic.
Microarray Development
One application that has revolutionized the postgenomic era
is the development and use of microarray technology. DNA
microarrays are a newly developed technology used for the
detection of pathogens and are rapid and sensitive. The
method involves four steps: extraction of genomic DNA, amplification of targeted DNA, hybridization of labeled DNA
with oligonucleotide probes immobilized on a microarray, and
data analysis. Oligonucleotide microarrays have been successfully applied to the diagnosis of many pathogens in recent
years. Microarray-based approaches represent an attractive diagnostic tool for detection and identification of parasitic species in clinical and epidemiological investigations.
The first oligonucleotide microarray developed for parallel
detection of E. histolytica, E. dispar, G. lamblia assemblages A
524
FOTEDAR ET AL.
CLIN. MICROBIOL. REV.
TABLE 5. Published real-time PCR assays for E. histolytica and E. dispar
Assay
Light cycler
TaqMan 1
TaqMan 2
Multiplex real time PCR
Gene target
18S rRNA
18S rRNA
Episomal repeats
(SREPH gene)
18S rRNA
Artus (Hamburg,
Germany) real-time
LC-PCR kitd
SYBER green
Molecular beacon
18S rRNA
18S rRNA
Amplicon
(bp)
Primer or probe
Sequence (5⬘33⬘)
Nucleotide
position
Reference(s)
Eh-S26Ca
Ed-27 Cb
Eh-Ed-AS25c
GTACAAAATGGCCAATTCATTCAACG
GTACAAAGTGGCCAATTTATGTAAGCA
GAATTGATTTTACTCAACTCTAGAG
190–216
191–217
497–473
Eh/Ed-24LC-Red
640
Eh-Ed-25-Fc
LC-Red-640-TCGAACCCCAATTCCTCGTTA
TCCp
FL-GCCATCTGTAAAGCTCCCTCTCCGAX
373–350
Eh-d-239Fa
Ehd-88Rb
ATTGTCGTGGCATCCTAACTCA
GCGGACGGCTCATTATAACA
260–239
88–107
Histolytica-96Ta
VIC-TCATTGAATGAATTGGCCATTTnonfluorescent quencher
217–197
Dispar-96Tb
FAM-TTACTTACATAAATTGGCCACTTTGnonfluorescent quencher
218–194
Histolytica-50Fa
Histolytica-132Ra
CATTAAAAATGGTGAGGTTCTTAGGAA
TGGTCGTCGTCTAGGCAAAATATT
50–76
132–109
Histolytica-78Ta
FAM-TTGACCAATTTACACCGTTGATTTTCG
GA-Eclipse Dark quencher
106–78
137
Dispar-1Fb
Dispar-137Rb
Dispar-33b
GGATCCTCCAAAAAATAAAGTTTTATCA
ATCCACAGAACGATATTGGATACCTAGTA
HEX-UGGUGAGGUUGUAGCAGAGAUAUUA
AUU-TAMRA
1–28
137–109
33–60
172
Ehd-239Fc
Ehd-88Rc
Histolytica-96Ta
ATTGTCGTGGCATCCTAACTCA
GCGGACGGCTCATTATAACA
VIC-TCATTGAATGAATTGGCCATTTnonfluorescent quencher
260–239
88–107
217–197
195
230
E. histolytica
NDe
55
877
PSP5a
PSP3a
GGCCAATTCATTCAATGAATTGAG
CTCAGATCTAGAAACAATGCTTCTC
200–223
1076–1052
139
878
NPSP5b
NPSP3b
GGCCAATTTATGTAAGTAAATTGAG
CTTGGATTTAGAAACAATGTTTCTTC
200–224
1077–1052
134
Ehfa
Ehra
Molecular beacon
probe
AACAGTAATAGTTTCTTTGGTTAGTAAAA
CTTAGAATGTCATTTCTCAATTCAT
Texas Red-GCGAGC-ATTAGTACAAAATGGCC
AATTCATTCA-GCTCGC-dR Elle
307
231
83
18, 27, 139
400–376
104–238
98, 139, 195,
198
139, 198,
200
153
a
Specific for E. histolytica.
Specific for E. dispar.
c
Specific for E. histolytica and E. dispar.
d
Discontinued.
e
ND, not described.
b
and B, and C. parvum types 1 and 2 in a single assay with high
specificity and sensitivity was reported by Wang et al. (205). In
addition to distinguishing between the principal genotypes, this
assay proved to be useful in detecting and differentiating E.
moshkovskii from E. histolytica. However, this study was conducted with purified genomic DNA extracted from standard
culture strains of different parasites (205).
A microarray-based genotyping assay (comparative genomic
hybridization) technique was later developed using sequenced
genomic DNA clones from E. histolytica (HM-1:IMSS). This
was the first genome-wide analysis of Entamoeba strains, and it
revealed that this technology can be used to distinguish E.
histolytica from E. dispar, to identify genes restricted to virulent
strains, and to find potential genotypic-phenotypic associations
(164).
Microarray assays are at this time mostly a research tool and
have seldom been used in the clinical diagnostic laboratory for
detection and differentiation of parasites. However, with anticipated improvements in the microarray technology along
with decreasing cost, it is possible that this technology may
become placed at the forefront of parasitic research.
Typing Methods
The observed heterogeneity in virulence among strains,
which may determine a strain’s ability to cause invasive disease,
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
525
TABLE 6. Primers for fingerprinting of E. histolytica, E. dispar, and E. moshkovskii
Gene target
Primer
Sequence (5⬘33⬘)
Reference(s)
Strain-specific gene for E. histolytica
SSG5
SSG3
GGTCTCAAAAAACCCACGAG
CAAACGATAAAATCTAGCAAACTAC
33, 213
Serine gene for E. histolytica
SREHP5 (EHF)
SREPH3 (EHR)
GCTAGTCCTGAAAAGCTTGAAGAAGCTG
GGACTTGATGCAGCATCAAGGT
11, 33, 69, 146,
170, 213
nSREPH5
nSREPH3
TATTATTATCGTTATCTGAACTACTTCCTG
TGAAGATAATGAAGATGATGAAGATG
Serine gene for E. dispar
SREHP (F) EDF
SREHP (R) EDR
AGATACTAAGATTTCAGTC
CATAATGAAAGCAAAGAG
62
Chitinase gene for E. histolytica
EHF
EHR
GGAACACCAGGTAAATGTATA
TCTGTATTGTGCCCAATT
62, 69
Chitinase gene for E. dispar
EDF
EDR
GGAACACCAGGTAAATGCCTT
TCTGTATTGTGCCCAATT
62
Intergenic regions between actin gene
and superoxide dismutase gene of
E. histolytica and E. dispar
EH/EDF
EH/EDR
TTGGTGGAATGTAGTCAACTG
AAATCCGGCTTTACACATTCC
62
Locus 1-2 (E. histolytica and E. dispar)
Dsp1
Dsp2
TTGAAGAGTTCACTTTTTATACTATA
TAACAATAAAGGGGAGGG
136, 211, 212
Locus 5-6 (E. histolytica and E. dispar)
Dsp5
Dsp6
CTATACTATATTCTT TTTATGTACTTCCC
CTGAGAGCATTGTTTTTAAAGAA
E. moshkovskii Arg gene
EmR-1
EmR-2
GGCGCCTTTTTTACTTTATGG
GCTAACAAGGCCAATCGATAAA
has stimulated efforts through molecular epidemiological studies to determine whether some subgroups of E. histolytica are
more likely than others to cause invasive disease. The parasite
and host variables that contribute to the epidemiology of disease are not clear, and there is probably a complex interplay
between host genetics, immunity, enteric flora, nutrition, and
parasite genetics that occurs and contributes to disease.
Whether there are subtypes of E. histolytica that have higher or
lower virulence potential or a predilection for infection of
certain organs is not known. The WHO has prioritized efforts
to determine whether functional subgroups of E. histolytica
exist, which may help address some of the unanswered questions surrounding the virulence of this parasite (210). The
strain identification tools available to date are limited. Isoenzyme analysis provided the first markers (159), but it is now
known that isoenzyme patterns are not fixed (see “Isoenzyme
Analysis” above), and therefore many assigned zymodemes are
unreliable (94).
Intraspecific variation in E. histolytica was described by
Clark and Diamond (33), and their studies on E. histolytica
cultures (xenic and axenic) from different geographical areas
of the world demonstrated the presence of extensive polymorphism in the SREHP gene (174) and the strain-specific gene
(SSG) (25) (Table 6). The SREHP gene, which encodes an
8
immunodominant surface antigen, encodes contains 8- and
12-amino-acid tandem repeats. The existence of genetic differences among strains of E. histolytica which cause intestinal or
liver disease has been demonstrated by the polymorphism exhibited in the SREHP gene using nested PCR performed on
DNA extracted from stool and liver samples (11). However,
these findings were later contradicted by Haghighi et al. (70).
The SSG, which is a noncoding gene and contains tandemly
repeated sequences ranging in size from 8 to 16 bp, has been
used to differentiate strains by the number of repeats among
strains of E. histolytica (25, 33). However, the complete absence of this locus in certain strains makes it a poor marker for
intraspecies typing (162).
