Download In vivo cleaved CDCP1 promotes early tumor dissemination via

In vivo cleaved CDCP1 promotes early tumor dissemination via complexing
with activated β1 integrin and induction of FAK/PI3K/Akt motility signaling
Berta Casar, Ivo Rimann, Hisashi Kato, Sanford J. Shattil, James Quigley and
Elena Deryugina
Supplementary Information
Reagents
Polyclonal antibody against CDCP1 C-terminus, the mAb against human FAK phosphorylated at
Tyr391, and polyclonal FAK-specific antibody were purchased from Abgent (San Diego, CA).
The phosphotyrosine-specific mAb 4G10 was from Millipore (Temecula, CA). The antibodies
against Akt and phospho Akt (Thr308 or Ser473) were from Cell Signaling Technology
(Danvers, MA). MAb against β1 integrin (MAB17783) from R&D Systems (Minneapolis, MN)
was used in western blotting, mAb HUTS-4 (Millipore, Temecula, CA) recognizing active form
of 1 integrin was used for immunoprecipitation, while anti-β1 integrin mAb TS2/16 (Biolegend,
San Diego) was used in flow cytometry. Function-blocking mAbs P1E6 against α2 integrin and
mAb P2D5 against β1 integrin (Millipore) were used in intramesodermal model. The antibody
against β3 integrin ab7167 was from Abcam (Cambridge, MA). Aprotinin was from Sigma,
dasatinib and wortmannin from LC Laboratories (Woburn, MA), and FAK inhibitor 14 from
Tocris Bioscience (R&D, Minneapolis, MN). CellTracker Green CMFDA was purchased form
Invitrogen. Rhodamine-conjugated Lens culinaris agglutinin (LCA) was from Vector Labs
(Burlingame, CA). Matrigel was supplied by Becton Dickinson (Franklin Lakes, NJ).
Orthotopic prostate tumor model
Orthotopic implantations of PC-hi/diss cells were performed in immunodeficient nude or SCID
mice as described (1). The mice were purchased from the TSRI breeding colony and maintained
under the guidelines of TSRI IACUC. PC-hi/diss cells (2×106) were surgically implanted into the
anterior prostates. One week later, mice were inoculated i.p. with 100 µg of mAb 10-D7 or
control IgG. Antibody treatments were performed every 4-5 days for 3 weeks. At 4 weeks,
primary tumors were excised and weighed, and internal organs were harvested and frozen for Alu
qPCR to quantify the disseminated cells.
1
Chick embryo model for spontaneous metastasis
Spontaneous metastasis in chick embryos was performed as described (2). PC3-hi/diss cells
(2x106) or HT-hi/diss cells (4x105) were grafted on the CAM. Within next 4-6 days, the embryos
were treated with control mouse IgG or mAb 10-D7 (50 µg), aprotinin (0.5 trypsin inhibitory
units, TIU), wortmannin (1 µM) or FAK inhibitor 14 (10 µM) in 100 µl of PBS-1% DMSO.
Experiments were terminated on day 5 (HT-hi/diss) and days 7 or 8 (PC-hi/diss). Primary tumors
were excised and weighed. The portions of the CAM and liver were harvested and analyzed for
the number of human cells by quantitative Alu PCR (Alu-qPCR).
Chick embryo model of tissue colonization (experimental metastasis)
Experimental metastasis in chick embryos was performed as described (3). Briefly, 5x104 tumor
cells were inoculated into one of allantoic veins of day 12 chick embryos. Five days later, the
CAM and livers were harvested and analyzed for the levels of human cell colonization by AluqPCR.
Quantification of human tumor cells by Alu-qPCR
Actual numbers of human cells within murine or chick embryo tissues were determined by
human-specific Alu-qPCR as described (2).
