Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
1 Supplementary information 2 3 Supplementary materials and methods 4 5 Preparation of mRNAs encoding TPR proteins for in vitro translation 6 A DNA fragment encoding N-terminally myc-tagged FKBP62 was amplified by 7 PCR using primer231 and primer232 (Supplementary Table S1) from the cDNA 8 that was synthesized from A. thaliana (Col-0) total RNA using SuperScript III 9 Reverse Transcriptase (Invitrogen, US) and primer230, digested with PstI and 10 BamHI, and cloned into the pSP64-poly(A) vector to obtain pSP-mycFKBP62. To 11 obtain pSP-mycFKBP65, a DNA fragment encoding N-terminally myc-tagged 12 FKBP65 was amplified using primer260 and primer262 from the cDNA that was 13 synthesized from A. thaliana (Col-0) total RNA with primer261, digested with SalI 14 and 15 pSP-mycCYP40, a DNA fragment encoding N-terminally myc-tagged CYP40 16 was amplified using primer250 and primer252 from the cDNA that was 17 synthesized from A. thaliana (Col-0) total RNA with primer251, digested with PstI 18 and BamHI, and cloned into the pSP64-poly(A) vector. To obtain pSP-mycPP5, a BamHI, and cloned into the 1 pSP64-poly(A) vector. To obtain 19 DNA fragment encoding N-terminally myc-tagged PP5 was amplified using 20 primer246 and primer248 from the cDNA that was synthesized from A. thaliana 21 (Col-0) total RNA with primer247, digested with PstI and XbaI, and cloned into 22 the pSP64-poly(A) vector. To obtain pSP-mycTPR1, a DNA fragment encoding 23 N-terminally myc-tagged TPR1 was amplified using primer276 and primer278 24 from the cDNA that was synthesized from A. thaliana (Col-0) total RNA with 25 primer277, digested with PstI and BamHI, and cloned into the pSP64-poly(A) 26 vector. To obtain pSP-mycTPR2, a DNA fragment encoding N-terminally 27 myc-tagged TPR2 was amplified using primer293 and primer295 from the cDNA 28 synthesized from A. thaliana (Col-0) total RNA with primer294, digested with PstI 29 and BamHI, and cloned into the pSP64-poly(A) vector. To obtain pSP-mycTPR7, 30 a DNA fragment encoding N-terminally myc-tagged TPR7 was amplified using 31 primer285 and primer287 from the cDNA that was synthesized from A. thaliana 32 (Col-0) total RNA with primer286, digested with PstI and XbaI, and cloned into 33 the pSP64-poly(A) vector. 34 To obtain pSP-FKBP62myc, a DNA fragment encoding C-terminally 35 myc-tagged FKBP62 was amplified using primer306 and primer307 from 36 pSP-mycFKBP62, digested with PstI and BamHI, and cloned into the 2 37 pSP64-poly(A) vector. To obtain pSP-FKBP65myc, a DNA fragment encoding 38 C-terminally myc-tagged FKBP65 fragment was amplified using primer308 and 39 primer309 from pSP-mycFKBP65, digested with SalI and BamHI, and cloned 40 into the pSP64-poly(A) vector. To obtain pSP-CYP40myc, a DNA fragment 41 encoding C-terminally myc-tagged CYP40 was amplified using primer310 and 42 primer311 from pSP-mycCYP40, digested with PstI and BamHI, and cloned into 43 the pSP64-poly(A) vector. To obtain pSP-PP5myc, a DNA fragment encoding 44 C-terminally myc-tagged PP5 was amplified using primer312 and primer313 45 from pSP-mycPP5, digested with PstI and XbaI, and cloned into the 46 pSP64-poly(A) vector. 