Download A Single Amino Acid Can Determine the DNA Binding Specificity of

Cell, Vol. 59, 553-562,
November
3, 1969, Copyright
8 1969 by Cell Press
A Single Amino Acid Can Determine the DNA Binding
Specificity of Homeodomain Proteins
Jessica Tteisman, Pier@ G&ncxy, Malini Vashishtha,
Esther Harris, and Claude Desplan
Howard Hughes Medical Institute
The Rockefeller University
New York, New York 10021-8399
Summary
Many Drosophila developmental genes contain a DNA
binding domain encoded by the homeobox. This homeodomain contains a region distantly homologous
to the helix-turn-helix
motif present in several pmlcsryotic DNA binding proteins. We investigated the nature of homeodomain-DNA
interactions by making a
series of mutations in the helix-turn-helix motif of the
Drosophila homeodomain
protein Paired (Prd). This
protein does not recognize sequences bound by the
homeodomain
proteins Fushi taraxu (Ftz) or Bicoid
@cd). We show that changing a single amino acid at
the C-terminus of the recognition hei!x is both necessary and sufficient to confer the DNA blnding specificity of either Ftz or Bed on Prd. This simple rule
indicates that the amino acids that determine the
specificity of homeodomains are different fmm those
mediating protein-DNA
contacts in pmkaryotic proteins. We further show that Prd contains two DNA
binding activities. The Prd homeodomain is responsible for one of them while the other is not dependent
on the recognition helix.
Introduction
Embryonic development in Drosophila is controlled by a
set of regulatory genes that are expressed in a very precise temporal and spatial pattern (for reviews see Scott
and O ’Farreii, 1988; Scott and Carroll, 1987). The genetic
identification (NOssiein-Voihard and Wieschaus, 1980)
and the subsequent molecular analysis of most of these
developmental genes have led to an understanding of
their interactions. Maternal information establishes the
polarity of the embryo (Nussiein-Voihard et al., 1987)
while a hierarchy of gap, pair-rule, segment polarity, and
homeotic genes interprets this information, dividing the
embryo into repeating units and assigning identities to
them (reviewed in ingham, 1988). A molecular comparison of the products of the developmental genes has ailowed the identification of protein domains shared by several of them, raising the hypothesis that these genes have
arisen through duplication and subsequent divergence
(McGinnis et al., 1984a; Scott and Weiner, 1984; Scott and
O ’Farreii, 1988; Frigerio et al., 1988). The presence of
similar motifs in a large variety of multicellular organisms
argues for the utilization of similar developmental processes throughout evolution (McGinnis et al., 1984b;
Chowdhury et al., 1987; Deutsch et al., 1988; Dressier and
Gruss, 1988).
One of the most prevalent protein motifs among the
products of the developmental genes is the homeodomain
(McGinnis et al., 1984a; Scott and Weiner, 1984). This 80
amino acid protein domain is present in the product of the
Drosophila maternal effect gene bicoid as well as in those
of several classes of zygotic genes involved in early deveiopment and in later specification of ceil fates (for references see Scott et al., 1989). The homeodomain is also
encoded by genes expressed early in development in
other species. its sequence is highly conserved in otherwise unrelated proteins. An important characteristic of the
homeodomain is the presence in its C-terminal part of a
region similar to the helix-turn-helix motif that mediates
DNA binding by many prokaryotic proteins (Laughon and
Scott, 1984; Pabo and Sauer, 1984) supporting the idea
that many of the developmental genes encode transcriptional regulators (Garcia-Beiiido, 1975). indeed, several
homeodomain-containing
proteins have been shown to
bind specifically to DNA (Despian et al., 1985, 1988; Hoey
and Levine, 1988; Beachy et al., 1988; Driever and
Niisslein-Volhard, 1989; Miiiier et al., 1988). Recently, nuclear magnetic resonance studies have demonstrated
that the purified Antennapedia homeodomain contains
three heiices separated by turns (Otting et al., 1988). The
third of these heiices is thought to correspond to the recognition helix of the prokaryotic proteins, which forms specific hydrogen bonds and van der Waais contacts with the
base pairs of DNA (see Ptashne, 1988). In the homeodomain, the third helix extends further than the 9 amino
acids that constitute the prokaryotic recognition helix (Otting et al., 1988).
Based on sequence homologies, the homeodomains
fail into several groups that are conserved across species
(Gehring et al., 19Sr; Scott et al., 1989). Interestingly, there
is no direct correlation between the group a homeodomain belongs to and the developmental function of its
gene. We proposed a classification of the various homeodomains based on the sequences of their recognition
heiices (Desplan et al., 1988), expecting that the sequence differences in this motif would reflect differences
in DNA binding specificity and therefore in function. in the
lambda and 434 repressors, positions 1, 2, 5, and 8 form
critical contacts with the base pairs of the operator sequence (Ptashne, 1988; Wharton and Ptashne, 1985,
1987; Agganvai et al., 1988; Anderson et al., 1987). Mutational analysis of the Trp repressor, another prokaryotic
helix-turn-helix protein, has suggested that residue 3 of
the recognition helix is the most crucial for specific recognition of the operator (Bass et al., 1988). Surprisingly,
differences at these positions do not seem to affect the
DNA binding specificity of the homeodomain. For exampie, homeodomain proteins with different amino acids at
positions 2,3, and 8 (Fushi tarazu [Ftz] and Even-skipped
[Eve]; Laughon and Scott, 1984; Macdonaid et al., 1988)
nevertheless recognize the same consensus sequence
with only minor differences in specificity (Despian et al.,
1988; Hoey and Levine, 1988; C. D., unpublished data).
Cdl
554
We therefore hypothesized that the protein-DNA contacts
are different for the homeodomain proteins than for the
prokaryotic proteins that have been crystallized and genetically characterized in great detail (Ptashne, 1966;
Hochschild et al., 1966; Hochschild and Ptashne, 1966;
Anderson et al., 1967; Aggarwal et al., 1966; Jordan and
Pabo, 1966; Wolberger et al., 1966; Otwinowski et al.,
1966; Bass et al., 1966).
We carried out a systematic analysis of the roles of various amino acids of the helix-turn-helix motif in specifying
the DNA sequences bound by homeodomain proteins.