Western blotting and immunoprecipitation
The cells were lysed in mRIPA buffer supplemented with protease inhibitors (Sigma). From 20
to 50 µg of protein per lane were separated on 4% to 20% SDS-PAGE gels (Invitrogen, Grand
Island, NY) and transferred to Immobilon-P membranes (Millipore). For analyses of tissue
samples, the amounts of loaded proteins were adjusted to produce a similar CDCP1 signal.
Immunoprecipitations were performed with antibodies to CDCP1 (mAb 41-2) or activated β1
integrin (HUTS-4) and protein G-Sepharose (Amersham, Uppsala, Sweden). Immunoprecipitates
were subjected to western blotting with the indicated primary antibodies. Bound secondary
antibodies were visualized using SuperSignal West Pico Chemiluminescent substrate (Pierce).
Intramesodermal microtumor model for tumor cell escape and invasion in vivo
PC-hi/diss and HT-hi/diss cells were labeled with 5 µM CellTracker and resuspended at
2
2x106/ml or 1x106/ml, respectively. Five to seven small boluses of tumor cells (3-5 µl) were
injected directly into the CAM mesoderm of chick embryos developing ex ovo. Developing
microtumors were treated twice on days 2 and 4 (PC-hi/diss) or once on day 2 (HT-hi/diss) with
20 µl PBS-1% DMSO supplemented with 0.4 µg mAb 10-D7 or control IgG, 0.002 TIU
aprotinin or 0.02 nM wortmannin. On day 5 (HT-hi/diss) or day 6 (PC-hi/diss), embryos were
injected intravenously with LCA to highlight the CAM vasculature. Portions of the CAM with
microtumors were excised and immediately imaged using a Carl Zeiss AxioImager microscope.
Quantification of tumor cell escape and invasion was performed using ImageJ software (NIH,
Bethesda, MD). The mean number of the cells escaped and the mean of invasion distances from
the microtumor-CAM border was determined for each microtumor. A total of 11 to 13 individual
microtumors from 6 to 8 embryos were analyzed for each variable in 2 independent experiments.
Transendothelial migration
Endothelial cells (5-7x104) were placed in 0.1 ml endothelial culture medium on the insert
undersurfaces of 6.5 mm-Transwells with 8 μm pores (Corning Inc., Lowell, MA), pre-coated
with 5 µg of Matrigel. After overnight incubation, the inserts were flipped and endothelial cells
were grown to confluence. Pre-labeled PC-hi/diss cells were pre-incubated with corresponding
antibodies or inhibitors, and detached with EDTA or trypsin. Following washes, 1x105 cells in
0.1 ml SF-DMEM were placed into individual inserts. The lower chamber was filled with
DMEM-5% FBS. After 24-48 hr, transmigrated cells were quantified by flow cytometry as
percentage of green fluorescent cells among total cells harvested from bottom chambers.
Generation of PC-hi/diss β1 integrin knock-down cells
To express short hairpin RNA (shRNA), DNA fragments containing the human U6 promoter and
shRNA amplified by PCR were cloned into FG12-tdTomato and lentiviral infection was
performed as described (4). The following shRNA target sequence was used to knock down
(KD) human 1 integrin: AAGAGTGCCGTAACAACTGTGGTCAATCC. Control shRNA
sequence was as following: CAATGATCAGAACCACATGCCTGGCTTCC (5). PC-hi/diss
cells were transduced with control and β1 shRNA lentiviral constructs as described (6),
generating PC-control and PC-β1 KD cell lines, respectively.
3
Supplementary Figure Legends
Supplementary Figure S1. Kinetic analysis of antibody clearance in mice after i.p.
inoculation
The mice were inoculated i.p. with 100 µg of biotinylated normal IgG. Plasma samples were
collected at the indicated time points. Antibodies from 100 µl aliquots were immunoprecipitated
with Avidin Sepharose beads, eluted and visualized by western blotting with anti-mouse HRPconjugated antibody. Plasma from mice which did not received any biotinylated antibody served
as a negative control. For positive control, 2.5 µg of biotinylated antibody were directly mixed
with 100 µl normal plasma.