The use of short tandem repeats that are linked to tRNA
genes has been developed for genotyping of E. histolytica (9).
This PCR-based genotyping of E. histolytica should allow the
investigation of a possible association between the genotype
and the outcome of infection (9).
Other DNA markers to distinguish among isolates of E.
histolytica include the chitinase gene, which encodes tandem
repeats of a degenerate 7-amino-acid sequence (38, 69). Studies with the chitinase gene as a marker for studying populations
of E. dispar have revealed the presence of different strains in
Serum (acute infection)
Serum (convalescent
infection)
Stool
Stool
Liver aspirate
Antibody detection
Culture and isoenzyme
PCR-based assaysc
Data are from references 77, 90, 91, 188, and 215.
NA, not available.
c
PCR assay for cerebrospinal fluid (172).
b
NA
100
⬎90
NA
⬎90
90–100
Gold standard
⬍25
75–85
⬎90
Lower than that of
antigen or PCR
tests (problems
in case of mixed
infections)
90–100
⬎85
Yes
NA
ALA fluid
⬎95
⬎90
10–50
100
Specificity (%)
70–100
⬎90
Usually negative
75 (late), 100 (early
detection, before
treatment)
100 (before
treatment)
⬎95
65 (early)
Antigen detection (ELISA)
Stool
Serum
ALA
⬍10
⬍25
Stool
Liver abscess fluid
a
Sensitivity (%)
Amebic colitis
25–60
NAb
Specimen
Microscopy (wet mount/permanent
stain)
Test
1–2 days
1–2 wk
2–3 h
3h
1–2 h
Time
required
TABLE 7. Sensitivity and specificity of different laboratory tests for diagnosis of amebiasisa
Yes
Yes
For certain antibody
assays
None
Yes
Technical expertise
required
High
High, laborintensive
Low
Low
Low
Cost
526
FOTEDAR ET AL.
CLIN. MICROBIOL. REV.
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
VOL. 20, 2007
different geographical areas by using DNA extracted from fecal samples (62, 140).
Other typing methods targeting repeats include the use of
microsatellite typing for detecting intra- and interspecies differences. Microsatellites are segments of DNA that consist of
tandem repeats of very simple motifs such as (CT)n. The microsatellite typing is performed by amplifying the microsatellite by PCR using specific primers. Two minisatellite loci containing internal repeats, loci 1-2 and 5-6, have demonstrated
variable polymorphism for E. histolytica and E. dispar (136,
211, 212), indicating that these loci have the potential to be
used as molecular markers for investigating the epidemiology
of the two Entamoeba species.
Riboprinting has revealed considerable genetic divergence
among isolates of E. moshkovskii (34). Detection of polymorphisms among the E. moshkovskii samples was studied using
the EmR primers, and this attempt was only partially successful due to the differences in sequence of the primer-binding
regions (8). With the increasing reports highlighting the recovery of E. moshkovskii from human stool samples, further studies involving typing of E. moshkovskii would be helpful for
studying the epidemiology of this Entamoeba species.
CONCLUSION
Amebiasis caused by E. histolytica is one of the most common parasitic infections of mankind. Research on different
aspects of the parasite, carried out in various parts of the
world, particularly in the last two decades, has provided the
basis for breakthroughs such as the discovery of the other
closely related Entamoeba species, E. dispar and E. moshkovskii. The redefinition of E. histolytica, the redescription of E.
dispar, and the recent studies of recovery of E. moshkovskii
from patients have dramatically changed our understanding of
the prevalence of different Entamoeba species in the community. This has motivated researchers to develop diagnostic tests
capable of distinguishing and differentiating the three species
of Entamoeba encountered in the clinical laboratory (Table 7).
The diagnosis of invasive amebiasis is most commonly attempted by a combination of microscopy of a fecal specimen,
serological testing, and, where indicated, by colonoscopy and
biopsy of intestinal amebic lesions or by drainage of a liver
abscess. The inability of microscopic examination to detect and
differentiate the three species of Entamoeba has been highlighted. While serological testing remains a useful tool for the
diagnosis of amebiasis, studies have demonstrated the unreliability of serological tests to correctly diagnose this infection in
areas of endemicity, as the level of antiamebic antibodies remains elevated in serum for many years, resulting in the inability to distinguish past from current infection. Antigen detection using fecal ELISA is another diagnostic tool, which
could be used in areas of endemicity where diarrheal diseases
are common, and it has proven to be useful in the developing
world, where most cases of amebiasis occur and where molecular techniques cannot be used because of cost constraints.
However, the sensitivity of the fecal antigen test is about 100
times less than that of PCR, and in addition, several studies
have highlighted low specificity because of cross-reaction with
other Entamoeba species. The development of molecular tools,
including PCR and real-time PCR, to detect E. histolytica, E.
527
dispar, and E. moshkovskii DNA in stool or liver abscess samples has led to major advances in making an accurate diagnosis
during recent years. This in turn has assisted clinical diagnosis
and the appropriate selection of patients for antiamebic therapy. In order to minimize undue treatment of individuals infected with other species of Entamoeba such as E. dispar and E.
moshkovskii, efforts have been made for specific diagnosis of E.
histolytica rather than treatment based on the microscopic examination of Entamoeba species in feces. In tropical and subtropical countries where amebiasis is endemic, the standard
clinical approach is to treat all asymptomatic individuals with
cysts in feces with an antiprotozoal agent. This approach to
treatment causes indiscriminate use of antiamebic agents and
has led to increased MICs of these therapeutic agents against
E. histolytica, with a potential for resistant strains to appear
(13, 110). These considerations suggest that positive fecal samples should be confirmed with reliable tests prior to initiation
of therapy.
Our understanding of different aspects of Entamoeba species
and the disease they can cause makes this a very exciting and
rewarding time for the study of amebiasis. The incorporation
of many new technologies into the diagnostic laboratory will
represent a challenge to us all. Such studies will then lead to a
better understanding of the public health problem and measures to control the disease.
REFERENCES
1. Abd-Alla, M. D., T. G. Jackson, and J. L. Ravdin. 1998. Serum IgM antibody response to the galactose-inhibitable adherence lectin of Entamoeba
histolytica. Am. J. Trop. Med. Hyg. 59:431–434.
2. Abd-Alla, M. D., T. F. Jackson, S. Reddy, and J. I. Ravdin. 2000. Diagnosis
of invasive amoebiasis by enzyme linked immunosorbent assay of saliva to
detect amoebic lectin antigen and antilectin immunoglobulin G antibodies.
J. Clin. Microbiol. 38:2344–2347.
3. Acuna-Soto, R., J. Samuelson, P. De Girolami, L. Zarate, F. MillanVelasco, G. Schoolnick, and D. Wirth. 1993. Application of the polymerase
chain reaction to the epidemiology of pathogenic and nonpathogenic Entamoeba histolytica. Am. J. Trop. Med. Hyg. 48:58–70.
4. Adams, E. B., and I. N. MacLeod. 1977. Invasive amebiasis. I. Amebic
dysentery and its complications. Medicine 56:315–323.
5. Adams, E. B., and I. N. MacLeod. 1977. Invasive amebiasis. II. Amebic liver
abscess and its complications. Medicine 56:325–334.
6. Aguirre, A., D. C. Warhurst, F. Guhl, and I. A. Frame. 1995. Polymerase
chain reaction-solution hybridization enzyme-linked immunoassay (PCRSHELA) for the differential diagnosis of pathogenic and non-pathogenic
Entamoeba histolytica. Trans. R. Soc. Trop. Med. Hyg. 89:187–188.
7. Aguirre, A., S. Molina, C. Blotkamp, J. Verveij, T. Vinuesa, M. E. Valls, F.
Guhl, A. Polderman, M. T. Jimenez de Anta, M. Corachan, A. GonzalezRuiz, I. A. Frame, and D. Warhurst. 1997. Diagnosis of Entamoeba histolytica and Entamoeba dispar in clinical specimens by PCR-SHELA. Arch.
Med. Res. 28:285–287.
8. Ali, I. K., M. B. Hossain, S. Roy, P. F. Ayeh-Kumi, W. A. Petri, Jr., R.
Haque, and C. G. Clark. 2003. Entamoeba moshkovskii infections in children, Bangladesh. Emerg. Infect. Dis. 9:580–584.
9. Ali, I. K., M. Zaki, and C. G. Clark. 2005. Use of PCR amplification of
tRNA gene-linked short tandem repeats for genotyping Entamoeba histolytica. J. Clin. Microbiol. 43:5842–5847.
10. Allason-Jones, E., A. Mindel, P. Sargeaunt, and P. Williams. 1986. Entamoeba histolytica as a commensal intestinal parasite in homosexual men.
N. Engl. J. Med. 31:353–356.
11. Ayeh-Kumi, P. F., I. M. Ali, L. A. Lockhart, C. A. Gilchrist, W. A. Petri, Jr.,
and R. Haque. 2001. Entamoeba histolytica: genetic diversity of clinical
isolates from Bangladesh as demonstrated by polymorphisms in the serinerich gene. Exp. Parasitol. 99:80–88.