For this purpose, we changed specific amino acids in the
Paired protein (Prd; Bopp et al., 1966; Frigerio et al., 1966)
and analyzed the DNA binding specificities of the wildtype and mutant proteins produced in Escherichia coli.
The unmodified Prd protein does not recognize sequences specifically bound by the homeodomain protein
Ftz, nor those specifically bound by Bicoid (Bed; Driever
and Nirsslein-Volhard, 1969). We tested the ability of the
mutant proteins to gain binding to these two classes of sequences. From these studies we conclude that the amino
acid at position 9 of the recognition helix (as defined for
prokaryotic proteins) determines the specificity of the
homeodomain. When a glutamine occupies this position,
as in Ftz, the mutated Prd is able to bind to the Ftz sites.
When a lysine occupies this position, as in Bed (Berleth
et al., 1966) the Prd mutant recognizes the Bed sites present in the hunchback promoter (Driever and NOssleinVolhard, 1969). Prd itself has a serine at position 9 (Bopp
et al., 1966) and its homeodomain recognizes a distinct
sequence. This provides a very simple rule to explain the
overall specificity of homeodomains, which distinguishes
their mechanism of interaction with DNA from that of
A
Helix 2
REELAQRT
-I-----L
-I-----L
-I-IG--L
-IDI-NAL
Turn
Helix 3
NP6
Figure 1. Structure
Results
Changing a Single Amino Acid in the Prd
Recognition Helix Switches Its Specificity
to That of Ftz
The homeodomain proteins Ftz, Zerkniillt (Zen; Doyle et
al., 1966) and other proteins of class I and class II, as well
as the Eve protein, bind to the consensus sequence
TCAATTAAAT (NP) and to cognate sites in the engrhd
gene (Desplan et al., 1966; Hoey and Levine, 1966),
whereas Prd (class IV) does not recognize these DNA sequences (Hoey and Levine, 1966; see also Figure 2). This
difference prompted us to investigate the nature of the
specificity underlying homeodomain-DNA
interactions.
We used in vitro mutagenesis to create a series of altered Prd constructs that have redesigned helix-turn-helix
motifs borrowing residues from the Ftz homeodomain
(Figure lA, Ml through M7). We then overexpressed these
constructs in E. coli (Figure 1B) under the control of the
T7 promoter (Studier and Moffatt, 1966) and assayed the
e6
Bed
NLT
EARIQVWFS
+
-
s-s--------
-RQ-KI---RQ-KI--Q
-RQ-KI---RQ-KI--Q
- - --- -- -Q
-R--KI--Q
-RQ--I--Q
-RQDKIEAQ
+
+
+
nd
nd
nd
nd
nd
nd
nd
s-c
s-s
-RQVKI--Q
-RQ-KI--Q
+
+
+
+
+
+
+
+
+
+
+
+
(+)
-
-
+
+
nd
+
--------K
LAD-SAKL
prokaryotic DNA binding proteins. Hanes and Brent (1969)
have recently reached similar conclusions by measuring
the rate of transcriptional activation by mutants in the bicoid gene expressed in yeast.
We also report that the Prd protein possesses two DNA
binding functions. One of them is dependent on the
homeodomain and is masked by the C-terminal part of the
Prd protein, which contains the Prd repeat (Bopp et al.,
1966). Deletion of this part allows recognition of the consensus sequence TTTGACGT. Another distinct specificity
is not affected by dramatic changes in the recognition helix and is therefore not mediated by this motif.
A-G
and Expression
T-QVKI--K
of Prd Constructs
nd
Containing
Redesigned
Helix-Turn-Helix
B
kd
Motifs
(A) Mutations in the helix-turn-helix motif of Prd. The sequences of Zen, Ftz, Bed, and the various mutants are indicated. A dash indicates that the
amino acid is the same as in Prd. Binding to the class I consensus sequence (NPs). to the eve promoter site (ec), or to the hunchback promoter
&es (Bed Al, A2. and A3) is indicated. Binding of Bed to hunchbeck has been reported by Driever and Ngsslein-\lblhard (lgeg). The amino acid
changes in each mutant that alter its binding specifictty are indicated in boldface. nd, not determined.
(B) Coomassie blue-stained SDS-polyacrylamide
gel showing the crude bacterial extracts used for these experiments. Twenty micrograms of total
protein was loaded in each lane.
Specificity
555
G/A
of Homeodomains
ZSII
Prd
. ..-I
Figure 2. Binding of the Prd Mutant Proteins to the Class I Consensus
..a
..-
Sequence
DNAase I protection of the NPs sequence (Desplan et al., 1999). Approximately 2 ng of DNA was incubated without pmtein (-) or with 2, 10, or
40 ug of bacterial extracts containing the indicated proteins (increasing protein concentration is shown by arrows). DNAase I footprinting was carried
out as described in Experimental Procedures. The G/A lane shows a Maxam and Gilbert sequencing ladder identifying the purines. The six repeats
of the NP sequence are indicated by arrows showing their orientation (5’-TCAATTAAATGA-39. DNAase l-hypersensitive
sites (arrowheads) appear
between protected regions for those proteins that bind to this sequence.
mutant proteins by DNAase I footprinting for their ability
to bind to a hexameric repeat of the class l/class II consensus sequence (NPrJ. Interestingly, changing amino
acids 2, 3, 5, and 6 of the Prd recognition helix to those
of the Ftz sequence, making Prd identical to Ftz over
amino acids 1 through 6, gave only a very low affinity bind-
A
hb
Figure 3. Binding Specificity
of the Prd B9 Mutant
B
ing to the NP sequence (Figure 2, Ml), despite a normal
level of expression (Figure 16) and binding activity to an
alternate site (see below and Figure 4). When the whole
recognition helix of Prd was changed to that of Ftz, the
mutant protein now bound to NPs, suggesting a crucial
role for residue 9 of the recognition helix (Figure 2, M2).
N%
C
eve
Protein concentrations and footprint procedures were as described in Figure 2.
(A) DNAase I protection of a Bed-specific site from the hunchback (hb) promoter. The Bed Al site (CGTAATCCC; Driever and Niisslein-Volhard.
is indicated.