47 To obtain pSP-FKBP62, a DNA fragment encoding FKBP62 was 48 amplified using primer306 and primer232 from pSP-mycFKBP62, digested with 49 PstI and BamHI, and cloned into the pSP64-poly(A) vector. To obtain 50 pSP-FKBP65, a DNA fragment encoding FKBP65 was amplified using 51 primer308 and primer262 from pSP-mycFKBP65, digested with SalI and BamHI, 52 and cloned into the pSP64-poly(A) vector. To obtain pSP-CYP40, a DNA 53 fragment encoding CYP40 was amplified using primer310 and primer252 from 54 pSP-mycCYP40, digested with PstI and BamHI, and cloned into the 3 55 pSP64-poly(A) vector. To obtain pSP-PP5, a DNA fragment encoding PP5 was 56 amplified using primer312 and primer248 from pSP-mycPP5, digested with PstI 57 and XbaI, and cloned into the pSP64-poly(A) vector. To obtain pSP-TPR1, a 58 DNA fragment encoding TPR1 was amplified using primer325 and primer278 59 from pSP-mycTPR1, digested with PstI and BamHI, and cloned into the 60 pSP64-poly(A) vector. To obtain pSP-TPR2, a DNA fragment encoding TPR2 61 was amplified using primer326 and primer287 from pSP-mycTPR2, digested 62 with PstI and XbaI, and cloned into the pSP64-poly(A) vector. To obtain 63 pSP-TPR7, a DNA fragment encoding TPR7 was amplified using primer327 and 64 primer295 from pSP-mycTPR7, digested with PstI and BamHI, and cloned into 65 the pSP64-poly(A) vector. 66 The plasmid pSP-mycCYP40R63A was constructed by the overlap PCR 67 method using primer298, primer299, and pSP-mycCYP40 as template. The 68 plasmid pSP-mycCYP40K216A was constructed by the overlap PCR method using 69 primer304, 70 pSP-mycCYP401-215, a DNA fragment encoding mycCYP401-215 was amplified by 71 PCR using primer250 and primer301, digested with PstI and BamHI, and cloned 72 into the pSP64-poly(A) vector. To obtain pSP-mycCYP40166-361, a DNA fragment primer305, and pSP-mycCYP40 4 as template. To obtain 73 encoding mycCYP40166-361 was amplified by PCR using primer300 and 74 primer252, digested with PstI and BamHI, and cloned into the pSP64-poly(A) 75 vector. To obtain pSP-CYP40R63A and pSP-CYP40K216A, DNA fragments 76 encoding 77 pSP-mycCYP40R63A and pSP-mycCYP40K216A, respectively, using primer310 78 and primer252. To obtain pSP-CYP401-215, a DNA fragment encoding CYP401-215 79 was amplified by PCR using primer310, primer301, and pSP-mycCYP401-215 as 80 a template. To construct pSP-CYP40166-361, a DNA fragment encoding 81 CYP40166-361 was amplified by PCR using primer356, primer252, and 82 pSP-mycCYP40166-361 as a template. CYP40R63A and CYP40K216A were amplified by PCR from 83 To obtain pSP-NtFKBP62/65, a DNA fragment encoding NtFKBP62/65 84 (GeneBank accession number AB671736) was amplified by PCR using 85 primer387, primer242, and template cDNA that was synthesized from N. 86 tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase 87 (Invitrogen, US) and primer241, digested by PstI and BamHI, and cloned into the 88 pSP64-poly(A) vector. To obtain pSP-NtCYP40, a DNA fragment encoding 89 NtCYP40 (GeneBank accession number AB671737) was amplified by PCR 90 using primer384, primer386, and template cDNA that was synthesized from N. 5 91 tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase 92 (Invitrogen, US) and primer385, digested by SalI and BamHI, and cloned into the 93 pSP64-poly(A) vector. To obtain pSP-NtPP5, a DNA fragment encoding NtPP5 94 (GeneBank accession number AB671738) was amplified by PCR using 95 primer381, primer383, and template cDNA that was synthesized from N. 96 tabacum (BY-2) total RNA using SuperScript III Reverse Transcriptase 97 (Invitrogen, US) and primer382, digested by PstI and BamHI, and cloned into the 98 pSP64-poly(A) vector. 99 All of the mRNAs were prepared from plasmids linearized with either 100 EcoRI (FKBP65, CYP40, TPR1, TPR7, NtCYP40, NtPP5) or SmaI (FKBP62, 101 PP5, TPR2, NtFKBP62/65, which have internal EcoRI sites) using the AmpliCap 102 SP6 High Yield Message Maker Kit (EPICENTRE, US). 