12. Balamuth, W. 1946. Improved egg yolk medium for cultivation of Entamoeba histolytica and other intestinal protozoa. Am. J. Clin. Pathol. 16:
380–384.
13. Bansal, D., R. Sehgal, Y. Chawla, R. C. Mahajan, and N. Malla. 2004. In
vitro activity of antiamoebic drugs against clinical isolates of Entamoeba
histolytica and Entamoeba dispar. Ann. Clin. Microbiol. Antimicrob.
21:3:27.
528
FOTEDAR ET AL.
14. Barnes, P. F., K. M. DeCock, T. N. Reynolds, and P. W. Tralla. 1987. A
comparison of amebic and pyogenic abscess of the liver. Medicine (Baltimore) 66:472–483.
15. Bhattacharya, S., A. Bhattacharya, L. S. Diamond, and A. T. Soldo. 1989.
Circular DNA of Entamoeba histolytica encodes ribosomal RNA. J. Protozool. 36:455–458.
16. Blanc, D., and P. G. Sargeaunt. 1991. Entamoeba histolytica zymodemes:
exhibition of gamma and delta bands only of glucose phosphate isomerase
and phosphoglucomutase may be influenced by starch content in the medium. Exp. Parasitol. 72:87–90.
17. Blessmann, J., I. K. Ali, P. A. Nu, B. T. Dinh, T. Q. Viet, A. L. Van, C. G.
Clark, and E. Tannich. 2003. Longitudinal study of intestinal Entamoeba
histolytica infections in asymptomatic adult carriers. J. Clin. Microbiol.
41:4745–4750.
18. Blessmann, J., H. Buss, P. A. Nu, B. T. Dinh, Q. T. Ngo, A. L. Van, M. D.
Alla, T. F Jackson, J. I. Ravdin, and E. Tannich. 2002. Real-time PCR for
detection and differentiation of Entamoeba histolytica and Entamoeba dispar in fecal samples. J. Clin. Microbiol. 40:4413–4417.
19. Blessmann, J., P. Van Linh, P. A. Nu, H. D. Thi, B. Muller-Myhsok, H.
Buss, and E. Tannich. 2002. Epidemiology of amebiasis in a region of high
incidence of amebic liver abscess in central Vietnam. Am. J. Trop. Med.
Hyg. 66:578–583.
20. Blessmann, J., A. L. Van, and E. Tannich. 2006. Epidemiology and treatment of amebiasis in Hue, Vietnam. Arch. Med. Res. 37:270–272.
21. Blessmann, J., N. D. Khoa, A. L. Van, and E. Tannich. 2006. Ultrasound
patterns and frequency of focal liver lesions after successful treatment of
amoebic liver abscess. Trop. Med. Int. Health 4:504–508.
22. Boonyapisit, S., O. Chinapak, and U. Plengvait. 1993. Amoebic liver abscess in Thailand, clinical analysis of 418 cases. J. Med. Assoc. Thailand
76:243–246.
23. Braga, L. L., Y. Mendonca, C. A. Paiva, A. Sales, A. L. Cavalcante, and B. J.
Mann. 1998. Seropositivity for and intestinal colonization with Entamoeba
histolytica and Entamoeba dispar in individuals in northeastern Brazil.
J. Clin. Microbiol. 36:3044–3045.
24. Britten, D., S. M. Wilson, R. McNerney, A. H. Moody, P. L. Chiodini, and
J. P. Ackers. 1997. An improved colorimetric PCR-based method for detection and differentiation of Entamoeba histolytica and Entamoeba dispar.
J. Clin. Microbiol. 35:1108–1111.
25. Burch, D. J., E. Li, S. Reed, T. F. Jackson, and S. L. Stanley. 1991. Isolation
of a strain-specific Entamoeba histolytica cDNA clone. J. Clin. Microbiol.
29:696–701.
26. Caballero-Salcedo, A., M. Viveros-Rogel, B. Salvatierra, R. Tapia-Conyer,
J. Sepulveda-Amor, G. Gutierrez, and L. Ortiz-Ortiz. 1994. Seroepidemiology of amebiasis in Mexico. Am. J. Trop. Med. Hyg. 50:412–419.
27. Calderaro, A., C. Gorrini, S. Bommezzadri, G. Piccolo, G. Dettori, and C.
Chezzi. 2006. Entamoeba histolytica and Entamoeba dispar: comparison of
two PCR assays for diagnosis in a non-endemic setting. Trans. R. Soc. Trop.
Med. Hyg. 100:450–457.
28. Chadee, K., J. M. Smith, and E. Meerovitch. 1985. Entamoeba histolytica:
electrophoretic isoenzyme patterns of strains and their virulence in the
cecum of gerbils (Meriones unguiculatus). Am. J. Trop. Med. Hyg. 34:870–
878.
29. Clark, C. G. 1995. Axenic cultivation of Entamoeba dispar Brumpt 1925,
Entamoeba insolita Geiman and Wichterman 1937 and Entamoeba ranarum
Grassi 1879. J. Eukaryot. Microbiol. 42:590–593.
30. Clark, C. G., and L. S. Diamond. 1991. The Laredo strain and other
Entamoeba histolytica-like amoebae are Entamoeba moshkovskii. Mol.
Biochem. Parasitol. 46:11–18.
31. Clark, C. G., and L. S. Diamond. 1991. Ribosomal RNA genes of ‘pathogenic’ and ‘nonpathogenic’ Entamoeba histolytica are distinct. Mol. Biochem. Parasitol. 49:297–302.
32. Clark, C. G., and L. S. Diamond. 1992. Differentiation of pathogenic
Entamoeba histolytica from other intestinal protozoa by riboprinting. Arch.
Med. Res. 23:15–16.
33. Clark, C. G., and L. S. Diamond. 1993. Entamoeba histolytica: a method for
isolate identification. Exp. Parasitol. 77:450–455.
34. Clark, C. G., and L. S. Diamond. 1997. Intraspecific variation and phylogenetic relationships in the genus Entamoeba as revealed by riboprinting. J.
Eukaryot. Microbiol. 44:142–154.
35. Clark, C. G., and L. S. Diamond. 2002. Methods for cultivation of luminal
parasitic protists of clinical importance. Clin. Microbiol. Rev. 15:329–341.
36. Cruz-Reyes, J. A., W. M. Spice, T. Rehman, E. Gisborne, and J. P. Ackers.
1992. Ribosomal DNA sequences in the differentiation of pathogenic and
non-pathogenic isolates of Entamoeba histolytica. Parasitology 104:239–246.
37. Debnath, A., P. Das, M. Sajid, and J. H. McKerrow. 2004. Identification of
genomic responses to collagen binding by trophozoites of Entamoeba histolytica. J. Infect. Dis. 190:448–457.
38. De la Vega, H., C. A. Specht, C. E. Semino, P. W. Robbins, D. Eichinger, D.
Caplivski, S. Ghosh, and J. Samuelson. 1997. Cloning and expression of
chitinases of Entamoebae. Mol. Biochem. Parasitol. 85:139–147.
39. Diamond, L. S. 1961. Axenic cultivation of Entamoeba histolytica. Science
134:336–337.
CLIN. MICROBIOL. REV.
40. Diamond, L. S. 1968. Improved method for the monoxenic cultivation of
Entamoeba histolytica Schaudinn, 1903 and E. histolytica-like amebae with
trypanosomatids. J. Parasitol. 54:715–719.
41. Diamond, L. S. 1982. A new liquid medium for xenic cultivation of Entamoeba histolytica and other lumen dwelling protozoa. J. Parasitol. 68:958–
959.
42. Diamond, L. S., and I. L. Bartgis. 1970. Entamoeba moshkovskii: axenic
cultivation. Exp. Parasitol. 28:171–175.
43. Diamond, L. S., and C. G. Clark. 1993. A redescription of Entamoeba
histolytica Schaudinn, 1903 (Emended Walker, 1911) separating it from
Entamoeba dispar Brumpt, 1925. J. Eukaryot. Microbiol. 40:340–344.
44. Diamond, L. S., C. G. Clark, and C. C. Cunnick. 1995. YI-S, a casein-free
medium for axenic cultivation of Entamoeba histolytica, related Entamoeba,
Giardia intestinalis and Trichomonas vaginalis. J. Eukaryot. Microbiol. 42:
277–278.
45. Diamond, L. S., D. R. Harlow, and C. C. Cunnick. 1978. A new medium for
the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans.
R. Soc. Trop. Med. Hyg. 72:431–432.
46. Dreyer, D. A. 1961. Growth of a strain of Entamoeba histolytica at room
temperature. Texas Rep. Biol. Med. 19:393–396.
47. Edman, U., M. A. Meraz, S. Rausser, N. Agabian, and I. Meza. 1990.
Characterization of an immuno-dominant variable surface antigen from
pathogenic and nonpathogenic Entamoeba histolytica. J. Exp. Med. 172:
879–888.
48. Espinosa-Cantellano, M., G. Castañon Gutierrez, and A. Martı́nezPalomo. 1997. In vivo pathogenesis of Entamoeba dispar. Arch. Med. Res.
28:S204–S206.