Supplementary Figure S2. Inoculation of prostate carcinoma cells induces de novo
generation of plasmin
Prostate carcinoma cells (1x106) alone (PC-hi/diss) or with 0.1 TIU aprotinin (PC-hi/diss +
Aprotinin in vivo), were inoculated into chick embryo vasculature through allantoic vein. After
24 hr, plasma was collected and analyzed for plasmin activity in a direct assay measuring
cleavage of plasmin-specific peptide S-2251 (Chromogenix, Instrumentation Laboratory
Company, Lexington, MA). To demonstrate plasmin nature of peptide-cleaving activity, plasma
sample collected from control embryos inoculated with the cells only was supplemented with
aprotinin (PC-hi/diss + Aprotinin in vitro). Plasmin-mediated cleavage of S-2251 was monitored
at 37 °C according to the manufacturer’s instructions.
Supplementary Figure S3. Analysis of de novo synthesis of 135-kDa CDCP1
Prostate carcinoma PC-3 cells (top panel) and cervical carcinoma HeLa cells transfected with
CDCP1 (HeLa-CDCP1) were treated with EDTA or trypsin for 15 min, washed and re-plated. At
the indicated time points, the cells were lysed in mRIPA buffer and analyzed by western blotting
for expression of full-length 135-kDa CDCP1 and cleaved 70-kDa CDCP1. Position of mol. wt.
markers (in kDa) is indicated on the left. Note that while newly-synthesized 135-kDa CDCP1
species re-appear by 9 hr after re-plating of trypsin-treated cells, the cleaved 70-kDa CDCP1
species are persistently present even at 48 hr after cell re-plating.
4
Supplementary Figure S4. Effect of CDCP1 ligation on the levels of prostate carcinoma cell
vascular arrest and CAM retention and colonization
(a) Flow cytometry analysis of CDCP1 ligation. PC-hi/diss cells were pre-incubated with 20
µg/ml control IgG or mAb 10-D7. The cells were washed to remove unbound excess antibodies
and then analyzed for the levels of cell surface bound control IgG (open histogram) or mAb 10D7 (hatched histogram).
(b) Analysis of CDCP1 cleavage and tumor cell number in CAM tissue. PC-hi/diss cells bearing
IgG or mAb 10-D7 were inoculated into allantoic vein of the chick embryo. At the indicated time
points, the CAM tissue was analyzed by IP and western blotting for CDCP1 cleavage and by
Alu-qPCR for the levels of tumor cell arrest (2 hr), tissue retention (24 hr) and colonization (day
5). In blot images, the full-length 135-kDa and cleaved 70-kDa CDCP1 species are indicated on
the right. The position of molecular weight markers is indicated in kDa on the left. Data in the
graph (mean ± SEM) are presented as percent change of IgG control (100%) determined in
pooled data from 3 independent experiments employing from 18 to 25 embryos per treatment
variant.
Supplementary Figure S5. Inhibition of CDCP1 cleavage diminishes fibrosarcoma cell
escape from primary tumors and stromal invasion
(a) Cell escape and invasion of HT-hi/diss cells in the intramesodermal microtumor model.
Fluorescent-labeled HT-hi/diss cells (green) were inoculated directly into the mesoderm layer of
the CAM. Developing microtumors were treated twice, on days 2 and 4, with 10 µg control IgG
or mAb 10-D7. On day 5, the embryos were inoculated i.v. with rhodamine-tagged LCA to
highlight the vasculature (red). Portions of the CAM with microtumors were video imaged at
10x magnification. Microtumor border and invasion distances covered by the escaped tumor
cells are outlined by dotted lines. Scale bar, 50 µm.
(b) Quantitative analysis of stromal invasion. Digitally acquired images of mesodermal
microtumors were quantified to determine mean invasion distance (± SEM) covered by escaped
cells from the edge of the microtumor. ***, P<0.001.