103 104 Preparation of small RNA duplexes 105 Small RNA duplexes were prepared as described previously (Iki et al, 2010), 106 except that the 5'-terminal nucleotides of the guide strand siRNA of gf698-21, 107 gf698-22, and miR168 (0.5 M) were phosphorylated with T4 polynucleotide 108 kinase (TAKARA, Japan) by incubating with 5 M [-32P]ATP (6.9 TBq/mmol) at 6 109 37°C for 90 min, followed by inactivation of the enzyme at 65°C for 15 min. 110 111 Chemicals 112 The stock solutions of cyclosporin A (CsA, WAKO, Japan), FK506 (SIGMA, US), 113 and geldanamycin (GA, WAKO, Japan) were prepared by dissolving these 114 chemicals in DMSO at a concentration of 1 mM. For use, the stock solutions 115 were diluted with D.W. to 200 M, and the 200 M solutions were added to BYL 116 reaction mixtures at a concentration of 20 M. 117 118 7 119 120 Supplementary Figure S1 121 Synthesis of N-terminally myc-tagged TPR proteins. The mRNAs encoding 122 myc-TPR proteins were translated in BYL at 25°C for 90 min. The reaction 123 mixtures were analyzed by immunoblotting using anti-myc antibodies. 124 8 125 126 127 Supplementary Figure S2 128 (A) Synthesis of non-tagged TPR domain-containing proteins. The mRNAs 129 encoding TPR proteins were translated in BYL at 25°C for 90 min. The reaction 9 130 was carried out in the presence of L-[35S]-methionine (Perkin Elmer) without 131 additional amino acids. (B) Effect of the addition of CYP40 and PP5 that were 132 synthesized in BYL on the production of ss gf698-21 and gf698-22 guide strands 133 and miR168. AGO1 mRNA-translated BYL was mixed with mock-translated BYL 134 (filled 135 mRNA-translated BYL (open triangles). The mixtures were incubated with 5 nM 136 small RNA duplex containing 32P-labeled siRNA guide or miRNA strands at 25°C. 137 RNA was extracted at the indicated time (min), and analyzed by native PAGE. 138 The concentration of produced ss small RNAs was calculated from the intensity 139 of bands corresponding to ss small RNAs and duplexes. We obtained consistent 140 results through three independent experiments and a typical set of results is 141 shown here. (C) Synthesis of NtFKBP62/65, NtCYP40, and NtPP5 proteins. The 142 mRNAs were translated in BYL at 25°C for 90 min. The reaction was carried out 143 in the presence of L-[35S]-methionine (Perkin Elmer) without additional amino 144 acids. (D) Effect of the addition of NtFKBP62/65, NtCYP40, and NtPP5, on the 145 generation of ss siRNA. AGO1 and the N. tabacum proteins were synthesized in 146 BYL, mixed, and incubated with gf698-22 siRNA duplex containing the 147 32P-labeled circles), CYP40 mRNA-translated BYL (open circles), or PP5 guide strand at 25°C for 30 min. RNA was extracted from the 10 148 reaction mixtures and analyzed by 15% native PAGE (left panel). Negative 149 control reactions using mock-translated BYL were performed in parallel. Relative 150 ss siRNA generation activity was calculated as described in the legend to Figure 151 3A. The graph shows the averages and standard deviation (STD) of the relative 152 ss siRNA generation activity values obtained in three independent experiments 153 (right panel). Different letters indicate statistically significant differences 154 (Student’s t-test, P < 0.01). (E) Effect of the addition of NtFKBP62/65, NtCYP40, 155 and NtPP5, on target cleavage activity. AGO1 and the N. tabacum proteins were 156 synthesized in BYL, mixed, incubated with gf698-22 siRNA duplex at 25°C for 30 157 min, and further incubated with 32P-labeled GF-s target RNA. RNA was extracted 158 and analyzed by denaturing 5% PAGE (left panel). Relative target cleavage 159 activity was calculated as described in the legend to Figure 3B. The graph 160 shows the averages and STD of the relative target cleavage activity values 161 obtained in four independent experiments (right panel). Different letters indicate 162 statistically significant differences (Student’s t-test, P < 0.01). 