49. Espinosa-Cantellano, M., A. González-Robles, B. Chávez, G. Castañon, C.
Argüello, A. Lázaro-Haller, and A. Martı́nez-Palomo. 1998. Entamoeba
dispar: ultrastructure, surface properties, and cytopathic effect. J. Eukaryot.
Microbiol. 45:265–272.
50. Evangelopoulos, A., G. Spanakos, E. Patsoula, N. Vakalis, and N. A. Legakis.
2000. A nested, multiplex, PCR assay for the simultaneous detection and
differentiation of Entamoeba histolytica and Entamoeba dispar in faeces. Ann.
Trop. Med. Parasitol. 94:233–240.
51. Evangelopoulos, A., N. Legakis, and N. Vakalis. 2001. Microscopy, PCR
and ELISA applied to the epidemiology of amoebiasis in Greece. Parasitol.
Int. 50:185–189.
52. Fotedar, R., D. Stark, N. Beebe, D. Marriott, J. Ellis, and J. Harkness.
2007. PCR detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in stool samples from Sydney, Australia. J. Clin. Microbiol. 45:1035–1037.
53. Freedman, L., S. E. Maddison, and R. Elsdon-Dew. 1958. Monoxenic culture of Entamoeba histolytica derived from human liver abscesses. S. Afr.
J. Med. Sci. 23:9–12.
54. Freitas, M. A., E. N. Vianna, A. S. Martins, E. F. Silva, J. L. Pesquero, and
M. A. Gomes. 2004. A single step duplex PCR to distinguish Entamoeba
histolytica from Entamoeba dispar. Parasitology 128:625–628.
55. Furrows, S. J., A. H. Moody, and P. L. Chiodini. 2004. Comparison of PCR
and antigen detection methods for diagnosis of Entamoeba histolytica infection. J. Clin. Pathol. 57:264–266.
56. Garcia, L. S., D. A. Bruckner, T. C. Brewer, and R. Y. Shimizu. 1982.
Comparison of indirect fluorescent-antibody amoebic serology with counterimmunoelectrophoresis and indirect hemagglutination amoebic serologies. J. Clin. Microbiol. 5:603–605.
57. Garcia, L. S., and D. A. Bruckner. 1997. Diagnostic medical parasitology.
ASM Press, Washington, DC.
58. Garcia, L. S., R. Y. Shimizu, and C. N. Bernard. 2000. Detection of Giardia
lamblia, Entamoeba histolytica/Entamoeba dispar, and Cryptosporidium parvum antigens in human fecal specimens using the Triage parasite panel
enzyme immunoassay. J. Clin. Microbiol. 38:3337–3340.
59. Garfinkel, L. I., M. Giladi, M. Huber, C. Gitler, D. Mirelman, M. Revel,
and S. Rozenblatt. 1989. DNA probes specific for Entamoeba histolytica
possessing pathogenic and nonpathogenic zymodemes. Infect. Immun. 57:
926–931.
60. Gathiram, V., and T. F. Jackson. 1987. A longitudinal study of asymptomatic carriers of pathogenic zymodemes of Entamoeba histolytica. S. Afr.
Med. J. 72:669–672.
61. Gatti, S., G. Swierczynski, F. Robinson, M. Anselmi, J. Corrales, J.
Moreira, G. Montalvo, A. Bruno, R. Maserati, Z. Bisoffi, and M. Scaglia.
2002. Amebic infections due to the Entamoeba histolytica-Entamoeba dispar
complex: a study of the incidence in a remote rural area of Ecuador. Am. J.
Trop. Med. Hyg. 67:123–127.
62. Ghosh, S., M. Frisardi, L. Ramirez-Avila, S. Descoteaux, K. SturmRamirez, O. A. Newton-Sanchez, J. I. Santos-Preciado, C. Ganguly, A.
Lohia, S. Reed, and J. Samuelson. 2000. Molecular epidemiology of Entamoeba spp.: evidence of a bottleneck (demographic sweep) and transcontinental spread of diploid parasites J. Clin. Microbiol. 38:3815–3821.
63. Gomes, M. A., J. B. Pesquero, C. Furst, P. R. Valle, J. L. Pesquero, and E. F.
Silva. 1999. An improved method to distinguish Entamoeba histolytica and
Entamoeba dispar. Parasitology 119:359–362.
64. Goncalves, M. L., V. L. da Silva, C. M. de Andrade, K. Reinhard, G. C. da
VOL. 20, 2007
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
Rocha, M. Le Bailly, F. Bouchet, L. F. Ferreira, and A. Araujo. 2004.
Amoebiasis distribution in the past: first steps using an immunoassay technique. Trans. R. Soc. Trop. Med. Hyg. 98:88–91.
Gonin, P., and L. Trudel. 2003. Detection and differentiation of Entamoeba
histolytica and Entamoeba dispar isolates in clinical samples by PCR and
enzyme-linked immunosorbent assay. J. Clin. Microbiol. 41:237–241.
Gonzalez, C. R., A. Isibasi, V. Ortiz-Navarrete, J. Paniagua, J. A. Garcia, A.
Ramirez, B. Salvatierra, R. Tapia, J. Sepulveda, G. Gutierrez, et al. 1995.
Prevalence of antibodies against Entamoeba histolytica in Mexico measured
by ELISA. Epidemiol. Infect. 115:535–543.
Gonzalez-Ruiz, A., R. Haque, A. Aguire, G. Castanon, A. Hall, F. Guhl, G.
Ruiz-Palacios, M. A. Miles, and D. C. Warhurst. 1994. Value of microscopy
in the diagnosis of dysentery associated with invasive Entamoeba histolytica.
J. Clin. Pathol. 47:236–239.
Grundy, M. S. 1982. Preliminary observations using a multi-layer ELISA
method for the detection of Entamoeba histolytica trophozoite antigens in
stool samples. Trans. R. Soc. Trop. Med. Hyg. 76:396–400.
Haghighi, A., S. Kobayashi, T. Takeuchi, G. Masuda, and T. Nozaki. 2002.
Remarkable genetic polymorphism among Entamoeba histolytica isolates
from a limited geographic area. J. Clin. Microbiol. 40:4081–4090.
Haghighi, A., S. Kobayashi, T. Takeuchi, N. Thammapalerd, and T. Nozaki.
2003. Geographic diversity among genotypes of Entamoeba histolytica field
isolates, J. Clin. Microbiol. 41:3748–3756.
Hamzah, Z., S. Petmitr, M. Mungthin, S. Leelayoova, and P. Chavalitshewinkoon-Petmitr. 2006 Differential detection of Entamoeba histolytica,
Entamoeba dispar, and Entamoeba moshkovskii by a single-round PCR
assay. J. Clin. Microbiol. 44:3196–3200.
Haque, R., I. K. Ali, S. Akther, and W. A. Petri, Jr. 1998. Comparison of
PCR, isoenzyme analysis, and antigen detection for diagnosis of Entamoeba
histolytica infection. J. Clin. Microbiol. 36:449–452.
Haque, R., I. K. M Ali, C. G. Clark, and W. A. Petri, Jr. 1998. A case report
of Entamoeba moshkovskii infection in a Bangladeshi child. Parasitol. Int.
47:201–202.
Haque, R., I. K. M. Ali, and W. A. Petri, Jr. 1999. Prevalence and immune
response to Entamoeba histolytica infection in preschool children in Bangladesh. Am. J. Trop. Med. Hyg. 60:1031–1034.
Haque, R., I. M. Ali, R. B. Sack, B. M. Farr, G. Ramakrishnan, and W. A.
Petri, Jr. 2001. Amebiasis and mucosal IgA antibody against the Entamoeba
histolytica adherence lectin in Bangladeshi children. J. Infect. Dis. 183:
1787–1793.
Haque, R., A. S. G. Faruque, P. Hahn, D. Lyerly, and W. A. Petri, Jr. 1997.
Entamoeba histolytica and Entamoeba dispar infection in children in Bangladesh. J. Infect. Dis. 175:734–736.
Haque, R., C. D. Huston, M. Hughes, E. Houpt, and W. A. Petri, Jr. 2003.
Current concepts: amebiasis. N. Engl. J. Med. 348:1565–1573.
Haque, R., K. Kress, S. Wood, T. F. G. H. Jackson, D. Lyerly, T. Wilkins,
and W. A. Petri, Jr. 1993. Diagnosis of pathogenic Entamoeba histolytica
infection using a stool ELISA based on monoclonal antibodies to the
galactose specific adhesin. J. Infect. Dis. 167:247–249.
Haque, R., N. U. Mollah, I. K. M. Ali, K. Alam, A. Eubank, D. Luerly, and
W. A. Petri, Jr. 2000. Diagnosis of amebic liver abscess and intestinal
infection with the TechLab Entamoeba histolytica II antigen detection and
antibody tests. J. Clin. Microbiol. 38:3235–3239.
Haque, R., L. M. Neville, P. Hahn, and W. A. Petri, Jr. 1995. Rapid
diagnosis of Entamoeba infection by using Entamoeba and Entamoeba histolytica stool antigen detection kits. J. Clin. Microbiol. 33:2558–2561.
Haque, R., and W. A. Petri, Jr. 2006. Diagnosis of amebiasis in Bangladesh.
