Download emboj2011395-sup

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Nucleic acid analogue wikipedia, lookup

List of types of proteins wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

SR protein wikipedia, lookup

Transcript
1
Supplementary information
2
3
Supplementary materials and methods
4
5
Preparation of mRNAs encoding TPR proteins for in vitro translation
6
A DNA fragment encoding N-terminally myc-tagged FKBP62 was amplified by
7
PCR using primer231 and primer232 (Supplementary Table S1) from the cDNA
8
that was synthesized from A. thaliana (Col-0) total RNA using SuperScript III
9
Reverse Transcriptase (Invitrogen, US) and primer230, digested with PstI and
10
BamHI, and cloned into the pSP64-poly(A) vector to obtain pSP-mycFKBP62. To
11
obtain pSP-mycFKBP65, a DNA fragment encoding N-terminally myc-tagged
12
FKBP65 was amplified using primer260 and primer262 from the cDNA that was
13
synthesized from A. thaliana (Col-0) total RNA with primer261, digested with SalI
14
and
15
pSP-mycCYP40, a DNA fragment encoding N-terminally myc-tagged CYP40
16
was amplified using primer250 and primer252 from the cDNA that was
17
synthesized from A. thaliana (Col-0) total RNA with primer251, digested with PstI
18
and BamHI, and cloned into the pSP64-poly(A) vector. To obtain pSP-mycPP5, a
BamHI,
and
cloned
into
the
1
pSP64-poly(A)
vector.
To
obtain
19
DNA fragment encoding N-terminally myc-tagged PP5 was amplified using
20
primer246 and primer248 from the cDNA that was synthesized from A. thaliana
21
(Col-0) total RNA with primer247, digested with PstI and XbaI, and cloned into
22
the pSP64-poly(A) vector. To obtain pSP-mycTPR1, a DNA fragment encoding
23
N-terminally myc-tagged TPR1 was amplified using primer276 and primer278
24
from the cDNA that was synthesized from A. thaliana (Col-0) total RNA with
25
primer277, digested with PstI and BamHI, and cloned into the pSP64-poly(A)
26
vector. To obtain pSP-mycTPR2, a DNA fragment encoding N-terminally
27
myc-tagged TPR2 was amplified using primer293 and primer295 from the cDNA
28
synthesized from A. thaliana (Col-0) total RNA with primer294, digested with PstI
29
and BamHI, and cloned into the pSP64-poly(A) vector. To obtain pSP-mycTPR7,
30
a DNA fragment encoding N-terminally myc-tagged TPR7 was amplified using
31
primer285 and primer287 from the cDNA that was synthesized from A. thaliana
32
(Col-0) total RNA with primer286, digested with PstI and XbaI, and cloned into
33
the pSP64-poly(A) vector.
34
To obtain pSP-FKBP62myc, a DNA fragment encoding C-terminally
35
myc-tagged FKBP62 was amplified using primer306 and primer307 from
36
pSP-mycFKBP62, digested with PstI and BamHI, and cloned into the
2
37
pSP64-poly(A) vector. To obtain pSP-FKBP65myc, a DNA fragment encoding
38
C-terminally myc-tagged FKBP65 fragment was amplified using primer308 and
39
primer309 from pSP-mycFKBP65, digested with SalI and BamHI, and cloned
40
into the pSP64-poly(A) vector. To obtain pSP-CYP40myc, a DNA fragment
41
encoding C-terminally myc-tagged CYP40 was amplified using primer310 and
42
primer311 from pSP-mycCYP40, digested with PstI and BamHI, and cloned into
43
the pSP64-poly(A) vector. To obtain pSP-PP5myc, a DNA fragment encoding
44
C-terminally myc-tagged PP5 was amplified using primer312 and primer313
45
from pSP-mycPP5, digested with PstI and XbaI, and cloned into the
46
pSP64-poly(A) vector.