(B) DNAaae I protection of the NPs sequence described in Figure 2. The six repeats are indicated by arrows.
(C) DNAase I protection of the Prd-specific site from the eve promoter. es (CACGATTAGCACCGTTCCGCTC)
is indicated.
1999)
Cdl
556
G/A
Zen
--.-----4---m--_-.
Ftz
Prd
Ml
M2
M3
M4
Figure 4. Binding of the Prd Mutant Proteins to the e5 Site from the eve Promoter Described
Protein concentrations
and footprint procedures
were as described
MS
M6.---
M7
Control
in Figure 3
in Figure 2.
This was confirmed by generating a mutant protein (M5)
that had only this single amino acid (serine) changed to
the Ftz sequence (glutamine). This single change conferred binding to the NPe sequence at an affinity similar
to that of Ftz (Figure 2, M5). Further single amino acid
changes in the M2 mutant (M6 and M7) did not produce
changes in specificity. Changing amino acids at nonconserved positions of the Prd helix 2 to those present in Ftz
also had no effect on the specificity of the mutant proteins,
as can be seen by comparing Ml with M3 or M2 with M4
(Figure 2). Similar binding patterns were observed when
mutant proteins were tested for their ability to bind to the
cognate sequence in the engrailed promoter (data not
shown).
Taken together, these results show that a glutamine as
residue 9 of the recognition helix is both necessary and
sufficient to confer F&specific DNA binding on the Prd
homeodomain protein.
The Same Residue Determines the Binding
Specificity of Bicoid
To see whether these observations could be expanded to
other homeodomain proteins, we made use of the binding
specificity of the Bed protein. Bed is a homeodomain
protein that has recently been shown to bind target sequences in the hunchback promoter (Driever and Niisslein-\lollhard, 1969). These sites are not bound by Prd, by
Ftz-type homeodomain proteins, or by the Prd mutant M5,
which has a glutamine at position 9 (Figure 3A). The Bed
homeodomain is quite divergent from that of Ftz and has
a lysine as residue 9 of the recognition helix (Figure 1A;
Frigerio et al., 1966). According to the data presented
above, changing residue 9 of Prd into that present in Bed
(serine to lysine) should be sufficient to allow binding of
this mutant protein to the sites in the hunchback promoter.
As shown in Figure 3A (mutant B9), this is indeed the
case. The 89 protein does not bind to the NP sequence
(Figure 36); thus two different substitutions at position 9
confer two different binding specificities on the Prd pro-
tein. We can therefore generalize that this single amino
acid is critical in determining the specificity of homeodomain proteins.
Another DNA Binding Activity Resides outside
the Prd Recognition Helix
As shown in Figure 18, the mutant proteins were all produced in E. coli at similar levels. In addition, all proteins
were active in DNA binding as judged by the footprint patterns shown in Figures 3C and 4. Prd binds specifically to
a DNA sequence (CACGATTAGCACCGTTCCGCTC)
in
the eve promoter, overlapping a site named e5 that is
bound by the Eve protein (Hoey and Levine, 1966). This
sequence is distinct from the NP sequence, to which Eve
also binds. We utilized the binding to the e5 site as a control for the DNA binding activity of our mutant proteins. Prd
itself as well as all the mutant proteins retained their ability
to bind to the e5 sequence (Figures 3C and 4). Ftz bound
only weakly to the es sequence, while the footprint pattern of Zen differed from those of Prd and its derivatives
(Figure 4).
The observation that mutants with specificities switched
to those of Ftz or Bed still retained their ability to bind to
the e5 site was puzzling in the light of the above model.
One would have expected only those mutant proteins retaining the Prd-type residue 9 (serine) in the recognition
helix to bind specifically to this sequence. However, this
is not the case, suggesting that the binding of Prd to the
e5 site is not directed by residue 9 of the recognition helix. We therefore tried to assess whether the recognition
helix of Prd was mediating binding to the eve promoter. For
this purpose, we engineered a construct with a recognition helix dramatically changed at three positions of helix
3 (isoleucine to aspartic acid at position 4, tryptophan to
glutamic acid at position 7, and phenylalanine to alanine
at position 6) (Figure lA, MP-IWF). These three positions are absolutely conserved in all homeodomains, and
changing them is expected to make this helix inactive as
a DNA binding domain. In particular, isoleucine at posi-
Specificity
557
of Homeodomains
eve
G
7
A --
M2
Figure 5. Destruction
MP-IWF
of the Recognition
control
G
“A-------
M2
MLNVF
control
Helix of M2
DNAase I protection of (A) the NPs -containing fragment described in Figure 2 and (6) the e5 -containing
in Figure 3. Protein concentrations and footprint procedures were as described in Figure 2.
tion 4 is homologous to a residue that contacts helix 2
in the prokaryotic proteins, providing structural stability
(Ptashne, 1988). We made these changes in the Prd mutant M2, which recognizes both the NPs and the e5 sequences (Figures lA, 2, and 4). As shown in Figure 5A,
binding to NPB is indeed destroyed, but binding to the e5
sequence is not affected by these changes (Figure 58).
This implies that some part of Prd outside the helix-turnhelix is able to bind to e5. We are currently further refining the location of this novel DNA binding region.
The Prd Homeodomain Contains a DNA Binding
Specificity Masked by the GTerminal Region
of the Molecule
We could make a Prd protein that binds to Ftz and not to
Bed sites by making one substitution at residue 9 (M5, Figure 2) and another protein that binds to Bed and not to
Ftz sites by placing a different amino acid at this position
(B9, Figure 3). VW initially were unable to define a specificity for Prd itself that was dependent on the presence of a
serine at position 9. However, by using a truncated version
of the Prd protein that lacks the C-terminal region (PrdA;
see Experimental Procedures for details), we were able to
define a sequence specifically recognized by the Prd
homeodomain. We used PrdA to search a complex DNA
fragment from the eve promoter described
mixture (the 50 kb lambda genome) which should by
chance contain sequences approaching those actually
recognized by the Prd protein in vivo (Ross and Landy,
1982; Desplan et al., 1985; Biedenkapp et al., 1988). We
also searched the engrai/ed promoter, which is expected
to contain Prd binding sites.