Arch. Med. Res. 37:273–276.
Heckendorn, F., E. K. NⴕGoran, I. Felgar, P. Vounatsou, A. Yapi, A. Oettli,
H. P. Marti, M. Dobler, M. Traore, K. L. Lohourignon, and C. Lengeler.
2002. Species-specific field-testing of Entamoeba spp. in an area of high
endemicity. Trans. R. Soc. Trop. Med. Hyg. 96:521–528.
Higgins, J. A., R. Fayer, J. M. Trout, L. Xiao, A. A. Lal, S. Kerby, and M. C.
Jenkins. 2001. Real-time PCR for the detection of Cryptosporidium parvum.
J. Microbiol. Methods 47:323–337.
Hira, P. R., J. Iqbal, F. Al-Ali, R. Philip, S. Grover, E. D’Almeida, and A. A.
Al-Eneizi. 2001. Invasive amebiasis: challenges in diagnosis in a non-endemic country (Kuwait). Am. J. Trop. Med. Hyg. 65:341–345.
Holland, J. L., L. Louie, A. E Simor, and M. Louie. 2000. PCR detection of
Escherichia coli 5O157:H7 directly from stools: evaluation of commercial
extraction methods for purifying fecal DNA. J. Clin. Microbiol. 38:4108–
4113.
Hooshyar, H., M. Rezaian, B. Kazemi, M. Jeddi-Tehrani, and S. SolaymaniMohammadi. 2004. The distribution of Entamoeba histolytica and Entamoeba
dispar in northern, central, and southern Iran. Trans. Parasitol. Res. 94:96–100.
Hougardy, N., A. Louahabi, and P. Goffinet. 2006. Direct and fast detection
of methicillin resistant Staphylococcus aureus carriage by automated nucleic
acid extraction and real time PCR. Pathol. Biol. 54:461–477.
Hung, C. C., P. J. Chen, S. M. Hsieh, J. M. Wong, C. T. Fang, S. C. Chang,
and M. Y. Chen. 1999. Invasive amoebiasis: an emerging parasitic disease in
patients infected with HIV in an area endemic for amoebic infection AIDS.
13:2421–2428.
529
89. Hung, C. C., H. Y. Deng, W. H. Hsiao, S. M. Hsieh, C. F. Hsiao, M. Y. Chen,
S. C. Chang, and K. E. Su. 2005. Invasive amebiasis as an emerging parasitic
disease in patients with human immunodeficiency virus type 1 infection in
Taiwan. Arch. Intern. Med. 165:409–415.
90. Huston, C. D., R. Haque, and W. A. Petri, Jr. 1999. Molecular-based
diagnosis of Entamoeba histolytica infection. Expert Rev. Mol. Med.
22:1–11.
91. Huston, C. D., and W. A. Petri, Jr. 1999. Amebiasis: clinical implications of
the recognition of Entamoeba dispar. Curr. Infect. Dis. Rep. 1:441–447.
92. Jackson, T. F., C. B. Anderson, and A. E. Simjee. 1984. Serological differentiation between past and present infection in hepatic amoebiasis. Trans.
R. Soc. Trop. Med. Hyg. 78:342–345.
93. Jackson, T. F., V. Gathiram, and A. E. Simjee. 1985. Seroepidemiological
study of antibody responses to the zymodemes of Entamoeba histolytica.
Lancet i:716–719.
94. Jackson, T. F., and S. Suparsad. 1997. Zymodeme stability of Entamoeba
histolytica and E. dispar. Arch. Med. Res. 28:304–305.
95. Jetter, A., B. Walderich, D. Britten, O. Mete, V. Goral, G. D. Burchard, and
J. Ackers. 1997. An epidemiological study of Entamoeba histolytica and E.
dispar infection in eastern Turkey using a colorimetric polymerase chain
reaction. Arch. Med. Res. 28(Suppl.):319–321.
96. Jones, W. R. 1946. The experimental infection of rats with Entamoeba
histolytica; with a method for evaluating the anti-amoebic properties of new
compounds. Ann. Trop. Med. Parasitol. 40:130–140.
97. Katzwinkel-Wladarsch, S., T. Loscher, and H. Rinder. 1994. Direct amplification and differentiation of pathogenic and non-pathogenic Entamoeba
histolytica DNA from stool specimens, Am. J. Trop. Med. Hyg. 51:115–118.
98. Kebede, A., J. J. Verweij, T. Endeshaw, T. Messele, G. Tasew, B. Petros, and
A. M. Polderman. 2004. The use of real-time PCR to identify Entamoeba
histolytica and E. dispar infections in prisoners and primary-school children
in Ethiopia. Ann. Trop. Med. Parasitol. 98:43–48.
99. Klein, D. 2002. Quantification using real-time PCR technology: applications and limitations. Trends Mol. Med. 8:257–260.
100. Knappik, M., U. Borner, and T. Jelinek. 2005. Sensitivity and specificity of
a new commercial enzyme-linked immunoassay kit for detecting Entamoeba histolytica IgG antibodies in serum samples. Eur. J. Clin. Microbiol. Infect. Dis. 24:701–703.
101. Knepp, J. H., M. A. Geahr, M. S. Forman, and A. Valsamakis. 2003.
Comparison of automated and manual nucleic acid extraction methods for
detection of enterovirus RNA. J. Clin. Microbiol. 41:3532–3536.
102. Knobloch, J., and E. Mannweiler. 1983. Development and persistence of
antibodies to Entamoeba histolytica in patients with amebic liver abscess.
Analysis of 216 cases Am. J. Trop. Med. Hyg. 32:727–732.
103. Kobayashi, S., E. Imai, H. Tachibana, T. Fujiwara, and T. Takeuchi. 1998.
Entamoeba dispar: cultivation with sterilized Crithidia fasciculata. J. Eukaryot. Microbiol. 45:3S–8S.
104. Krogstad, D. J., H. C. Spencer, Jr., G. R. Healy, N. N. Gleason, D. J. Sexton,
and C. A. Herron. 1978. Amebiasis: epidemiologic studies in the United
States, 1971–1974. Ann. Intern. Med. 88:89–97.
105. Lebbad, M., and S. G. Svard. 2005. PCR differentiation of Entamoeba
histolytica and Entamoeba dispar from patients with amoeba infection initially diagnosed by microscopy. Scand. J. Infect. Dis. 37:680–685.
106. Leiva, B., M. Lebbad, J. Winiecka-Krusnell, I. Altamirano, A. Tellez, and E.
Linder. 2006. Overdiagnosis of Entamoeba histolytica and Entamoeba dispar
in Nicaragua: a microscopic, Triage parasite panel and PCR study Arch.
Med. Res. 37:529–534.
107. Li, E., and S. L. Stanley, Jr. 1996. Protozoa. Amebiasis. Gastroenterol.
Clin. N. Am. 25:471–492.
108. Lysy, J., J. Zimmerman, Y. Sherman, R. Feigin, and M. Ligumsky. 1991.
Crohn’s colitis complicated by superimposed invasive amebic colitis. Am. J.
Gastroenterol. 86:1063–1065.
109. MacFarlane, R. C., and U. Singh. 2006. Identification of differentially
expressed genes in virulent and nonvirulent Entamoeba species: potential
implications for amebic pathogenesis. Infect. Immun. 74:340–351.
110. Martinez-Palomo, A., and M. Martinez-Baez. 1983. Selective primary
health care: strategies for control of disease in the developing world. X.
Amebiasis. Rev. Infect. Dis. 5:1093–1102.
111. McMillan, A., H. M. Gilmour, G. McNeillage, and G. R. Scott. 1984.
Amoebiasis in homosexual men. Gut 25:356–360.
112. Mhlanga, B. R., L. O. Lanoie, H. J. Norris, E. E. Lack, and D. H. Connor.
1992. Amebiasis complicating carcinomas—a diagnostic dilemma. Am. J.
Trop. Med. Hyg. 46:759–764.
113. Mirelman, D., Y. Nuchamowitz, and T. Stolarsky. 1997. Comparison of use
of enzyme-linked immunosorbent assay-based kits and PCR amplification
of rRNA genes for simultaneous detection of Entamoeba histolytica and E.
dispar. J. Clin. Microbiol. 35:2405–2407.
114. Mondal, D., W. A. Petri, Jr., R. B. Sack, B. D. Kirkpatrick, and R. Haque.
2006. Entamoeba histolytica-associated diarrheal illness is negatively associated with the growth of preschool children: evidence from a prospective
study. Trans. R. Soc. Trop. Med. Hyg. 100:1032–1038.
115. Monteiro, L., D. Bonnemaison, A. Vekris, K. G. Petry, J. Bonnet, R. Vidal,
530
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
FOTEDAR ET AL.
J. Cabrita, and F. Megraud. 1997. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J. Clin. Microbiol. 35:995–998.
Moran, P., F. Ramos, M. Ramiro, O. Curiel, E. Gonzalez, A. Valadez, A.
Gomez, G. Garcia, E. I. Melendro, and C. Ximenez. 2005. Entamoeba
histolytica and/or Entamoeba dispar: infection frequency in HIV⫹/AIDS
patients in Mexico City. Exp. Parasitol. 110:331–334.