47
To obtain pSP-FKBP62, a DNA fragment encoding FKBP62 was
48
amplified using primer306 and primer232 from pSP-mycFKBP62, digested with
49
PstI and BamHI, and cloned into the pSP64-poly(A) vector. To obtain
50
pSP-FKBP65, a DNA fragment encoding FKBP65 was amplified using
51
primer308 and primer262 from pSP-mycFKBP65, digested with SalI and BamHI,
52
and cloned into the pSP64-poly(A) vector. To obtain pSP-CYP40, a DNA
53
fragment encoding CYP40 was amplified using primer310 and primer252 from
54
pSP-mycCYP40, digested with PstI and BamHI, and cloned into the
3
55
pSP64-poly(A) vector. To obtain pSP-PP5, a DNA fragment encoding PP5 was
56
amplified using primer312 and primer248 from pSP-mycPP5, digested with PstI
57
and XbaI, and cloned into the pSP64-poly(A) vector. To obtain pSP-TPR1, a
58
DNA fragment encoding TPR1 was amplified using primer325 and primer278
59
from pSP-mycTPR1, digested with PstI and BamHI, and cloned into the
60
pSP64-poly(A) vector. To obtain pSP-TPR2, a DNA fragment encoding TPR2
61
was amplified using primer326 and primer287 from pSP-mycTPR2, digested
62
with PstI and XbaI, and cloned into the pSP64-poly(A) vector. To obtain
63
pSP-TPR7, a DNA fragment encoding TPR7 was amplified using primer327 and
64
primer295 from pSP-mycTPR7, digested with PstI and BamHI, and cloned into
65
the pSP64-poly(A) vector.
66
The plasmid pSP-mycCYP40R63A was constructed by the overlap PCR
67
method using primer298, primer299, and pSP-mycCYP40 as template. The
68
plasmid pSP-mycCYP40K216A was constructed by the overlap PCR method using
69
primer304,
70
pSP-mycCYP401-215, a DNA fragment encoding mycCYP401-215 was amplified by
71
PCR using primer250 and primer301, digested with PstI and BamHI, and cloned
72
into the pSP64-poly(A) vector. To obtain pSP-mycCYP40166-361, a DNA fragment
primer305,
and
pSP-mycCYP40
4
as
template.
To
obtain
73
encoding mycCYP40166-361 was amplified by PCR using primer300 and
74
primer252, digested with PstI and BamHI, and cloned into the pSP64-poly(A)
75
vector. To obtain pSP-CYP40R63A and pSP-CYP40K216A, DNA fragments
76
encoding
77
pSP-mycCYP40R63A and pSP-mycCYP40K216A, respectively, using primer310
78
and primer252. To obtain pSP-CYP401-215, a DNA fragment encoding CYP401-215
79
was amplified by PCR using primer310, primer301, and pSP-mycCYP401-215 as
80
a template. To construct pSP-CYP40166-361, a DNA fragment encoding
81
CYP40166-361 was amplified by PCR using primer356, primer252, and
82
pSP-mycCYP40166-361 as a template.
CYP40R63A
and
CYP40K216A
were
amplified
by
PCR
from
83
To obtain pSP-NtFKBP62/65, a DNA fragment encoding NtFKBP62/65
84
(GeneBank accession number AB671736) was amplified by PCR using
85
primer387, primer242, and template cDNA that was synthesized from N.
86
tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase
87
(Invitrogen, US) and primer241, digested by PstI and BamHI, and cloned into the
88
pSP64-poly(A) vector. To obtain pSP-NtCYP40, a DNA fragment encoding
89
NtCYP40 (GeneBank accession number AB671737) was amplified by PCR
90
using primer384, primer386, and template cDNA that was synthesized from N.
5
91
tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase
92
(Invitrogen, US) and primer385, digested by SalI and BamHI, and cloned into the
93
pSP64-poly(A) vector. To obtain pSP-NtPP5, a DNA fragment encoding NtPP5
94
(GeneBank accession number AB671738) was amplified by PCR using
95
primer381, primer383, and template cDNA that was synthesized from N.
96
tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase
97
(Invitrogen, US) and primer382, digested by PstI and BamHI, and cloned into the
98
pSP64-poly(A) vector.
99
All of the mRNAs were prepared from plasmids linearized with either
100
EcoRI (FKBP65, CYP40, TPR1, TPR7, NtCYP40, NtPP5) or SmaI (FKBP62,
101
PP5, TPR2, NtFKBP62/65, which have internal EcoRI sites) using the AmpliCap
102
SP6 High Yield Message Maker Kit (EPICENTRE, US).
103
104
Preparation of small RNA duplexes
105
Small RNA duplexes were prepared as described previously (Iki et al, 2010),
106
except that the 5'-terminal nucleotides of the guide strand siRNA of gf698-21,
107
gf698-22, and miR168 (0.5 M) were phosphorylated with T4 polynucleotide
108
kinase (TAKARA, Japan) by incubating with 5 M [-32P]ATP (6.9 TBq/mmol) at
6
109
37°C for 90 min, followed by inactivation of the enzyme at 65°C for 15 min.