To identify fragments containing binding sites for the
PrdA protein, we used a precipitation assay based on our
observation that most proteins overproduced in E. coli are
partially insoluble but are still able to bind to DNA (Treisman and Despfan, 1989). We then used the protein extract
to footprint the binding sites present in the precipitated
fragments. From these sequences, we derived the Prd
consensus sequence TTTGACGT. A cloned synthetic oligonucleotide containing three Prd consensus sequences
(Prd3) exhibited a strong footprint with PrdA and not with
Ftz, the M5 mutant (Figure 8A), or the full-length Prd protein. We therefore concluded that the Prd homeodomain
was able to specify binding to the Prd3 sequence but that
this activity was masked by the C-terminal part of the molecule (Figure 8A).
To demonstrate further that the Prd homeodomain was
responsible for the binding to the Prd3 sequence, we
swapped the homeodomains of Prd and M5 into the Ftz
protein (Ftz/PrdHD and Ftz/M5HD, respectively). Ftz/
Cdl
558
Prd 3
A
Ftr
G
/n-.-----t
Prd
--
M5
-
Figure 6. Binding of Prd Derivatives
-
Prd A
control
-_c
=/a
-
Ftz
MSHD
-
Ftz
PrdHD
-
-
Ftz
M5HD
------
Ftz
PrdHD
Prd II
to the Prd 3 Sequence
(A) DNAase I protection of three copies of the Prd-specific sequence. Three repeats of the Prd consensus sequence TTTGACGT are indicated by
arrows. PrdA has a deletion of the C-terminal part of the Prd protein. The FWM5HD and Ftz/PrdHD proteins contain the M5 or Prd homeodomain,
respectively, inserted in place of the Ftz homeodomain.
(6) DNAase I protection of the NPs sequence described in Figure 2. The protein concentrations were 10 and 40 ug.
Footprint procedures were as described in Figure 2
PrdHD was able to bind to the Prd3 sequence while
Ftz/M5HD was not (Figure 8A). The failure of Ftz/M5HD
to bind to the Prd3 sequence demonstrates that this specificity is dependent on the serine at postion 9 of the recognition helix. Furthermore, unlike the case of Prd, the context of the Ftz protein was not able to inhibit the function
of the Prd homeodomain. We also tested the ability of
these proteins to bind to NPG. FtzIM5HD bound to NPs
with a much higher affinity than Ftz/PrdHD (Figure 66)
indicating that the specificity was indeed due to the recognition helix. However, both PrdA and FtzlPrdHD were able
to bind weakly to the NPB sequence (Figure 6B), showing
that the Prd homeodomain has a low affinity for the class
I sequence.
Discussion
We have analyzed the DNA binding specificity of the
homeodomain as part of our effort to understand its function in Drosophila developmental genes. Our approach
was guided by the large body of work with the analogous
helix-turn-helix motif present in prokaryotic DNA binding
proteins. According to the current model based on the
crystal structures of the lambda and 434 repressors and
of the 434 Cro protein, as well as on molecular and genetic
data (Ptashne, 1986; Anderson et al., 1987; Wharton and
Ptashne, 1985, 1987; Wolberger et al., 1988; Aggarwal et
al., 1988), the N-terminal part of the recognition helix (helix 3) fits into the major groove of DNA and the amino acids
on one face of this helix establish hydrogen bonds and
van der Waals contacts with the base pairs. The specificity-determining residues occupy positions 1 and 2 in the
first turn of the recognition helix and positions 5 and 6 in
the second turn. In the lambda and 434 repressors, the
amino acid at position 9 (asparagine) participates only
nonspecifically in the binding by interacting with the DNA
backbone at positions that also contact the glutamines at
the beginning of both helices 2 and 3 (Aggarwal et al.,
1988; S. C. Harrison, personal communication).
The Amino Acid at Position 9 of the Recognition
Helix Is Essential for Specificity
The homeodomain was initially expected to bind to DNA
in a conformation similar to that described for prokaryotic
proteins. Indeed, homeodomains of class I, which have
identical recognition helices, recognize the same sequence (Desplan et al., 1988; Hoey and Levine, 1988),
consistent with the idea that the helix-turn-helix is important in generating their specificity. Homeodomain proteins
from more divergent classes, such as Prd (class IV), do
not bind to this sequence (Hoey and Levine, 1988; Figure
2). Alternative consensus sequences have been determined for Bed (TCXAATCCC; Driever and Niisslein-Volhard, 1989) and for the POU homeodomain proteins (e.g.,
Specificity of Homeodomains
559
octamer sequence ATGCAAAT for Ott-l/OTF-1) (Clerc et
al., 1988; Herr et al., 1988; Ko et al., 1988; Scheidereit et
al., 1988; Sturm et al., 1988). It has also been reported that
class I proteins are able to bind to repeats of the trinucleotide TAA and to activate transcription of genes linked to
this sequence (Beachy et al., 1988; Krasnow et al., 1989;
Winslow et al., 1989).
The results we have presented here demonstrate that
the specificity of a homeodomain is critically dependent
on the nature of the amino acid at position 9 of its recognition helix and that the protein-DNA contacts are therefore
different from those of the prokaryotic proteins. If amino
acid 9 is a glutamine (as in Ftz, Zen, and the M2, M4, M5,
M8, and M7 mutants), the homeodomain will bind to the
NP sequence (Figure 2). Another example of a protein
with a glutamine at position 9 is the Xenopus protein Mix,
which has a homeobox otherwise homologous to Prd
(Rosa, 1989). This protein also binds to the NP sequence
(J. T., unpublished data). When a lysine occupies position
9 (as in Bed or the B9 mutant), the protein will recognize
the Bed sites (Figure 3A). In addition, the product of the
cut gene (Blochlinger et al., 1988) which has a histidine
at this position, does not bind to the NP sequence (J. T.,
unpublished data). Helix 2 does not play a significant role
in the specificity and probably has only a structural role,
as in most prokaryotic proteins. An extensive swap of the
recognition helix or of the entire helix-turn-helix between
Prd and Ftz (excluding position 9) results only in weak
binding of the mutants Ml and M3 to NP6, with an affinity
at least 2CMold lower than when position 9 is a glutamine.
