Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cell Division Mitosis Why do they have to be so small? Why not keep growing – why divide? Surface area to Volume ratio Too much volume, too little space for it to get in Diffusion happens at the same rate, but smaller volume means less dist. to travel. Surface to Volume Ratio 1 cm2 to 1 cm3 4 cm2 to 8 cm3 9 cm2 to 27 cm3 Diffusion happens at the same rate – it all depends on the distance it has to travel. Now We Know Why, but what Mitosis is the division of the nucleus Focus is on getting equal and correct chromosomes to each new cell Most multicellular organisms are DIPLOID (2n) – two copies of each chromosome Compared to a haploid cell which only has one copy What type of cell in our bodies are haploid? Diploid? What does it look like for humans? Cell Cycle Nucleus: full of DNA Ruptured nucleus Interphase Prophase Metaphase Anaphase Telophase/cytokinesis What Controls Cell Division? What if it won’t stop? Cancer is the uncontrolled growth and reproduction of cells Tumors Benign (non spreading) Malignant (spreading) All depends on access to blood vessels Viruses and Cancer Viruses When Viruses attack If it goes lytic, then that cell will die And potentially those surrounding it When you deal with prophages (lysogenic) it all depends on when it turns lytic and where the DNA inserts The when often depends on environment The where depends on the DNA DNA – base pairing G pairs with C A pairs with T GACCAGGTCGACCTTATTACGACATGACAGATACCATAGAATGGACAAGG CTGGTCCAGCTGGAATAATGCTGTACTGTCTATGGTATCTTACCTGTTCC It all Depends on Where Newly inserted viral DNA making a prophage GACCAGGTCGACCTTATTACGACAT GACAGATACCATAGAATGGACAAGG If it inserts in non-coding DNA, then no big deal But, if it inserts in the middle of gene, then that gene is no longer functional Then it just depends on what the gene was. US Mortality, 2001 Rank Cause of Death No. of deaths % of all deaths 1. Heart Diseases 700,142 2. Cancer 553,768 22.9 3. Cerebrovascular diseases 163,538 6.8 4. Chronic lower respiratory diseases 123,013 5.1 5. Accidents (Unintentional injuries) 101,537 4.2 6. Diabetes mellitus 71,372 3.0 7. Influenza and Pneumonia 62,034 2.6 8. Alzheimer’s disease 53,852 2.2 9. 39,480 1.6 10. Septicemia 32,238 1.3 Nephritis 29.0 Source: US Mortality Public Use Data Tape 2001, National Center for Health Statistics, Centers for Disease Control and Prevention, 2003. Change in the US Death Rates* by Cause, 1950 & 2001 Rate Per 100,000 600 586.8 1950 500 2001 400 300 245.8 200 193.9 180.7 194.4 100 57.5 48.1 21.8 0 Heart Diseases Cerebrovascular Diseases Pneumonia/ Influenza * Age-adjusted to 2000 US standard population. Sources: 1950 Mortality Data - CDC/NCHS, NVSS, Mortality Revised. 2001 Mortality Data–NVSR-Death Final Data 2001–Volume 52, No. 3. http://www.cdc.gov/nchs/data/nvsr/nvsr52/nvsr52_03.pdf Cancer Cancer Death Rates*, All Sites Combined, All Races, US, 1975-2000 Rate Per 100,000 300 Men 250 Both Sexes 200 Women 150 100 *Age-adjusted to the 2000 US standard population. Source: Surveillance, Epidemiology, and End Results Program, 1975-2000, Division of Cancer Control and Population Sciences, National Cancer Institute, 2003. 2000 1999 1998 1997 1996 1995 1994 1993 1992 1991 1990 1989 1988 1987 1986 1985 1984 1983 1982 1981 1980 1979 1978 1977 1976 0 1975 50 Cancer Death Rates*, for Men, US, 1930-2000 100 Rate Per 100,000 Lung 80 60 Stomach Prostate 40 Colon & rectum 20 *Age-adjusted to the 2000 US standard population. Source: US Mortality Public Use Data Tapes 1960-2000, US Mortality Volumes 1930-1959, National Center for Health Statistics, Centers for Disease Control and Prevention, 2003. 2000 1995 1990 1985 1980 1975 1965 1960 1955 1950 1945 1940 1935 1970 Liver Leukemia 1930 0 Pancreas 5000 100 4500 90 4000 80 3500 70 Per capita cigarette consumption 3000 60 2500 50 Male lung cancer death rate 2000 40 1500 30 1000 20 500 10 Age-Adjusted Lung Cancer Death Rates* Per Capita Cigarette Consumption Tobacco Use in the US, 1900-2000 Female lung cancer death rate 2000 1995 1990 1985 1980 1975 1970 1965 1960 1955 1950 1945 1940 1935 1930 1925 1920 1915 1910 1905 0 1900 0 Year *Age-adjusted to 2000 US standard population. Source: Death rates: US Mortality Public Use Tapes, 1960-2000, US Mortality Volumes, 1930-1959, National Center for Health Statistics, Centers for Disease Control and Prevention, 2002. Cigarette consumption: US Department of Agriculture, 1900-2000. What is Cancer? Cancer is a disease of old age It’s typically a build up of mutations in genes that control the cell cycle We keep seeing more cancer because we live longer Metastasis – Cancer with car keys 1. The tumor grows 2. Mutates genes that promote vessel formation (VEGF) – helps it get food 3. Forms a displasia (see left) – begins to invade surrounding tissue 4. Eventually breaks through the blood vessels and spreads What are some things that play a role in the cell cycle? Cyclin VEGF CDC’s Telomerase p53 Rb p16ink4a E2F Big T, middle T, small T Ras Myc Jun etc., etc., etc How can we stop it? Some of it you can’t – Why? Mutations happen by accident in ~ 1 in a 1,000,000 replications of DNA We have over 1 Trillion cells – do the math – they’re (mutations) are going to happen Be smart – don’t: smoke, drink excessively, get sun burns, etc How do we treat it? Surgery, if possible, to remove the tumor Chemotherapy – Chemical therapy, specifically cytotoxins to go and kill specific cells Radiation treatment – typically a focused high intensity beam of X-rays which both disrupt cell growth but also and mainly cause blood vessels to thicken and eventually close off