110
111
Chemicals
112
The stock solutions of cyclosporin A (CsA, WAKO, Japan), FK506 (SIGMA, US),
113
and geldanamycin (GA, WAKO, Japan) were prepared by dissolving these
114
chemicals in DMSO at a concentration of 1 mM. For use, the stock solutions
115
were diluted with D.W. to 200 M, and the 200 M solutions were added to BYL
116
reaction mixtures at a concentration of 20 M.
117
118
7
119
120
Supplementary Figure S1
121
Synthesis of N-terminally myc-tagged TPR proteins. The mRNAs encoding
122
myc-TPR proteins were translated in BYL at 25°C for 90 min. The reaction
123
mixtures were analyzed by immunoblotting using anti-myc antibodies.
124
8
125
126
127
Supplementary Figure S2
128
(A) Synthesis of non-tagged TPR domain-containing proteins. The mRNAs
129
encoding TPR proteins were translated in BYL at 25°C for 90 min. The reaction
9
130
was carried out in the presence of L-[35S]-methionine (Perkin Elmer) without
131
additional amino acids. (B) Effect of the addition of CYP40 and PP5 that were
132
synthesized in BYL on the production of ss gf698-21 and gf698-22 guide strands
133
and miR168. AGO1 mRNA-translated BYL was mixed with mock-translated BYL
134
(filled
135
mRNA-translated BYL (open triangles). The mixtures were incubated with 5 nM
136
small RNA duplex containing 32P-labeled siRNA guide or miRNA strands at 25°C.
137
RNA was extracted at the indicated time (min), and analyzed by native PAGE.
138
The concentration of produced ss small RNAs was calculated from the intensity
139
of bands corresponding to ss small RNAs and duplexes. We obtained consistent
140
results through three independent experiments and a typical set of results is
141
shown here. (C) Synthesis of NtFKBP62/65, NtCYP40, and NtPP5 proteins. The
142
mRNAs were translated in BYL at 25°C for 90 min. The reaction was carried out
143
in the presence of L-[35S]-methionine (Perkin Elmer) without additional amino
144
acids. (D) Effect of the addition of NtFKBP62/65, NtCYP40, and NtPP5, on the
145
generation of ss siRNA. AGO1 and the N. tabacum proteins were synthesized in
146
BYL, mixed, and incubated with gf698-22 siRNA duplex containing the
147
32P-labeled
circles),
CYP40
mRNA-translated
BYL (open
circles),
or
PP5
guide strand at 25°C for 30 min. RNA was extracted from the
10
148
reaction mixtures and analyzed by 15% native PAGE (left panel). Negative
149
control reactions using mock-translated BYL were performed in parallel. Relative
150
ss siRNA generation activity was calculated as described in the legend to Figure
151
3A. The graph shows the averages and standard deviation (STD) of the relative
152
ss siRNA generation activity values obtained in three independent experiments
153
(right panel). Different letters indicate statistically significant differences
154
(Student’s t-test, P < 0.01). (E) Effect of the addition of NtFKBP62/65, NtCYP40,
155
and NtPP5, on target cleavage activity. AGO1 and the N. tabacum proteins were
156
synthesized in BYL, mixed, incubated with gf698-22 siRNA duplex at 25°C for 30
157
min, and further incubated with 32P-labeled GF-s target RNA. RNA was extracted
158
and analyzed by denaturing 5% PAGE (left panel). Relative target cleavage
159
activity was calculated as described in the legend to Figure 3B. The graph
160
shows the averages and STD of the relative target cleavage activity values
161
obtained in four independent experiments (right panel). Different letters indicate
162
statistically significant differences (Student’s t-test, P < 0.01).
163
11
164
165
166
Supplementary Figure S3
167
Association of AGO1, HSP90, and small RNA duplex with C-terminally
168
myc-tagged TPR proteins. FLAG-AGO1 and the C-terminally myc-tagged TPR
169
proteins were synthesized in BYL, mixed, and incubated at 25°C for 30 min with
170
5 nM gf698-22 siRNA duplex containing 32P-labeled guide strand in the presence
171
of additional 0.75 mM ATPS and 1 mM MgCl2. The TPR-myc proteins were
172
immunopurified using the anti-myc antibody and copurified RNA was extracted
173
and analyzed by 15% native PAGE. To confirm recovery of the myc-tagged
174
proteins and to examine the copurification of AGO1 and HSP90, a similar
175
experiment using unlabeled gf698-22 siRNA duplex was performed in parallel,
12
176
and myc-purified proteins were analyzed by immunoblotting using the anti-myc,
177
anti-HSP90, and anti-AGO1 antibodies.