This shows that the other amino acids of the helix-turnhelix may also exert some weak influence on the specificity of the homeodomain. This is not surprising, since it is
unlikely that a single amino acid interacts with all the base
pairs of a 9-10 bp consensus sequence.
The POU homeodomain proteins are very divergent
and appear to require regions outside the homeodomain
to bind to DNA (Herr et al., 1988). All POU homeodomains
have a cysteine at position 9 (He et al., 1989), but replacement of the Prd recognition helix with that of OCT-2/OrF-2,
including a cysteine at position 9, did not allow recognition
of the octamer sequence from the histone H2b promoter
(J. T, unpublished data). Therefore, the specificity determinant of the POU homeodomains does not reside entirely in residue 9 of the recognition helix.
It seems that the recognition helix of the homeodomain
does not interact with the major groove of DNA in the
same way as the lambda or 434 repressor. The region just
C-terminal to position 9, which is the most highly conserved part of the homeodomain, contains a stretch of 4
or 5 lysines or arginines. This region forms a helical
C-terminal extension of the recognition helix (Otting et al.,
1988). It is possible that this very basic region can interact
closely with the phosphates on the DNA backbone, tilting
the recognition helix to bring the amino acid at position 9
closer to the major groove than in the 434 repressor.
The importance of amino acid 9 of the recognition helix
has also recently been reported by Hanes and Brent
(1989) from their analysis in yeast of transcriptional activation by the products of IexA-bed fusion genes carrying
mutations in the recognition helix. Our independent observations with Prd, Ftz, and Bed generalize the rule and
demonstrate that the results can be attributed directly to
DNA binding and not to interactions with the transcriptional machinery. Together, the two sets of results support
the model that amino acid 9 of the recognition helix is the
major determinant of the specificity of the bona fide
homeodomain proteins.
Prd Has a Novel DNA Binding Function
We have shown that two different specificities can be
created in the Prd homeodomain by substituting two
different amino acids at position 9 of its recognition helix.
We have also shown that the Prd homeodomain itself,
which contains a serine at this position, is capable of binding to a third sequence, TTTGACGT. However, its binding
appears to be masked by the C-terminal part of the Prd
protein, which contains the so-called Prd repeat (Bopp et
al., 1988). A similar effect has been described for the glucocorticoid receptor, which becomes a constitutive DNA
binding protein when the C-terminal steroid binding domain is deleted (Godowski et al., 1987; Picard et al., 1988).
We should note that the C-terminal part of Prd does not
affect the binding of the Prd mutants M2 and M5 to the NP
sites or of B9 to the Bed sites. Deletion of the Prd repeat
region also allows the Prd protein to bind with low affinity
to the NP sites, indicating that there is some crossreactivity between the various classes of homeodomain
proteins. Similarly, Han et al. (1989) have shown that Prd
can activate transcription of a promoter containing sites
closely related to the NP sequence. It has also been
reported that the homeodomain proteins Ultrabithorax
and Abdominal-B are able to weakly activate transcription
from a promoter containing octamer sequences, which
are normally recognized by the POU homeodomain protein OTF-2 (Thali et al., 1988). Our results suggest that a
serine at position 9 makes Prd more susceptible to interactions with the rest of the protein than glutamine or lysine
at this position.
The data presented here also show that Prd binding to
the e5 site is not mediated by the helix-turn-helix motif.
The evidence is that substitutions in the Prd helix-turnhelix motif that created a new specificity did not affect the
ability of the mutant proteins to bind to a sequence in the
evB promoter (Figure 4). More dramatically, replacing the
three most conserved amino acids in the recognition helix
with nonconservative amino acids also did not diminish
this binding (Figure 5B). We therefore suggest that the Prd
protein contains two distinct DNA binding domains. Eve is
another example of a homeodomain with dual specificity
(Hoey and Levine, 1988). Its binding to the e4 and e5 sites
is similarly influenced by interaction with regions of the
protein outside the homeodomain (Hoey et al., 1988). It
has also been reported that the yeast HAP-l protein has
two different DNA binding specificities that can be distinguished by mutations. However, the mechanisms of its
differential binding are not understood (Pfeifer et al., 1987;
L. Guarente, personal communication). Thus in addition
to the specificity directed by residue 9 of the recognition
helix, individual homeodomain proteins may have other
Cdl
580
complexities in their interaction with DNA, as we show
here for the two DNA binding specificities of Prd, one of
which can interact with the rest of the protein. This could
provide an explanation for the conservation throughout
evolution of the differences between the various classes
of homeodomains outside the recognition helix.
Experimental
Procedures
Plasmids
The pARPrd and pARZen expression plasmids were the gift of Tim
Hoey and Mike Levine (Hoey and Levine, 1988); the pGEMf1 Ftz expression plasmid was provided by Henry Krause (Krause et al., 1966).
The origin of replication of fl was cloned into the EcoRl site of pARPrd
as an EcoRl fragment obtained from the plasmid pAREn.oriCla (Heitman et al., 1989). This construct packages the sense strand of theprd
DNA. The plasmid ~273, containing the e4 and es sites, was provided
by Mike Levine, and the pEE.BlgOO plasmid, containing the Bed Al, A2,
and A3 sites, was provided by Ulrike Gaul and Herbert Jackie. PrdA
was constructed by removing a 923 bp BamHl fragment (starting 128
bp downstream of the 3’end of the homeobox and ending after the stop
codon) in the pARPrd vector. The ends were filled in with Klenow poly
merase and the plasmid was religated. The protein produced from this
plasmid has a deletion of the last 298 amino acids and an addition of
26 amino acids from an open reading frame after the stop codon. To
construct the Ftz/PrdHD and FtzlM5HD plasmids, the Ftz homeodomain was removed from the pGEMfl-ORI plasmid by cutting out a 267
bp Nael fragment. A 231 bp Ddel fragment containing the PAR-Prd or
M5 homeodomain was blunt-ended and inserted in the resulting plasmid. The Prd3 plasmid was obtained by cloning the oligonucleotide
GGGAATTCAGCTGGATCCTTTGACGIACTTTGACGTGATTTGACGTAATGAGTCGAC in the Smal site of the pBSM13+ plasmid (Stratagene).