163 11 164 165 166 Supplementary Figure S3 167 Association of AGO1, HSP90, and small RNA duplex with C-terminally 168 myc-tagged TPR proteins. FLAG-AGO1 and the C-terminally myc-tagged TPR 169 proteins were synthesized in BYL, mixed, and incubated at 25°C for 30 min with 170 5 nM gf698-22 siRNA duplex containing 32P-labeled guide strand in the presence 171 of additional 0.75 mM ATPS and 1 mM MgCl2. The TPR-myc proteins were 172 immunopurified using the anti-myc antibody and copurified RNA was extracted 173 and analyzed by 15% native PAGE. To confirm recovery of the myc-tagged 174 proteins and to examine the copurification of AGO1 and HSP90, a similar 175 experiment using unlabeled gf698-22 siRNA duplex was performed in parallel, 12 176 and myc-purified proteins were analyzed by immunoblotting using the anti-myc, 177 anti-HSP90, and anti-AGO1 antibodies. 13 178 179 Supplementary Figure S4 180 (A) Effect of CsA, FK506, and GA on ss siRNA production. AGO1 181 mRNA-translated BYL was incubated at 25°C for 30 min in the presence of 2% 182 DMSO alone, 2% DMSO and 20 M CsA, 2% DMSO and 20 M FK506, or 2% 183 DMSO and 20 M GA, and further incubated with 5 nM gf698-22 siRNA duplex 184 containing 185 analyzed by 15% native PAGE. A control experiment with mock-translated BYL 186 was performed in parallel. Relative ss siRNA generation activity was calculated 32P-labeled guide strand at 25°C for 30 min. RNA was extracted and 14 187 as described in the legend to Figure 3A (‘AGO1 + DMSO’ condition = 100%). 188 The graph shows the averages and STD of the relative intensity of the ss siRNA 189 band obtained in three independent experiments (right panel). (B) Effect of CsA, 190 FK506, and GA on target cleavage activity. AGO1 mRNA-translated BYL was 191 incubated with 5 nM gf698-22 siRNA duplex at 25°C for 30 min in the presence 192 of 2% DMSO, 2% DMSO and 20 M CsA, 2% DMSO and 20 M FK506, or 2% 193 DMSO and 20 M GA. The reaction mixtures were further incubated with 5 nM 194 internally 195 and analyzed by 5% denaturing PAGE. A control experiment with the 196 mock-translated BYL was performed in parallel. Relative target cleavage activity 197 was calculated as described in the legend to Figure 3B (‘AGO1 + DMSO’ 198 condition = 100%). The graph shows the averages and STD of the relative target 199 cleavage activity values obtained in three independent experiments (right panel). 32P-labeled GF-s target RNA at 25°C for 10 min. RNA was extracted 200 15 201 202 203 Supplementary Figure S5 16 204 (A) Synthesis of non-tagged wild-type and mutant CYP40 proteins. The mRNAs 205 encoding the wild-type and mutant CYP40 proteins were translated in BYL at 206 25°C for 90 min. The reaction was carried out in the presence of 207 L-[35S]-methionine (Perkin Elmer) without additional amino acids. (B) Effect of 208 the addition of the CYP40 mutant proteins on generation of ss small RNA. AGO1 209 and myc-CYP40 mutant proteins were synthesized in BYL, mixed, and 210 incubated with gf698-22 siRNA duplex containing 211 25°C for 30 min. After the reaction, RNA was extracted and analyzed by 15% 212 native PAGE (left panel). Relative ss siRNA generation activity was calculated as 213 described in the legend to Figure 3A. The graph shows the averages and STD of 214 the relative ss siRNA generation activity values obtained in three independent 215 experiments (right panel). Different letters indicate statistically significant 216 differences (Student’s t-test, P < 0.01). (C) Effect of the addition of the CYP40 217 mutant proteins on target cleavage activity. AGO1 and myc-CYP40 mutant 218 proteins were synthesized in