13
178
179
Supplementary Figure S4
180
(A) Effect of CsA, FK506, and GA on ss siRNA production. AGO1
181
mRNA-translated BYL was incubated at 25°C for 30 min in the presence of 2%
182
DMSO alone, 2% DMSO and 20 M CsA, 2% DMSO and 20 M FK506, or 2%
183
DMSO and 20 M GA, and further incubated with 5 nM gf698-22 siRNA duplex
184
containing
185
analyzed by 15% native PAGE. A control experiment with mock-translated BYL
186
was performed in parallel. Relative ss siRNA generation activity was calculated
32P-labeled
guide strand at 25°C for 30 min. RNA was extracted and
14
187
as described in the legend to Figure 3A (‘AGO1 + DMSO’ condition = 100%).
188
The graph shows the averages and STD of the relative intensity of the ss siRNA
189
band obtained in three independent experiments (right panel). (B) Effect of CsA,
190
FK506, and GA on target cleavage activity. AGO1 mRNA-translated BYL was
191
incubated with 5 nM gf698-22 siRNA duplex at 25°C for 30 min in the presence
192
of 2% DMSO, 2% DMSO and 20 M CsA, 2% DMSO and 20 M FK506, or 2%
193
DMSO and 20 M GA. The reaction mixtures were further incubated with 5 nM
194
internally
195
and analyzed by 5% denaturing PAGE. A control experiment with the
196
mock-translated BYL was performed in parallel. Relative target cleavage activity
197
was calculated as described in the legend to Figure 3B (‘AGO1 + DMSO’
198
condition = 100%). The graph shows the averages and STD of the relative target
199
cleavage activity values obtained in three independent experiments (right panel).
32P-labeled
GF-s target RNA at 25°C for 10 min. RNA was extracted
200
15
201
202
203
Supplementary Figure S5
16
204
(A) Synthesis of non-tagged wild-type and mutant CYP40 proteins. The mRNAs
205
encoding the wild-type and mutant CYP40 proteins were translated in BYL at
206
25°C for 90 min. The reaction was carried out in the presence of
207
L-[35S]-methionine (Perkin Elmer) without additional amino acids. (B) Effect of
208
the addition of the CYP40 mutant proteins on generation of ss small RNA. AGO1
209
and myc-CYP40 mutant proteins were synthesized in BYL, mixed, and
210
incubated with gf698-22 siRNA duplex containing
211
25°C for 30 min. After the reaction, RNA was extracted and analyzed by 15%
212
native PAGE (left panel). Relative ss siRNA generation activity was calculated as
213
described in the legend to Figure 3A. The graph shows the averages and STD of
214
the relative ss siRNA generation activity values obtained in three independent
215
experiments (right panel). Different letters indicate statistically significant
216
differences (Student’s t-test, P < 0.01). (C) Effect of the addition of the CYP40
217
mutant proteins on target cleavage activity. AGO1 and myc-CYP40 mutant
218
proteins were synthesized in BYL, mixed, incubated with gf698-22 siRNA duplex
219
at 25°C for 30 min, and further incubated with internally
220
RNA at 25°C for 10 min. RNA was extracted from the mixtures and analyzed by
221
5% denaturing PAGE (left panel). Relative target cleavage activity was
17
32P-labeled
guide strand at
32P-labeled
GF-s target
222
calculated as described in the legend to Figure 3B. The graph shows the
223
averages and STD of the relative target cleavage activity values obtained in four
224
independent experiments (right panel). Different letters indicate statistically
225
significant differences (Student’s t-test, P < 0.01).