Mutagenesls
Single-stranded uridine-containing pARPrd DNA was prepared from E.
coli BW313 (dut- ung thi-I r&l spoT//F’/ysA) according to the method
of Kunkel(l985) but omitting thymidine and deoxyadenosine from the
medium and growing phage for only a single cycle. Kinased oligonucleotides were annealed to this template in 20 ul of 20 m M Tris (pH 7.5),
10 m M MgCIP. 56 m M NaCI, and these primers were extended for 90
min at 37% in 100 ul of 20 m M Tris (pH 7.5) 5 m M DTT, 10 m M MgCI,,
1 m M ATR 0.5 m M each of dATR dGTR dCTP and dTTR with 1 U of
the Klenow fragment of DNA polymerase I and 200 U of T4 DNA ligase.
After phenol extraction and ethanol precipitation, the DNA was methylated according to the procedure of Horton and Lord (1986) using 50
m M Tris (pH 7.5) 5 m M MgClp, 1 m M DTT as the reaction buffer. It was
then used to transform E. coli DH5aF’ (Bethesda Research Laboratories). Colonies were screened by hybridization to the radioactively labeled mutagenic oligonucleotide (Maniatis et al., 1982). Positives were
confirmed by dideoxy sequencing (Sanger et al., 1977). The sequences
of the oligonucleotides
used for mutagenesis were:
Ml: CGCCGGTTGCTGAACCAIAICTTGATXGTECTCCGTGAGATTGGTG
M2, M4: GCTGCTTGCGGAGACGGGCCCGCCGGTTTTGAACCATAT CTTG, creating an Apa I site
M3: GTCTCTCCGTGAGAC~&GCGCTGGGCCAGCTC~ACGCGTGTAGATATCAGGGTATTGG,
creating Mlul and Aflll sites
MS: GCTGCTTGCGGAGACGGGCCCGCCGGTTT~GAACCACACCTGGATGCG, creating an Apa I site
M6: CCATATCTTGAT~GTCTCTCCGTGAG
M7: GGTTTTGGAACCATATCTGGATTTGTCTCTC
MCTF: GGAGACGAGCACGCCGGTTGCAGAACCACACCCGGATG~~C~CGTGAGATTGGTGCGCTGGG
B9: GAGCACGCCGGTT_CITGAACCACACCTGG
MP-IWF: GCCGGTTTTGGGCCTCTATCTTG~TTGTCTCTCCGTGAGATTGG.
Nucleotides
altering the sequences
are underlined.
Protein Praparatlon
Crude bacterial extracts were prepared from E. coli BL21(DE8) contain-
ing each expression construct or the pAR3040 vector alone (Studier
and Moffatt, 1966) as a control, according to the method of Hoey and
Levine (1988). except that all extracts were initially resuspended in
buffer 2 containing 4 M guanidine-HCI
and 1 m M EOTA without
MgCl2 and were renatured by dialysis against the same buffer, first
containing 1 M guanidine-HCI
and then without guanidine-HCI.
DNAese I Footprint Reactlons
DNA fragments were end-labeled with T4 polynucleotide kinase, and
1-5 x IO4 cpm was used per lane. The footprint procedure used is
described in Desplan et al. (1988) except that the final DNAase I concentration was either 12.5 or 25 nglml. Binding to the class l-specific
sites (NPs) was shown by footprinting approximately 2 ng of a 125 bp
EcoRI-Hindlll
fragment containing the NPs sequence, 5’ end-labeled
at the EcoRl site of the M13mp18 polylinker (Desplan et al., 1988). For
analysis of binding to Bed sites, a 222 bp Neil-Nsil fragment of the
plasmid pE8.81000 (Tautr et al., 1987) containing the Bicoid Al site
from the hunchback promoter, was end-labeled at the Neil site and
footprinted. Binding to the ea site was tested by footprinting a 280 bp
Xhol-Hindlll
fragment of the eke promoter-containing
plasmid ~273
(Hoey and Levine, 1986) end-labeled at the Xhol site. To footprint the
Prd3 repeats, the Prd3 plasmid was end-labeled at the Asp718 site and
recut with Hindlll.
Acknowledgments
We are very grateful to Tim Hoey and Mike Levine for the gift of the
pARZen, pARPrd, and ~273 plasmids as well as for fruitful discussions
and encouragement.
We thank Henry Krause for the gift of the
pGEMfl vector, Ulrike Gaul and Herbert Jackie for providing plasmid
pEE.BlOOO (Tautz et al., 1987) and Wolfgang Driever and Christiane
Nt’isslein-Volhard for the Bed plasmid and for useful discussions about
the Bed binding sites. We also want to thank Ana Maria Bravo-Angel
for her enthusiasm in starting the analysis of the Prd protein as a summer student. Cheryl Fleisher has provided excellent technical assistance. Steve DiNardo, Elettra Ronchi, and Scott Dougan made help
ful comments on the manuscript. We also thank the DiNardo and
Desplan laboratories for constant help, interactions, and encouragement. J. T. is supported in part by the Lucille Markey Charitable Trust.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby
marked “advertisement” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
Received July 12, 1969; revised September
8, 1989.
References
Aggarwal, A. K., Rodgers, D. W., Drottar, M., Ptashne, M., and Harrison, S. C. (1988). Recognition of a DNA operator by the repressor of
phage 434: a view at high resolution. Science 242, 699-907.
Anderson, J. E., Ptashne, M., and Harrison, S. C. (1987). Structure of
the repressor-operator
complex of bacteriophage 434. Nature 326,
846-852.
Bass, S., Sorrells, V, and Youderian, P (1988). Mutant Trp repressors
with new DNA-binding specificities. Science 242, 240-245.
Beachy, F! A., Krasnow, M. A., Gavis, E. R., and Hogness, D. S. (1988).
An U/frabifhomx protein binds sequences near its own and the Anrennapedia Pl promoters. Cell 55, 1069-1061.
Berleth, T., Burri, M., Thoma. G., Bopp, D., Richstein, S., Frigerio, G.,
Nell, M., and Nusslein-Volhard, C. (1988). The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo.