BYL, mixed, incubated with gf698-22 siRNA duplex 219 at 25°C for 30 min, and further incubated with internally 220 RNA at 25°C for 10 min. RNA was extracted from the mixtures and analyzed by 221 5% denaturing PAGE (left panel). Relative target cleavage activity was 17 32P-labeled guide strand at 32P-labeled GF-s target 222 calculated as described in the legend to Figure 3B. The graph shows the 223 averages and STD of the relative target cleavage activity values obtained in four 224 independent experiments (right panel). Different letters indicate statistically 225 significant differences (Student’s t-test, P < 0.01). 226 227 18 228 Supplementary Table S1. Oligonucleotides Used in This Study Name Sequence (5'-3')* primer230 GGATAATCTCTCACTGTTTTATAAG primer231 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGATGCTAATTTCGAGATGCCTCCA primer232 ACTGACGGATCCAGTGTCTCACTAACGCTCAGGTTG primer241 GGAACACGAAAGATGCCCGATTC primer242 ACTGACGGATCCTCCTAATGTCCACTATAACGACTC primer246 ACTGACTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGATC TTGAGACCAAGAATGAGAATTCTGATG primer247 CTTATATCATTATGTTTCTGAACC primer248 ACTGACTCTAGACTGGTCTTGAGTCTTTAGAATAGC primer250 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGGTAGGTCAAAGTGTTTCATGGAC primer251 TGTTAGTCTTCTTCCTCACTATCC primer252 ACTGACGGATCCACCAAACCCTAAATGAAGCAGAGC primer260 ACTGACGTCGACATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGAAGACGATTTCGACACGCAGAAC primer261 CAACTCTGAAACAGTAACACACAC primer262 ACTGACGGATCCGTTTTTGGAATCAATGCGACTCTC primer276 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGTACTGATCGAATCAAGTGAGAGT primer277 TGTATGCATCAAGAACAATAACAC primer278 ACTGACGGATCCACATTTAAGTGGTAGAAGCAATAC primer285 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTTTTAACGGGTTAATGGATCCTGAG primer286 AAAGAAGATAAAACGATGTTACAG primer287 ACTGACTCTAGACCGAAGACTGGTTTTATCTTCACG primer293 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGCGCTATGGATGGACGCTGGAGCG primer294 AGCCCTAGCCATAACTCAGAACAG primer295 ACTGACGGATCCGTAACAGTAATAGATTACGACAAC primer298 TGATAACAGCATGAAATCGATTCCCCTTG primer299 ATTTCATGCTGTTATCAAGGGGTTTATGA 19 primer300 ACTGACCTGCAGATGGAGCAGAAGCTTATTTCTGAGGAGGAT CTTGTGATCCATGACTGTGGAGA primer301 ACTGACGGATCCCTAGACAAAATCAACAGTCTCCA primer304 ATTTTGTCGCGGCTCATGGGAATGAGCAC primer305 CCATGAGCCGCGACAAAATCAACAGTCTC primer306 ACTGACCTGCAGATGGATGCTAATTTCGAGA primer307 TGACGGATCCTCTTTTGATTAAAGATCCTCCTCAGAAATAAGC TTCTGCTCTTCCTTACTTAGTTTCGC primer308 ACTGACGTCGACATGGAAGACGATTTCGACAC primer309 ACTGACGGATCCTCAAAGATCCTCCTCAGAAATAAGCTTCTG CTCTGCCTTGGTGTCAATACTC primer310 ACTGACCTGCAGATGGGTAGGTCAAAGTGT primer311 ACTGACGGATCCCTAAAGATCCTCCTCAGAAATAAGCTTCTG CTCTACGAACATTTTGCGGTAC primer312 ACTGACCTGCAGATGGAGACCAAGAATGAG primer313 ACTGACTCTAGAGCTGGTTAAAGATCCTCCTCAGAAATAAGC TTCTGCTCGTTGAACATCCTGAGAAAG primer325 ACTGACCTGCAGATGGTACTGATCGAATCAAGTGAGAGT primer326 ACTGACCTGCAGATGGCGCTATGGATGGACGCTGGAGCG primer327 ACTGACCTGCAGATGTTTAACGGGTTAATGGATCCTGAG primer356 ACTGACCTGCAGATGGTGATCCATGACTGTGGAGA primer387 ACTGACCTGCAGATGGAAGAGGATTTTGATATTCCACCG primer384 ACTGACGTCGACATGGGAAGGCCACGGTGTTATTTGG primer385 CTCCCAGAATGCTTGCAATTGTAC primer386 ACTGACGGATCCAATTGCACGTGCCGGTTCCAAATC primer381 ACTGACCTGCAGATGCCCACTATGGAAACTGAG primer382 CTGCGGGCAAGTCAGGAAGTTGTC primer383 ACTGACGGATCCCTCCTGATGTGCATGCACTTGGTC 229 * The recognition sequences of the restriction enzymes used for cloning were 230 underlined. 231 20 232 233 Supplemental references 234 235 Iki T, Yoshikawa M, Nishikiori M, Jaudal MC, Matsumoto-Yokoyama E, Mitsuhara I, Meshi T, Ishikawa M (2010) In vitro assembly of plant RNA-induced silencing 236 complexes facilitated by molecular chaperone HSP90. Mol Cell 39(2): 282-291 237 238 239 21