Download What is Sickle Cell Disease? page 108

What is sickle cell disease?
Sickle cell disease is a disorder that affects the red blood cells, which use a
protein called hemoglobin to transport oxygen from the lungs to the rest of
the body. Normally, red blood cells are round and flexible so they can travel
freely through the narrow blood vessels.
The hemoglobin molecule has two parts: an alpha and a beta. Patients with
sickle cell disease have a mutation in a gene on chromosome 11 that
codes for the beta subunit of the hemoglobin protein. As a result,
hemoglobin molecules don't form properly, causing red blood cells to be
rigid and have a concave shape (like a sickle used to cut wheat). These
irregularly shaped cells get stuck in the blood vessels and are unable to
transport oxygen effectively, causing pain and damage to the organs.
How do people get sickle cell disease?
Sickle cell disease is inherited in an autosomal recessive pattern. This means that a
child will not inherit the disease unless both parents pass down a defective copy of
the gene. People who inherit one good copy of the gene and one mutated copy are
carriers. They are clinically normal, but can still pass the defective gene to their
children.
How do doctors diagnose sickle cell disease?
Most states routinely screen newborns for sickle cell disease with a simple blood
test. If the disorder is not detected at birth, a blood sample can be used in a test
called hemoglobin electrophoresis. This test will determine whether a person has
sickle cell disease, or whether he or she is a carrier of the faulty hemoglobin gene.
How is sickle cell disease treated?
Babies and young children with sickle cell disease must take a daily dose of penicillin to prevent potentially deadly infections.
Patients also take folic acid, which helps build new red blood cells.
Doctors advise people with sickle cell disease to get plenty of rest, drink lots of water, and avoid too much physical activity. Blood
transfusions that provide a patient with healthy red blood cells are a common treatment.
People with more severe cases of the disease can be treated with a bone marrow transplant. This procedure provides the patient
with healthy red blood cells from a donor, ideally from a sibling.
Interesting facts about sickle cell disease
Unlike normal red blood cells, which can live for 120 days, sickle-shaped cells live only 10 to 20 days. In the United States, the
disease most commonly affects African-Americans. About 1 out of every 500 African-American babies born in the United States has
sickle cell anemia.
Sickle cell disease is most common among people from Africa, India, the Caribbean, the Middle East, and the Mediterranean. The
high prevalence of the defective gene in these regions may be due to the fact that carriers of a mutation in the beta-subunit of
hemoglobin are more resistant to malaria. Malaria is a disease caused by a parasite that is transmitted to a person when they are
bitten by an infected mosquito. The sometimes fatal disease is common in hot countries, and causes recurring chills and fever.
Sickle Cell at the Molecular Level
In sickle cell anemia, there is a mutation in the gene that encodes the β chain of hemoglobin. Within this gene
(located on Chromosome 11). ONE BASE in the DNA is replaced with another base, and this mutation causes the
normal amino acid #6 to be replaced by another amino acid.
Assignment
1. Making a Normal Beta Chain of Hemoglobin
The sequence below is the first part of the DNA sequence for the chain of normal hemoglobin. Fill in the
complementary DNA strand using the base-pairing rules for making DNA (A pairs with T, C pairs with G)
DNA: GTG CAC CTG ACT CCT GAG GAG
DNA:
Now make the messenger RNA from the new, complementary strand of DNA that you just wrote down. Use the RNA
base-pairing rules (Remember: same as DNA but use U instead of T).
mRNA:
Now, using the Genetic Code, translate this mRNA into a sequence of amino acids.
Amino Acid:
2.
Making Sickle Cell Hemoglobin
In sickle cell anemia, there is a mutation at the seventeenth nucleotide of DNA in this gene; the nucleotide is
changed from A to T. Fill in the complementary DNA strand, mRNA, and amino acid sequence in the hemoglobin
protein.
DNA: GTG CAC CTG ACT CCT GTG GAG
DNA:
mRNA:
Amino Acids:
Conclusion
1. How does sickle cell hemoglobin differ from normal hemoglobin?
2. What is the effect on the red cell containing this altered hemoglobin?
3. Write a possible DNA sequence that includes a non harmful mutation from the normal hemoglobin
sequence. This mutation should not change the final amino acid sequence.
4. Imagine the nucleotide “A” was added to the sequence:
GTGACACCTGACTCCTGAGGAG
How would that affect the final protein?
5. Which kind of mutation should have a larger affect on the expressed protein, a mutation that switches
one nucleotide or one that inserts a nucleotide? Explain how some mutations are more harmful than
others (please be specific).
Modified from the following website:
http://chroma.gs.washington.edu/outreach/genetics/sickle/worksheet.html
Protein Synthesis Resources:
1. Allows you to build a protein from a DNA strand online: http://gslc.genetics.utah.edu/units/basics/transcribe/
2. List of useful sites that are genetics related: http://www.kumc.edu/gec/lessons.html