EMBO J. 7; 1749-1756.
Btedenkapp. H., Borgmeyer, U., Sippel, E. L.. and Klempnauer, N.-H.
(1968). Viral rnyb oncogene encodes a sequence-specific
DNAbinding
activity. Nature 335, 635-837
Blochlinger, K., Bodmer, R.. Jack, J., Jan, L. Y., and Jan, Y. N. (1988).
Primary structure and expression of a product from cur, a locus involved in specifying sensory organ identity in Drosophils. Nature 333,
629-635.
Bopp, D., Burri, M., Baumgartner,
S., Frigerio, G., and Nell. M. (1986).
Specificity
561
of Homeodomains
Conservation
of a large protein domain in the segmentation gene
related genes in Drosophila. Cell 47, 1033-
paired and in functionally
1049.
Chowdhury, K., Deutsch, U., and Gruss, P (1967). A multigene family
encoding several “finger” structures is present and differentially active
in mammalian genomes. Cell 48, 771-778.
Clerc, R. G., Corcoran, L. M., LeBowitz, J. l-f., Baltimore, D., and
Sharp, P A. (1968). The B-cell-specific Ott-2 protein contains POU
box- and homeo box-type domains. Genes Dev. 2, 1570-1581.
Desplan, C., Theis, J., and O’Farrell, P H. (1965). The Drosophile developmental gene engfailed encodes a sequence specific DNA binding activity. Nature 318, 630-635.
Desplan, C., Theis, J., and D’Farrell, P H. (1966). The sequence specificity of homeodomain-DNA
interaction. Cell 54, 1081-1090.
Deutsch, U., Dressler, G. R., and Gruss, P (1968). Pax 1, a member of
a paired box homologous murine gene family, is expressed in segmented structures during development. Cell 53, 617-625.
Doyle, H. J., Harding, K., Hoey, T., and Levine, M. (1986). Transcripts
encoded by a homeo box gene are restricted to dorsal tissues of Drosophile embryos. Nature 323, 76-79.
at 2.5 A resolution: details of the repressor-operator
Science 242, 693-899.
interactions.
Ko, H.-S., Fast, f?, McBride, W., and Staudt, L. M. (1988). A human protein specific for the immunoglobulin
octamer DNA motif contains a
functional homeobox domain. Cell 55, 135144.
Krasnow, M. A., Saffman, E. E., Kornfeld, K., and Hogness, D. S.
(1969). Transcriptional activation and repression by Ukrabithorax proteins in cultured Drosophila cells. Cell 57, 1031-1043.
Krause, H. M., Klemenz, R., and Gehring, W. J. (1988). Expression
modification and localization of the fushi tarazu protein in Dmsophile
embryos. Genes Dev. 2, 1021-1036.
Kunkel, T. A. (1965). Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488492.
Laughon, A., and Scott, M. P (1984). Sequence of a DrosophL segmentation gene: protein structure homology with DNA binding proteins Nature 310, 25-31.
Macdonald, f? M., Ingham. t? W.. and Struhl, G. (1986). Isolation,
structure, and expression of even-skipped: a second pair-rule gene of
Drosophila containing a homeo box. Cell 47, 721-734.
Dressler, G. R., and Gruss, P (1988). Do multigene families regulate
vertebrate development? Trends Genet. 4, 214-219.
Maniatis, T., Fritsch, E. F, and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory).
Driever, W., and Niisslein-Volhard, C. (1969). The bicoid protein is a
positive regulator of hunchback transcription in the early Drosophila
embryo. Nature 337, 136143.
McGinnis, W., Levine, M., Hafen, E., Kuroiwa, A., and Gehring, W. J.
(1984a). A conserved DNA sequence in homeotic genes of the Dro
sophila Antennapedia and bithorax complexes. Nature 308, 428-433.
Frigerio, G., Burri, M., Bopp, D., Baumgartner, S., and Nell, M. (1986).
Structure of the segmentation gene paired and the Drosophila PRD
gene set as part of a gene network. Cell 47, 735-746.
McGinnis, W., Garber, R. L., Wirz, J., Kuroiwa, A., and Gehring, W. J.
(1964b). A homologous protein-coding sequence in Drosophila homeotic genes and its conservation in other metazoans. Cell 37, 403406.
Garcia-Bellido,
A. (1975). Genetic control of wing disc development
in
Drosophila. Ciba Foundation Symp. 29, 161-182.
Gehring, W. J. (1967). Homeo
Science 236, 1245-1252.
boxes in the study of development.
Godowski, P, Rusconi, S., Miesfield, R., and Yamamoto, K. R. (1967).
Glucocorticoid
mutants that are constitutive activators of transcriptional enhancement. Nature 325, 365-368.
Han, K., Levine, M.. and Manley, J. L. (1969). Synergistic activation and
repression of transcription by Drosophila homeobox proteins. Cell 56,
573-583.
Muller, M., Affolter, M., Leupin, W., Otting, G., Wiithrich, K., and Gehring, W. J. (1968). Isolation and sequence-specific
DNA binding of the
Antennapedia homeodomain. EMBO J. 7,4299-4304.
Niisslein-Volhard, C., and Wieschaus, E. (1980). Mutations affecting
segment number and polarity in Drosophila. Nature 287, 795-801.
Nusslein-Volhard, C., Frohnhbfer, H. G., and Lehmann, R. (1987). Determination of anteroposterior
polarity in Drosophila. Science 238,
1675-1681.
Hanes, S. D., and Brent, R. (1969). DNA specificity of the Bicoid activator protein is determined by homeodomain recognition helix residue 9.
Cell 57, 1275-1283.
Otting, G., Qian, Y.-Q., Miiller, M., Affolter, M., Gehring. W. J., and
Wiithrich, K. (1988). Secondary structure determination for the Antennapedia homeodomain by nuclear magnetic resonance and evidence
for a helix-turn-helix motif. EMBO J. 7, 4305-4309.
He, X., Treaty, M. N., Simmons, D. M., Ingraham, H. A., Swanson,
L. W., and Rosenfeld, M. G. (1989). Expression of a large family of
POU-domain regulatory genes in mammalian brain development. Nature 340, 35-42.