226
227
18
228
Supplementary Table S1. Oligonucleotides Used in This Study
Name
Sequence (5'-3')*
primer230
GGATAATCTCTCACTGTTTTATAAG
primer231
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGATGCTAATTTCGAGATGCCTCCA
primer232
ACTGACGGATCCAGTGTCTCACTAACGCTCAGGTTG
primer241
GGAACACGAAAGATGCCCGATTC
primer242
ACTGACGGATCCTCCTAATGTCCACTATAACGACTC
primer246
ACTGACTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGATC
TTGAGACCAAGAATGAGAATTCTGATG
primer247
CTTATATCATTATGTTTCTGAACC
primer248
ACTGACTCTAGACTGGTCTTGAGTCTTTAGAATAGC
primer250
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGGTAGGTCAAAGTGTTTCATGGAC
primer251
TGTTAGTCTTCTTCCTCACTATCC
primer252
ACTGACGGATCCACCAAACCCTAAATGAAGCAGAGC
primer260
ACTGACGTCGACATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGAAGACGATTTCGACACGCAGAAC
primer261
CAACTCTGAAACAGTAACACACAC
primer262
ACTGACGGATCCGTTTTTGGAATCAATGCGACTCTC
primer276
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGTACTGATCGAATCAAGTGAGAGT
primer277
TGTATGCATCAAGAACAATAACAC
primer278
ACTGACGGATCCACATTTAAGTGGTAGAAGCAATAC
primer285
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTTTTAACGGGTTAATGGATCCTGAG
primer286
AAAGAAGATAAAACGATGTTACAG
primer287
ACTGACTCTAGACCGAAGACTGGTTTTATCTTCACG
primer293
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGCGCTATGGATGGACGCTGGAGCG
primer294
AGCCCTAGCCATAACTCAGAACAG
primer295
ACTGACGGATCCGTAACAGTAATAGATTACGACAAC
primer298
TGATAACAGCATGAAATCGATTCCCCTTG
primer299
ATTTCATGCTGTTATCAAGGGGTTTATGA
19
primer300
ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT
CTTGTGATCCATGACTGTGGAGA
primer301
ACTGACGGATCCCTAGACAAAATCAACAGTCTCCA
primer304
ATTTTGTCGCGGCTCATGGGAATGAGCAC
primer305
CCATGAGCCGCGACAAAATCAACAGTCTC
primer306
ACTGACCTGCAGATGGATGCTAATTTCGAGA
primer307
TGACGGATCCTCTTTTGATTAAAGATCCTCCTCAGAAATAAGC
TTCTGCTCTTCCTTACTTAGTTTCGC
primer308
ACTGACGTCGACATGGAAGACGATTTCGACAC
primer309
ACTGACGGATCCTCAAAGATCCTCCTCAGAAATAAGCTTCTG
CTCTGCCTTGGTGTCAATACTC
primer310
ACTGACCTGCAGATGGGTAGGTCAAAGTGT
primer311
ACTGACGGATCCCTAAAGATCCTCCTCAGAAATAAGCTTCTG
CTCTACGAACATTTTGCGGTAC
primer312
ACTGACCTGCAGATGGAGACCAAGAATGAG
primer313
ACTGACTCTAGAGCTGGTTAAAGATCCTCCTCAGAAATAAGC
TTCTGCTCGTTGAACATCCTGAGAAAG
primer325
ACTGACCTGCAGATGGTACTGATCGAATCAAGTGAGAGT
primer326
ACTGACCTGCAGATGGCGCTATGGATGGACGCTGGAGCG
primer327
ACTGACCTGCAGATGTTTAACGGGTTAATGGATCCTGAG
primer356
ACTGACCTGCAGATGGTGATCCATGACTGTGGAGA
primer387
ACTGACCTGCAGATGGAAGAGGATTTTGATATTCCACCG
primer384
ACTGACGTCGACATGGGAAGGCCACGGTGTTATTTGG
primer385
CTCCCAGAATGCTTGCAATTGTAC
primer386
ACTGACGGATCCAATTGCACGTGCCGGTTCCAAATC
primer381
ACTGACCTGCAGATGCCCACTATGGAAACTGAG
primer382
CTGCGGGCAAGTCAGGAAGTTGTC
primer383
ACTGACGGATCCCTCCTGATGTGCATGCACTTGGTC
229
* The recognition sequences of the restriction enzymes used for cloning were
230
underlined.
231
20
232
233
Supplemental references
234
235
Iki T, Yoshikawa M, Nishikiori M, Jaudal MC, Matsumoto-Yokoyama E, Mitsuhara
I, Meshi T, Ishikawa M (2010) In vitro assembly of plant RNA-induced silencing
236
complexes facilitated by molecular chaperone HSP90. Mol Cell 39(2): 282-291
237
238
239
21