5
(c) Analysis of CDCP1 cleavage status in HT-hi/diss in culture and CAM tissue. Lane 1,
Western blot analysis of CDCP1 in HT-hi/diss cells in culture. Lane 2, CDCP1 cleavage detected
in vivo after HT-hi/diss were inoculated i.v. into the CAM vasculature. CDCP1 was
immunoprecipitated from the CAM tissue harvested 24 hr after cell inoculations and analyzed by
western blotting. Lanes 3 and 4, CDCP1 cleavage status was analyzed in intramesodermal
microtumors dissected with adjacent stroma from the CAM of embryos treated with control IgG
or mAb 10-D7. CDCP1 was immunoprecipitated from the lysed tissue with mAb 41-2 and
analyzed by western blotting with polyclonal anti-CDCP1 antibody. The full-length 135-kDa
and cleaved 70-kDa CDCP1 species are indicated on the right. The position of molecular weight
markers is indicated in kDa on the left.
Supplementary Figure S6. Analysis of CDCP1 expression in human endothelial cells
CDCP1 was visualized by western blotting in lysates of PC-hi/diss cells and human endothelial
cells, EAhy-926 (the hybrid between human umbilical cord endothelial cells and lung
carcinoma) and microvascular endothelial cells (HMVEC), subjected to SDS-PAGE under
reducing conditions. The full-length 135-kDa and cleaved 70-kDa CDCP1 species are indicated
on the right. The position of molecular weight markers is indicated in kDa on the left.
Supplementary Figure S7. Cleaved CDCP1 does not complex with β3 integrin
PC-hi/diss cells were pre-treated for 20 min with 20 µg/ml control mouse IgG or mAb 10-D7
and then subjected to 50 nM plasmin to induce CDCP1 cleavage. After incubation for 30 min at
370C, the cells were washed and lysed in mRIPA buffer supplemented with protease inhibitors.
Cell lysates were immunoprecipitated (IP) with anti-CDCP1 mAb 41-2 and eluted proteins were
probed under reduced conditions for CDCP1 (top panel) or β3 integrin (middle panel). The
whole cell lysate was also probed with anti-β3 integrin antibody to confirm the presence of 110kDa β3 integrin subunit in PC-hi/diss cells (bottom panel).
6
Supplementary Figure S8. Analysis of complex formation between cleaved CDCP1 and
activated β1 integrin
PC-hi/diss cells were pre-incubated in buffer containing 20 mM HEPES, 150 mM NaCl, 2 mg/ml
D-glucose and 1 mM each of CaCl2 and MgCl2 (lanes 1 and 2). To activate β1 integrin (lanes 3
and 4), the buffer was supplemented with 1 mM MnCl2, which induces the active conformation
of β1 integrin and expression of an epitope recognized by mAb HUTS-4. The cells in the
corresponding buffers were then incubated with 50 nM plasmin to induce CDCP1 cleavage or
left untreated. After incubation for 30 min at 370C, the cells were washed and lysed in mRIPA
buffer supplemented with protease inhibitors. Aliquots of cell lysates were immunoprecipitated
(IP) with anti-CDCP1 mAb 41-2 and protein G Sepharose beads, and eluted proteins were
probed for CDCP1 with rabbit polyclonal antibody (top panel) and β1 integrin with mouse mAb
17783 (bottom panel).
Supplementary Figure S9. Involvement of FAK and PI3k/Akt activities in CDCP1mediated tissue colonization
PC-hi/diss cells (5x104 cells in 0.1 ml SF-DMEM) were inoculated intravenously into chick
embryos with or without 10 µM FAK inhibitor 14 (a) or 1 µM wortmannin (c). On day 5, CAM
tissue was harvested and analyzed for the levels of CAM colonization by Alu-qPCR. Data
(means ± SEM) are from representative experiments employing from 9 to 12 animals per
treatment. ***, P<0.001. CAM tissue lysates were also analyzed by western blotting for the
levels activated (phospho) FAK versus total FAK (b) or activated (phospho) Akt versus total Akt
(d). Taking into account a 2.5-fold difference between levels of PC-hi/diss colonization, the
protein amounts in the lysates to be separated by SDS-PAGE were adjusted to produce similar
levels of total FAK or Akt in control and FAK inhibitor- or wortmannin-treated animals (1:2.5,
respectively). The position of molecular weight markers is indicated in kDa on the left.
