Download Evidence for Evolution Resources

Station 1:
What is a Fossil?
A fossil is the remains or the impression of a prehistoric organism preserved or cast in rock. Paleontologists study fossils to learn more
about what happened on Earth before the written record. Scientists are able to use fossils to identify how old the Earth is, when and
where certain life forms arose, and how they are all related to one another. Two of the most common methods scientists use to
determine the age of fossils are through examining geological strata, and through radiometric dating.
Examining Geological Strata- Over the course of millions of
years the Earth’s outer crust has accumulated many layers of
rock and debris. These layers are called strata. Through a
number of methods, scientists have determined exactly how old
many of these layers are. They have basically created a
calendar for themselves in the layers of the Earth’s crust. When
fossils are found in these identified layers, we can infer that the
organism died sometime close to the date of that layer.
Radiocarbon Dating – Most organic material (anything that
was once alive) contains carbon, including fossils left behind by
ancient organisms. An isotope of carbon, called carbon-14, is
radioactive, and over time it decays into a different form of
carbon. Scientists have determined exactly how long it takes
carbon-14 to decay. By measuring the amount of carbon-14
molecules in a fossil, they are able to measure how long ago
that organism lived. Because carbon-14 eventually decays
completely, this method only works on fossils up to 60,000
years old.
“Lucy”
These are the fossil remains of a hominid (relative of humans)
that lived between 2.9 and 3.9 million years ago. Although she
is quite different from modern day humans, the shape of her
skull, her pelvis, and her knee joint have led paleontologists to
determine that she walked on two legs, not four.
“Lucy’s” Stats:






Species: Australopithecus afarensis
Home: Fossil remains were found in the deserts of
Ethiopia, in Eastern Africa.
Age: Lucy was probably about 25 years old when she
died.
Height: 1.1 meters tall (about 3’7”)
Weight: 29 kilograms (about 67 lb)
Important Features:
o By looking at the space inside of Lucy’s skull,
scientists have determined that her brain was
much smaller than modern humans, and closer
to that of modern chimpanzees.
o Lucy had a wide pelvis that was similar in shape
to modern humans. The shape her pelvis
suggests she walked upright.
o Lucy’s knee joint is a similar shape to modern
humans. It also suggests she walked upright.
o The hole at the base of Lucy’s skull (where the
spinal cord would exit) also suggests she walked
upright.
Chimpanzee
“Lucy” Modern human
Other Fossil Hominids
“Taung child”
Australopithecus africanus
About 2.8 million years old
Discovered in South Africa
Orrorin tugenensis
About 6 million years old
Australopithecus africanus
Between 2.4 and 2.8 million years old
“Hobbit”
Homo floresiensis
About 18,000 years old
Discovered in Indonesia
Homo rudolfensis
About 1.9 million years old
“Ardi”
Ardipithecus ramidus
About 4.4 million years old
Discovered in Ethiopia
Homo erectus
Between 780,000 and 400,000 years old
Discovered in China
Homo habilis
About 1.9 million years old
Discovered in Kenya
Homo neandertalensis
Between 70,000 and 45,000 years old
Discovered in Spain
Station 2:
Examples of Homologous Structures
Homologous structures are physical features of two or more species that they inherited from a common ancestor. Homologous
structures may not necessarily perform the same function, but they share a common ancestral origin.
The bones in the forelimbs of land-dwelling and some aquatic vertebrates (animals with a
backbone) are remarkably similar because they have all evolved from the forelimbs of a common
ancestor. This is an example of homologous structures.
Homologous Structures in Embryos
Many biologists compare the embryos of different
species to identify evolutionary relationships. Look
at these images and notice similarities and differences
across species and at different stages of development.
Homologous structures in plants – One interesting way that plants have evolved and diversified is through their leaves. Although
they may seem different, the venus flytrap, the red “petals” of the poinsettia, the spines on a cactus, and the pine needles on an
evergreen tree are all modified versions of leaves. This means they’re common ancestor was a plant that had leaves.
DNA Comparisons
Station 3:
Scientists study the DNA of many organisms to help determine evolutionary relationships. If two species have the same mutation in the DNA, it is
likely that they evolved from a common ancestor that carried that same mutation. Tracking these mutations in populations can also help scientists
understand how populations moved and migrated around the globe.
Examine the following strands of DNA that came from 5 different species. Look for similarities and differences. Then try to predict how they are
related to each other (from most to least related). Once you have written your prediction on your worksheet, you may check with Ms. Dignan for
the answers.
*Please don’t write on this sheet.
Species 1:
CCAATGGGGCGGGGGCGCTGGGGCTCGCCATATAAGGAGCGGCCTCGCCATAAAAGGAAACATTGTATCTCTTTATA
Species 2:
CCAATCGCAGCGCAGCACTGTGACTCACCATACATGGACAGCCATCACCATATAAGGAAACATCGACTCGCTTTATA
Species 3:
CCAATGGGGCGGGGGCGCTGGGGCTCACCATATAAGGAGCGGCCTCGCCATAAAAGGAAACATTGTATCTCTTTATA
Species 4:
CCAATGGGGCGGGGGCGCTGGGGCTCGCCATATAAGGAGCGGCCTCGCCATAAAAGGAAACATTGTATCTCTTTATA
Species 5:
CCAATCAATAAGCGATACTGTGACTCGCCAAATAAGGAGAGACATCACCAAATAAGGAAGCCTTGTATCTCTTTATA
Answer Key is written in white. Highlight it to see what it is:
Species 1: Rat
Species 2: Zebrafish
Species 3: Human
Species 4: Mouse
Species 5: Blowfish
Station 4:
Vestigial Traits
Vestigial traits are parts of an organisms body that they inherited from their ancestors, but that they no longer use. Because
individuals who carry these traits are not negatively impacted, they continue to exist within the species, even though they are no
longer of any use.
Whales have legs?
Although they never use them, whale
skeletons actually have small pelvic bones
where their evolutionary ancestor’s legs
would have been. This is an example of a
vestigial trait.
Vestigial Traits
Vestigial traits are parts of an organism’s body that they inherited from their ancestors, but that they no longer use. Because
individuals who carry these traits are not negatively impacted, they continue to exist within the species, even they are no longer of
any use.
The appendix: Scientists believe our
evolutionary ancestors needed the appendix
to aid in digesting certain foods. Our diet has
since changed, but we still have this organ. In
some people it can become infected and
needs to be removed.
The tail bone (coccyx): Humans evolved from
other land mammals that had tails. As
humans evolved and started to walk upright,
the tail got in the way and was selected
against. Our tail has decreased to the point
where it’s rarely visible accept for in the
skeleton. This is why we call it our tail bone!