Moran, P., F. Ramos, M. Ramiro, O. Curiel, E. Gonzalez, A. Valadez, A.
Gomez, G. Garcia, E. I. Melendro, and C. Ximenez. 2005. Infection by
human immunodeficiency virus-1 is not a risk factor for amebiasis. Am. J.
Trop. Med. Hyg. 73:296–300.
Myjak, P., J. Kur, and H. Pietkiewicz. 1997. Usefulness of new DNA
extraction procedure for PCR technique in species identification of Entamoeba isolates. Wiad. Parazytol. 43:163–170.
Myjak, P., J. Kur, H. Pietkiewicz, A. Kotlowski, W. Nahorski, and B.
Szostakowska. 2000. Molecular differentiation of Entamoeba histolytica and
Entamoeba dispar from stool and culture samples obtained from polish
citizens infected in tropica and in Poland. Acta Protozool. 39:217–224.
National Committee for Clinical Laboratory Standards. 1997. Procedures
for the recovery and identification of parasites from the intestinal tract.
Approved guideline M28-A. National Committee for Clinical Laboratory
Standards, Wayne, PA.
Newton-Sanchez, O. A., K. Sturm-Ramirez, J. L. Romero-Zamora, J. I.
Santos-Preciado, and J. Samuelson. 1997. High rate of occult infection with
Entamoeba histolytica among non-dysenteric Mexican children. Arch. Med.
Res. 28:311–313.
Nozaki, T., S. R. Motta, T. Takeuchi, S. Kobayashi, and P. G. Sargeaunt.
1989. Pathogenic zymodemes of Entamoeba histolytica in Japanese male
homosexual population. Trans. R. Soc. Trop. Med. Hyg. 83:525.
Nunez, Y. O., M. A. Fernandez, D. Torres-Nunez, J. A. Silva, I. Montano,
J. L. Maestre, and L. Fonte. 2001. Multiplex polymerase chain reaction
amplification and differentiation of Entamoeba histolytica and Entamoeba
dispar DNA from stool samples. Am. J. Trop. Med. Hyg. 64:293–297.
Oh, M. D., K. Lee, E. Kim, S. Lee, N. Kim, H. Choi, M. H. Choi, J. Y. Chai,
and K. Choe. 2000. Amoebic liver abscess in HIV-infected patients. AIDS
18:1872–1873.
Ohnishi, K., Y. Kato, A. Imamura, M. Fukayama, T. Tsunoda, Y. Sakaue,
M. Sakamoto, and H. Sagara. 2004. Present characteristics of symptomatic
Entamoeba histolytica infection in the big cities of Japan. Epidemiol. Infect.
132:57–60.
Ohnishi, K., M. Murata, and E. Okuzawa. 1994. Symptomatic amebic
colitis in a Japanese homosexual AIDS patient. Intern. Med. 33:120–122.
Ohnishi, K., and M. Murata. 1997. Present characteristics of symptomatic
amebiasis due to Entamoeba histolytica in the east-southeast area of Tokyo.
Epidemiol. Infect. 119:363–367.
Ong, S. J., M. Y. Cheng, K. H. Liu, and C. B. Horng. 1996. Use of the
ProSpecT microplate enzyme immunoassay for the detection of pathogenic
and non-pathogenic Entamoeba histolytica in faecal specimens. Trans. R.
Soc. Trop. Med. Hyg. 90:248–249.
Paglia, M. G., and P. Visca. 2004. An improved PCR-based method for
detection and differentiation of Entamoeba histolytica and Entamoeba dispar in formalin-fixed stools. Acta Trop. 92:273–277.
Parija, S. C., and K. Khairnar. 2005. Entamoeba moshkovskii and Entamoeba dispar-associated infections in Pondicherry, India. J. Health Pop.
Nutr. 23:292–295.
Patterson, M., and L. E. Schoppe. 1982. The presentation of amoebiasis.
Med. Clin. N. Am. 66:689–705.
Petri, W.A., Jr., and U. Singh. 1999. Diagnosis and management of amebiasis Clin. Infect. Dis. 29:1117–1125.
Pillai, D. R., and K. C. Kain. 1999. Immunochromatographic strip-based
detection of Entamoeba histolytica-E. dispar and Giardia lamblia coproantigen. J. Clin. Microbiol. 37:3017–3019.
Pillai, D. R., J. S. Keystone, D. C. Sheppard, J. D. MacLean, D. W.
MacPherson, and K. C. Kain. 1999. Entamoeba histolytica and Entamoeba
dispar: epidemiology and comparison of diagnostic methods in a setting of
non endemicity. Clin. Infect. Dis. 29:1315–1318.
Pinheiro, S. M., R. M. Carneiro, I. S. Aca, J. I. Irmao, M. A. Morais, Jr.,
M. R. Coimbra, and L. B. Carvalho, Jr. 2004. Determination of the prevalence of Entamoeba histolytica and E. dispar in the Pernambuco state of
northeastern Brazil by a polymerase chain reaction. Am. J. Trop. Med. Hyg.
70:221–224.
Pinheiro, S. M., R. F. Maciel, M. A. Morais, Jr., I. S. Aca, L. B. Carvalho,
Jr., and M. R. Coimbra. 2005. Genetic characterization of Entamoeba
dispar isolates in Northeast Brazil. Acta Trop. 94:35–40.
Proctor, E. M. 1991. Laboratory diagnosis of amebiasis. Clin. Lab. Med.
11:829–859.
Que, X., and S. L. Reed. 1991. Nucleotide sequence of a small subunit
ribosomal RNA (16S-like rRNA) gene from Entamoeba histolytica: differentiation of pathogenic from non-pathogenic isolates. Nucleic Acids Res.
11:5438.
Qvarnstrom, Y., C. James, M. Xayavong, B. P Holloway, G. S. Visvesvara,
R. Sriram, and A. J. Da Silva. 2005. Comparison of real-time PCR proto-
CLIN. MICROBIOL. REV.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
162.
cols for differential laboratory diagnosis of amebiasis. J. Clin. Microbiol.
43:5491–5497.
Ramos, F., G. Garcia, A. Valadez, P. Moran, E. Gonzalez, A. Gomez, E. I.
Melendro, O. Valenzuela, and C. Ximenez. 2005. E. dispar strain: analysis of
polymorphism as a tool for study of geographic distribution. Mol. Biochem.
Parasitol. 141:175–177.
Ramos. F., P. Moran, E. Gonzalez, G. Garcia, M. Ramiro, A. Gomez, C. de
Leon Mdel, E. I. Melendro, A. Valadez, and C. Ximenez. 2005. Entamoeba
histolytica and Entamoeba dispar: prevalence infection in a rural Mexican
community. Exp. Parasitol. 110:327–330.
Ramos, F., E. Valdez, P. Moran, E. Gonzalez, G. Padilla, A. Gomez, M.
Ramiro, E. I. Melendro, O. Munoz, C. G. Clark, and C. Ximenez. 2000.
Prevalence of Entamoeba histolytica and Entamoeba dispar in a highly endemic rural population. Arch. Med. Res. 31(Suppl.):34–35.
Ramos, F., R. Zurabian, P. Moran, M. Ramiro, A. Gomez, C. G. Clark, E. I.
Melendro, G. Garcia, and C. Ximenez. 1999. The effect of formalin fixation
on the polymerase chain reaction characterization of Entamoeba histolytica.
Trans. R. Soc. Trop. Med. Hyg. 93:335–336.
Randall, G. R., R. S. Goldsmith, J. Shek, S. Mehalko, and D. Heyneman.
1984. Use of the enzyme-linked immunosorbent assay (ELISA) for detection of Entamoeba histolytica antigen in faecal samples. Trans. R. Soc. Trop.
Med. Hyg. 78:593–595.
Ravdin, J. I., T. F. Jackson, W. A. Petri, Jr., C. F. Murphy, B. L. Ungar, V.
Gathiram, J. Skilogiannis, and A. E. Simjee. 1990. Association of serum
antibodies to adherence lectin with invasive amebiasis and asymptomatic
infection with pathogenic Entamoeba histolytica. J. Infect. Dis. 162:768–772.
Rivera, W. L., S. R. Santos, and H. Kanbara. 2006. Prevalence and genetic
diversity of Entamoeba histolytica in an institution for the mentally retarded
in the Philippines. Parasitol. Res. 98:106–110.
Rivera, W. L., H. Tachibana, and H. Kanbara. 1998. Field study on the
distribution of Entamoeba histolytica and Entamoeba dispar in the northern
Philippines as detected by the polymerase chain reaction. Am. J. Trop.
Med. Hyg. 59:916–921.
Rivera, W. L., H. Tachibana, M. R. Silva-Tahat, H. Uemura, and H. Kanbara.
1996. Differentiation of Entamoeba histolytica and E. dispar DNA from cysts
present in stool specimens by polymerase chain reaction: its field application in
the Philippines. Parasitol. Res. 82:585–589.
Robert, R., C. Mahaza, C. Bernard, C. Buffard, and J. M. Senet. 1990.