7
Supplementary Figure S10. Effect of downregulation of β1 integrin on FAK and Akt
phosphorylation signaling
Control PC-hi/diss cells (lanes 1 and 3) and β1 knockdown (β1 KD, lanes 2 and 4) PC-hi/diss
cells were treated with EDTA (lanes 1 and 2) to preserve the uncleaved status of CDCP1, or
trypsin (lanes 3 and 4) to induce cleavage of CDCP1. After washing with serum-free medium,
the cells were plated onto plastic surfaces pre-coated with type I collagen (25 µg/ml PBS,
40C,overnight) and incubated in a CO2 incubator for 30 min at 370C. The adherent and nonadherent cells were lysed together in mRIPA buffer supplemented with protease and phosphatase
inhibitors and analyzed by western blotting for CDCP1 cleavage, β1 integrin expression, and
activation status of FAK and Akt (phospho FAK and phospho Akt versus corresponding total
FAK and total Akt proteins). The position of molecular weight markers is indicated in kDa on
the left.
Supplementary Figure S11. Lack of significant effects of wortmannin on PC-hi/diss cell
proliferation
PC-hi/diss cells were plated into 24-well plate at 5x104 cells per well in D-10. After 3 day
incubation, the cells were treated with vehicle (D-10 supplemented with 0.1% DMSO) or D-10
supplemented with wortmannin at increasing concentrations (from 0.2 to 1 µM). The number of
cells per well was determined 24 and 48 hr later after cell detachment with trypsin/EDTA. Data
are mean ± SEM.
Reference List for Supplementary Information
1. Conn EM, Botkjaer KA, Kupriyanova TA, Andreasen PA, Deryugina EI, Quigley JP
Comparative Analysis of Metastasis Variants Derived from Human Prostate Carcinoma
Cells. Roles in Intravasation of VEGF-Mediated Angiogenesis and uPA-Mediated
Invasion. Am J Pathol 2009; 175: 1638-1652.
2. Deryugina EI, Zijlstra A, Partridge JJ, Kupriyanova TA, Madsen MA, Papagiannakopoulos T,
Quigley JP Unexpected effect of matrix metalloproteinase down-regulation on vascular
intravasation and metastasis of human fibrosarcoma cells selected in vivo for high rates of
dissemination. Cancer Res 2005; 65: 10959-10969.
8
3. Casar B, He Y, Iconomou M, Hooper JD, Quigley JP, Deryugina EI Blocking of CDCP1
cleavage in vivo prevents Akt-dependent survival and inhibits metastatic colonization
through PARP1-mediated apoptosis of cancer cells. Oncogene 2011.
4. Stoletov K, Kato H, Zardouzian E, Kelber J, Yang J, Shattil S, Klemke R Visualizing
extravasation dynamics of metastatic tumor cells. J Cell Sci 2010; 123: 2332-2341.
5. Tadokoro S, Shattil SJ, Eto K, Tai V, Liddington RC, de Pereda JM, Ginsberg MH,
Calderwood DA Talin binding to integrin beta tails: a final common step in integrin
activation. Science 2003; 302: 103-106.
6. Watanabe N, Bodin L, Pandey M, Krause M, Coughlin S, Boussiotis VA, Ginsberg MH,
Shattil SJ Mechanisms and consequences of agonist-induced talin recruitment to platelet
integrin alphaIIbbeta3. J Cell Biol 2008; 181: 1211-1222.
9