Otwinowski, Z.. Schevitz, R. W., Zhang, R.-G., Lawson, C. L., Joachimiak, A., Marmorstein, R. Q., Luisi, B. F., and Sigler, t? B. (1988). Crystal structure of frp repressor/operator complex at atomic resolution. Nature 335, 321-329.
Heitman, J., Treisman, J., Davis, N. G., and Russel, M. (1989). Cassettes of the 11 intergenic region. Nucl. Acids Res. 7Z 4413.
Pabo, C. O., and Sauer, R. T. (1984). Protein-DNA
Rev. Biochem. 53, 293-321.
Herr, W., Sturm, R. A., Clerc, R. G., Corcoran, L. M., Baltimore, D.,
Sharp, t? A., Ingraham, H. A., Rosenfeld, M. G., Finney, M.. Ruvkun.
G., and Horvitz, H. R. (1968). The POU domain: a large conserved region in the mammalian pit-l, ocf-1, o&2 and Caenorhabditis ekgens
uric-86 gene products. Genes Dev. 2, 1513-1516.
Hochschild, A., and Ptashne, M. (1986). Homologous interactions
repressor and 1 Cro with the 1 operator. Cell 44, 925-933.
of 5
Hochschild, A., Douhan, J., III, and Ptashne, M. (1986). How )i repressor and 5 Cro distinguish between 0~1 and On3. Cell 47, 807-816.
Hoey, T., and Levine, M. (1988). Divergent homeo box proteins recognize similar DNA sequences in Drosophile. Nature 332, 856-861.
Hoey, T., Warrior, R., Manak, J., and Levine, M. (1968). DNA-binding
activities of the Drosophila melanogasrer even-skipped protein are
mediated by its homeo domain and influenced by protein context. Mol.
Cell. Biol. 8, 4596-4607.
Horton, R. D., and Lord, S. T. (1986). In vitro methylation doubles the
efficiency of oligonucleotide-directed
mutagenesis. Nucl. Acids Res.
14. 5112.
Ingham, P W. (1986). The molecular geneticsof
mation in Drosophila. Nature 335, 25-34.
embryonic
pattern for-
Jordan, S. R., and Pabo, C. 0. (1988). Structure of the lambda complex
recognition.
Annu.
Pfeifer, K., Prezant, T., and Guarente, L. (1967). Yeast HAP1 activator
binds to two upstream activation sites of different sequence. Cell 49,
19-27.
Picard, D., Salser, S. J., and Yamamoto, K. R. (1988). A movable and
regulable inactivation function within the steroid binding domain of the
glucocorticoid
receptor. Cell 54, 1073-1080.
Ptashne, M. (1966). A Genetic Switch (Cambridge, Massachusetts,
and Palo Alto, California: Cell Press and Blackwell Scientific Publications).
Rosa, F. M. (1969). Mix.7, a homeobox mRNA inducible by mesoderm
inducers, is expressed mostly in the presumptive endodermal cells of
Xenopus embryos. Cell 57, 965-974.
Ross, W., and Landy, A. (1982). Bacteriophage )L Int protein recognizes
two classes of sequences in the phage attsite: characterization of armtype sites. Proc. Natl. Acad. Sci. USA 79, 7724-7728.
Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing
with chain-terminating
inhibitors. Proc. Natl. Acad. Sci. USA 74,
5463-5467.
Scheidereit, C., Cromlish, J. A., Gerster, T., Kawakami, K., Balmaceda,
C.-G., Currie, R. A., and Roeder, R. G. (1988). A human lymphoid-
specific transcription factor that activates immunoglobulin
homeobox protein. Nature 336, 551-557.
genes in a
Scott, M. P, and Carroll, S. B. (1987). The segmentation and homeotic
gene network in early Drosophila development. Cell 57, 689-698.
Scott, M. P, and O’Farrell, P. H. (1986). Spatial programming of gene
expression in early Drosopbile embryogenesis. Annu. Rev. Cell Biol.
2, 49-80.
Scott, M. P, and Weiner, A. J. (1984). Structural relationships among
genes that control development: sequence homology between the Antennapedia, Ultrabithorax, and fushi tarazu loci of Drosophila. Proc.
Natl. Acad. Sci. USA 81, 4115-4119.
Scott, M. f?, Tamkun, J. W., and HartzelI, G. W. (1989). The structure
and function of the homeodomain. Biochim. Biophys. Acta, in press.
Studier, F. W., and Moffatt, 8. A. (1986). Use of bacteriophage T7 RNA
polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol. 189, 113-130.
Sturm, Ft. A., Das, G., and Herr, W. (1988). The ubiquitous octamerbinding protein Ott-1 contains a POU domain with a homeo box subdomain. Genes Dev. 2, 1582-1599.
Tautz, D., Lehmann, R., Schnurch, H., Schuh, R., Seifert. E., Kienlin,
A., Jones, K. and Jackie, H. (1987). Finger protein of novel structure
encoded by hunchback, a second member of the gap class of Drosophila segmentation genes. Nature 327, 383-389.
Thali, M., Miiller, M M., Delorenzi, M., Matthias, P, and Bienz, M.
(1988). Drosophila homeotic genes encode transcriptional activators
similar to mammalian DTF-2. Nature 336, 598-601.
Treisman, J., and Desplan, C. (1989). The Drosophile
ucts Kriippel and Hunchback bind to the hunchback
ture, in press.
gap gene prodpromoters. Na-
Wharton, R. P, and Ptashne, M. (1985). Changing the binding specificity of a repressor by redesigning an alpha-helix. Nature 316, 601-605.
Wharton, R. P.. and Ptashne, M. (1987). A new-specificity mutant of
434 repressor that defines an amino acid-base pair contact. Nature
326, 888-891.
Winslow, G. M., Hayashi, S., Krasnow, M., Hogness, D. S., and Scott,
M. P (1989). Transcriptional activation by the Antennapedia and fushi
tarazu proteins in cultured Drosophila cells. Cell 57, 1017-1030.
Wolberger, C., Dong, Y., Ptashne, M., and Harrison, S. C. (1988). Structure of a phage 434 Cro/DNA complex. Nature 335, 789-795