Evaluation of a new bicolored latex agglutination test for immunological
diagnosis of hepatic amoebiasis. J. Clin. Microbiol. 28:1422–1424.
Robinson, G. L. 1968. The laboratory diagnosis of human parasitic amoebae. Trans. R. Soc. Trop. Med. Hyg. 62:285–294.
Romero, J. L., S. Descoteaux, S. Reed, E. Orozco, J. Santos, and J. Samuelson.
1992. Use of polymerase chain reaction and nonradioactive DNA probes to
diagnose Entamoeba histolytica in clinical samples. Arch. Med. Res. 23:277–
279.
Rosenblatt, J. E., L. M. Sloan, and J. E Bestrom. 1995. Evaluation of an
enzyme-linked immunoassay for the detection in serum of antibodies to
Entamoeba histolytica. Diagn. Microbiol. Infect. Dis. 22:275–278.
Roy, S., M. Kabir, D. Mondal, I. K. Ali, W. A. Petri, Jr., and R. Haque. 2005.
Real-time-PCR assay for diagnosis of Entamoeba histolytica infection. Clin.
Microbiol. 43:2168–2172.
Rustgi, A. K., and J. M. Richter. 1989. Pyogenic and amebic liver abscess.
Med. Clin. N. Am. 73:847–858.
Saklatvala, T. 1993. Milestones in parasitology. Parasitol. Today 9:347–348.
Sanchez-Giillen, M. C., M. Velazquez-Rojas, H Salgado-Rosas, E. TorresRasgado, R. Perez Fuentes, J. Martinez-Munguia, and P. TalamasRohana. 2000. Seroprevalence of anti-Entamoeba histolytica antibodies by
IHA and ELISA assay in blood donors from Puebla, Mexico. Arch. Med.
Res. 31:S53–S54.
Sanuki, J., T. Asai, E. Okuzawa, S. Kobayashi, and T. Takeuchi. 1997.
Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction. Parasitol. Res. 83:96–98.
Sargeaunt, P. G., J. E. Williams, and J. D. Grene. 1978. The differentiation
of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis Trans. R. Soc. Trop. Med. Hyg. 72:519–521.
Sargeaunt, P. G., T. F. Jackson, S. Wiffen, R. Bhojnani, J. E. Williams, D.
Felmingham, D. Goldmeir, E. Allason-Jones, A. Mindel, and E. Phillips.
1987. The reliability of Entamoeba histolytica zymodemes in clinical laboratory diagnosis. Arch. Investig. Med. 18:69–75.
Scaglia, M., S. Gatti, M. Strosselli, V. Grazioli, and M. R. Villa. 1983.
Entamoeba moshkovskii (Tshalaia, 1941): morpho-biological characterization of new strains isolated from the environment, and a review of the
literature. Ann. Parasitol. Hum. Comp. 58:413–422.
Schuurman, T., A. van Breda, R. de Boer, M. Kooistra-Smid, M. Beld, P.
Savelkoul, and R. Boom. 2005. Reduced PCR sensitivity due to impaired
DNA recovery with the MagNA Pure LC total nucleic acid isolation kit.
J. Clin. Microbiol. 43:4616–4622.
Sehgal, D., V. Mittal, S. Ramachandran, S. K. Dhar, A. Bhattacharya, and
S. Bhattacharya. 1994. Nucleotide sequence organisation and analysis of
the nuclear ribosomal DNA circle of the protozoan parasite Entamoeba
histolytica. Mol. Biochem. Parasitol. 67:205–214.
VOL. 20, 2007
LABORATORY DIAGNOSTIC TECHNIQUES FOR ENTAMOEBA SPECIES
163. Sehgal, R., M. Abd-Alla, A. H. Moody, P. L. Chiodini, and J. P. Ackers.
1995. Comparison of two media for the isolation and short-term culture of
Entamoeba histolytica and E. dispar. Trans. R. Soc. Trop. Med. Hyg. 89:394.
164. Shah, P. H., R. C. MacFarlane, D. Bhattacharya, J. C. Matese, J. Demeter,
S. E. Stroup, and U. Singh. 2005. Comparative genomic hybridizations of
Entamoeba strains reveal unique genetic fingerprints that correlate with
virulence. Eukaryot. Cell 4:504–515.
165. Shamsuzzaman, S. M., R. Haque, S. K. Hasin, and Y. Hashiguchi. 2000.
Evaluation of indirect fluorescent antibody test and enzyme-linked immunosorbent assay for diagnosis of hepatic amebiasis in Bangladesh. J. Parasitol. 86:611–615.
166. Shandera, W. X., P. Bollam, R. H. Hashmey, Jr., P. A. Athey, S. B. Greenberg, and A. C. White, Jr. 1998. Hepatic amebiasis among patients in a
public teaching hospital. South Med. J. 91:829–837.
167. Sharp, S. E., C. A. Suarez, Y. Duran, and R. J. Poppiti. 2001. Evaluation of
the Triage Micro Parasite Panel for detection of Giardia lamblia, Entamoeba histolytica/Entamoeba dispar, and Cryptosporidium parvum in
patient stool specimens. J. Clin. Microbiol. 39:332–334.
168. Sheehan, D. J., E. J. Bottone, K. Pavletich, and M. C. Heath. 1979. Entamoeba histolytica: efficacy of microscopic, cultural, and serological techniques for laboratory diagnosis. J. Clin. Microbiol. 10:128–133.
169. Shenai, B. R., B. L. Komalam, A. S. Arvind, P. R. Krishnaswamy, and P. V.
Rao. 1996. Recombinant antigen-based avidin-biotin microtiter enzymelinked imunosorbent assay for serodiagnosis of invasive amebiasis. J. Clin.
Microbiol. 34:828–833.
170. Simonishvili S., S. Tsanava, K. Sanadze, R. Chlikadze, A. Miskalishvili, N.
Lomkatsi, P. Imnadze, W. A. Petri, Jr., and N. Trapaidze. 2005. Entamoeba
histolytica: the serine-rich gene polymorphism-based genetic variability of
clinical isolates from Georgia. Exp. Parasitol. 110:313–317.
171. Solaymani-Mohammadi, S., M. Rezaian, Z. Babaei, A. Rajabpour, A. R.
Meamar, A. A. Pourbabai, and W. A. Petri, Jr. 2006. Comparison of a stool
antigen detection kit and PCR for diagnosis of Entamoeba histolytica and
Entamoeba dispar infections in asymptomatic cyst passers in Iran. J. Clin.
Microbiol. 44:2258–2261.
172. Solaymani-Mohammadi, S., M. M. Lam, J. R. Zunt, and W. A. Petri, Jr.
2007. Entamoeba histolytica encephalitis diagnosed by PCR of cerebrospinal
fluid. Trans. R. Soc. Trop. Med. Hyg. 101:311–313.
173. Stanley, S. L., Jr. 2003. Amoebiasis. Lancet. 361:1025–1034.
174. Stanley, S. L., Jr., A. Becker, C. Kunz-Jenkins, L. Foster, and E. Li. 1990.
Cloning and expression of a membrane antigen of Entamoeba histolytica
possessing multiple tandem repeats. Proc. Natl. Acad. Sci. USA 87:4976–
4980.
175. Stark, D., R. Fotedar, J. T. Ellis, and J. L. Harkness. 2006. Locally acquired
infection with Entamoeba histolytica in men who have sex with men in
Australia. Med. J. Aust. 185:417.
176. Stark, D., R. Fotedar, S. van Hal, B. Nigel., M. Deborah, J. Ellis, and J. L.
Harkness. 2007. Prevalence of enteric protozoa in HIV-positive and HIVnegative men who have sex with men from Sydney. Am. J. Trop. Med. Hyg.
76:549–552.
177. Stauffer, W., and J. I. Ravdin. 2003. Entamoeba histolytica: an update. Curr.
Opin. Infect. 16:479–485.
178. Strachan, W. D., P. L. Chiodini, W. M. Spice, A. H. Moody, and J. P.
Ackers. 1988. Immunological differentiation of pathogenic and nonpathogenic isolates of E. histolytica. Lancet i:561–563.
179. Tachibana, H., X. J. Cheng, S. Kobayashi, N. Matsubayashi, S. Gotoh, and
K. Matsubayashi. 2001. High prevalence of infection with Entamoeba dispar, but not E. histolytica, in captive macaques. Parasitol. Res. 87:14–17.
180. Tachibana, H., S. Ihara, S. Kobayashi, Y. Kaneda, T. Takeuchi, and Y.
Watanabe. 1991. Differences in genomic DNA sequences between pathogenic and nonpathogenic isolates of Entamoeba histolytica identified by
polymerase chain reaction. J. Clin. Microbiol. 29:2234–2239.
181. Tachibana, H., S. Kobayashi, K. Nagakura, Y. Kaneda, and T. Takeuchi.
2000. Asymptomatic cyst passers of Entamoeba histolytica but not Entamoeba dispar in institutions for the mentally retarded in Japan. Parasitol.
Int. 49:31–35.
182. Tachibana, H., S. Kobayashi, E. Okuzawa, and G. Masuda. 1992. Detection
of pathogenic Entamoeba histolytica DNA in liver abscess fluid by polymerase chain reaction. Int. J. Parasitol. 22:1193–1196.
183. Tachibana, H., S. Kobayashi, M. Takekoshi, and S. Ihara. 1991. Distinguishing pathogenic isolates of Entamoeba histolytica by polymerase chain
reaction. J. Infect. Dis. 164:825–826.
184. Takahashi, T., A. Gamboa-Dominguez, T. J. Gomez-Mendex, J. M. Remes,
D. Martinez-Gonzalez, J. Gutierrez-Saldivar, J. C. Morales, J. Granados,
and J. Sierra-Madero. 1997. Fulminant amebic colitis: analysis of 55 cases.
Dis. Colon Rectum 40:1362–1367.
185. Takeuchi, T., E. Okuzawa, T. Nozaki, S. Kobayashi, M. Mizokami, N.
Minoshima, M. Yamamoto, and S. Isomura. 1989. High seropositivity of
Japanese homosexual men for amebic infection. J. Infect. Dis. 159:808.
186. Takeuchi, T., S. Kobayashi, K. Asami, and N. Yamaguchi. 1987. Correlation of positive syphilis serology with invasive amebiasis in Japan. Am. J.
Trop. Med. Hyg. 36:321–324.
531
187. Tannich, E., and G. D. Burchard. 1991. Differentiation of pathogenic from
nonpathogenic Entamoeba histolytica by restriction fragment analysis of a
single gene amplified in vitro. J. Clin. Microbiol. 29:250–255.
188. Tanyuksel, M., and W. A. Petri, Jr. 2003. Laboratory diagnosis of amebiasis.
Clin. Microbiol. Rev. 16:713–729.
189. Tanyuksel, M., M. Ulukanligil, Z. Guclu, E. Araz, O. Koru, and W. A. Petri,
Jr. 2007. Two cases of rarely recognized infection with Entamoeba moshkovskii. Am. J. Trop. Med. Hyg. 76:723–724.
190. Thompson, J. E., Jr., S. Forlenza, and R. Verma. 1985. Amebic liver abscess: a therapeutic approach. Rev. Infect. Dis. 7:171–179.
191. Trissl, D., A. Martinez-Palomo, M. de la Torre, R. de la Hoz, and E. Perez
de Suarez. 1978. Surface properties of Entamoeba: increased rates of human erythrocyte phagocytosis in pathogenic strains. J. Exp. Med. 148:1137–
1143.
192. Troll, H., H. Marti, and N. Weiss. 1997. Simple differential detection of
Entamoeba histolytica and Entamoeba dispar in fresh stool specimens by
sodium acetate-acetic acid-formalin concentration and PCR. J. Clin. Microbiol. 35:1701–1705.
193. Tshalaia, L. E. 1941. On a species of Entamoeba detected in sewage effluents. Med. Parazit. (Moscow) 10:244–252.
194. Van Doorn, H. R., H. Hofwegen, R. Koelewijn, H. Gilis, R. Peek, J. C.
Wetsteyn, P. J. Van Genderen, T. Vervoort, and T. Van Gool. 2005. Use of
rapid dipstick and latex agglutination tests and enzyme-linked immunosorbent assay for serodiagnosis of amebic liver abscess, amebic colitis, and
Entamoeba histolytica cyst passage. J. Clin. Microbiol. 43:4801–4806.
195. Verweij, J. J., R. A. Blange, K. Templeton, J. Schinkel, E. A. Brienen, M. A.
Van Rooyen, L. Van Lieshout, and A. M. Polderman. 2004. Simultaneous
detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium
parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 42:1220–1223.
196. Verweij, J. J., J. Blotkamp, E. A. Brienen, A. Aguirre, and A. M. Polderman.
2000. Differentiation of Entamoeba histolytica and Entamoeba dispar cysts
using polymerase chain reaction on DNA isolated from faeces with spin
columns. Eur. J. Clin. Microbiol. Infect. Dis. 19:358–361.
197. Verweij, J. J., D. Laeijendecker, E. A. Brienen, L. Van Lieshout, and A. M.
Polderman. 2003. Detection and identification of Entamoeba species in
stool samples by a reverse line hybridization assay. J. Clin. Microbiol.
41:5041–5045.
198. Verweij, J. J., F. Oostvogel, E. A. Brienen, A. Nang-Beifubah, J. Ziem, and
A. M. Polderman. 2003. Prevalence of Entamoeba histolytica and Entamoeba dispar in northern Ghana. Trop. Med. Int. Health 8:1153–1156.
199. Verweij, J. J., L. Van Lieshout, C. Blotkamp, E. A. Brienen, S. Van
Duivenvoorden, M. Van Esbroeck, and A. M. Polderman. 2000. Differentiation of Entamoeba histolytica and Entamoeba dispar using PCR-SHELA
and comparison of antibody response. Arch. Med. Res. 31:44–46.
200. Verweij, J. J., J. Vermeer, E. A. Brienen, C. Blotkamp, D. Laeijendecker, L.
Van Lieshout, and A. M. Polderman. 2003. Entamoeba histolytica infections in captive primates. Parasitol. Res. 90:100–103.
201. Visser, L. G., J. J. Verweij, M. Van Esbroeck, W. M. Edeling, J. Clerinx, and
A. M. Polderman. 2006 Diagnostic methods for differentiation of Entamoeba histolytica and Entamoeba dispar in carriers: performance and clinical implications in a non-endemic setting. Int. J. Med. Microbiol. 296:397–
403.
202. Vohra, H., H. S. Bhatti, N. K. Ganguly, and R. C. Mahajan. 1989. Virulence
of pathogenic and non-pathogenic zymodemes of Entamoeba histolytica
(Indian strains) in guinea pigs. Trans. R. Soc. Trop. Med. Hyg. 83:648–650.
203. Walsh, J. A. 1986. Problems in recognition and diagnosis of amebiasis:
estimation of the global magnitude of morbidity and mortality. Rev. Infect.
Dis. 8:228–238.
204. Wang, L. T., G. Jen, and J. H. Cross. 1973. Establishment of Entamoeba
histolytica from liver abscess in monoxenic cultures with hemoflagellates.
Am. J. Trop. Med. Hyg. 22:30–32.
205. Wang, Z., G. J. Vora, and D. A. Stenger. 2004. Detection and genotyping of
Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray. J. Clin. Microbiol. 42:3262–
3271.
206. Ward L. A., and Y. Wang. 2001. Rapid methods to isolate Cryptosporidium
DNA from frozen feces for PCR. Diagn. Microbiol. Infect. Dis. 41:37–42.
207. Weinke, T., B. Friedrich-Janicke, P. Hopp, and K. Janitschke. 1990. Prevalence and clinical importance of Entamoeba histolytica in two high-risk
groups: travelers returning from the tropics and male homosexuals. J. Infect. Dis. 161:1029–1031.
208. Wolk, D. M., S. K. Schneider, N. L. Wengenack, L. M. Sloan, and J. E.
Rosenblatt. 2002. Real-time PCR method for detection of Encephalitozoon
intestinalis from stool specimens. J. Clin. Microbiol. 40:3922–3928.
209. Wonsit, R., N. Thammapalerd, S. Tharavanij, P. Radomyos, and D. Bunnag.
1992. Enzyme-linked immunosorbent assay based on monoclonal and polyclonal antibodies for the detection of Entamoeba histolytica antigens in faecal
specimens. Trans. R. Soc. Trop. Med. Hyg. 86:166–169.
210. World Health Organization. 1997. World Health Organization/Pan American Health Organization/UNESCO report of a consultation of experts on
532
FOTEDAR ET AL.
amoebiasis. Wkly. Epidemiol. Rec. 72:97–99.
211. Zaki, M., and C. G. Clark. 2001. Isolation and characterization of polymorphic DNA from Entamoeba histolytica. J. Clin. Microbiol. 39:897–905.
212. Zaki, M., P. Meelu, W. Sun, and C. G. Clark. 2002. Simultaneous differentiation and typing of Entamoeba histolytica and Entamoeba dispar. J. Clin.
Microbiol. 40:1271–1276.
213. Zaki, M., J. J. Verweij, and C. G. Clark. 2003. Entamoeba histolytica:
direct PCR-based typing of strains using faecal DNA. Exp. Parasitol.
104:77–80.
214. Zaman, S., J. Khoo, S. W. Ng, R. Ahmed, M. A Khan, R. Hussain, and V.
CLIN. MICROBIOL. REV.
Zaman. 2000. Direct amplification of Entamoeba histolytica DNA from
amoebic liver abscess pus using polymerase chain reaction. Parasitol. Res.
86:724–728.
215. Zengzhu, G., R. Bracha, Y. Nuchamowitz, W. Cheng, and D. Mirelman.
1999. Analysis by enzyme-linked immunosorbent assay and PCR of human
liver abscess aspirates from patients in China for Entamoeba histolytica.
J. Clin. Microbiol. 37:3034–3036.
216. Zindrou, S., E. Orozco, E. Linder, A. Tellez, and A. Bjorkman. 2001.
Specific detection of Entamoeba histolytica DNA by hemolysin gene targeted PCR. Acta Trop. 78:117–125.