• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
What percentage of students have a dominant learning style
What percentage of students have a dominant learning style

... What is a silent mutation? Mutation that does ...
Human RIF1 and protein phosphatase 1 stimulate DNA replication
Human RIF1 and protein phosphatase 1 stimulate DNA replication

... authors show that the exogenously expressed GFP-RIF1 cDNA in their system does interact with all three isoforms of human PP1 and the mutations in the PP1 binding motifs abolish these PP1 interactions. The authors demonstrate that, like in yeast, human RIF1 and its interaction with PP1 is required fo ...
Pedigree Analysis - Westwind Alternate School
Pedigree Analysis - Westwind Alternate School

... earlier (question 3e) about both parents being affected by an autosomal recessive trait? ...
one-step and stepwise magnification of a bobbed lethal
one-step and stepwise magnification of a bobbed lethal

... regions (Figure lb). Similar observations have been made for other Y chromosomes stained with Hoechst 33258 or quinacrine (GATTI, PIMPINELLI and SANTINI1976; GATTI and PIMPINELLI1983). Three of the one-step y bb" chromosomes, 10, 35 and 48, appeared as acrocentric chromosomes with a uniformly staini ...
Relation of Hemoglobin Measured at Different
Relation of Hemoglobin Measured at Different

... known to have anemia. Those trials that have been conducted have been too small to generate definitive conclusions, and most have been conducted in populations where iron-deficiency anemia is rare (3, 4). Several prospective studies have reported an association between pregnancy anemia and low birth ...
Chromosomes in Saccharomyces cerevisiae
Chromosomes in Saccharomyces cerevisiae

... the products of the mating could grow. Because cells which have lost the marked chromosome III derivative can divide a small number of times on leucine-free medium, the results are expressed as the frequency of chromosome loss (chromosome loss events per cell) rather than the rate of chromosome loss ...
Pedigree Analysis
Pedigree Analysis

... d) How does this conclusion compare with the one you made earlier (question 3e) about both parents being affected by an autosomal recessive trait? ...
Compound heterozygosity of novel missense
Compound heterozygosity of novel missense

... Sequence analysis of the carboxylase and VKORC1 genes The genomic DNA of the proposita and 4 members of her family was isolated from frozen peripheral blood, as described.33 Blood collection was achieved with informed written consent from all donors in accordance with the Helsinki protocol. The stud ...
Pre-Eclampsia – the silent killer
Pre-Eclampsia – the silent killer

... in the latter half of her pregnancy, then the diagnosis is almost always Pre Eclampsia. Some swelling (oedema) is common in normal pregnancy, but excessive swelling which also involves the face can occur in Pre Eclampsia. In severe Pre Eclampsia, symptoms can appear, including severe headaches, vis ...
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS)
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS)

... were then incubated at 55o C in water bath for 10-20 minutes to lyse the WBC and release the DNA The contents were then transferred into sterile eppendorf tubes and 300l of 6M NaCl was added, mixed well and micro-centrifuged at 10,000rpm for 5 minutes to precipitate the proteins. The supernatant co ...
Selection for TnlO Tet Repressor Binding to tet Operator
Selection for TnlO Tet Repressor Binding to tet Operator

... is represented by a linear bar with both the N- and C-terminal ends indicated. The solid portion defines the potential a-helix-turn-ahelix motif, which is thought to be involved in DNA binding (amino acid residues 26 to 47; ISACKSON and BERTRAND1985). The region of the protein for which mutants have ...
by Attila Mokanszki Supervisor: Prof. Dr. Eva Olah
by Attila Mokanszki Supervisor: Prof. Dr. Eva Olah

... 2500 live births. Insufficient functioning of the CFTR protein, which regulates the clorid chanels of plasma membrane, lies in the background of the disease. Profused secretions obstruct the outlets of the exocrin glandulae. Two vas deferens lack in males with congenital bilateral absence of vas def ...
Neonatal Effects of Magnesium Sulfate Given to the Mother
Neonatal Effects of Magnesium Sulfate Given to the Mother

... Our analysis indicates that several neonatal outcomes are significantly related to increasing concentrations of magnesium ion in the maternal circulation. Apgar scores, hypotonia, intubation in the delivery room, and admission to a special care nursery were all increased as the maternal magnesium lev ...
Quantitative analysis of SMN1 and SMN2 genes based on DHPLC
Quantitative analysis of SMN1 and SMN2 genes based on DHPLC

... All of the SMA carriers with SMN1/SMN2 ratios other than one could be identified by this simple but powerful detection system simply by injection of the crude PCR products after specific primer amplification. However, according to the clinical evidence, a small portion of SMA carriers had an SMN1/SM ...
Tryptophan metabolism, disposition and utilization in pregnancy
Tryptophan metabolism, disposition and utilization in pregnancy

... Plasma tryptophan disposition As stated above, the small fraction (5 %–10 %) of circulating Trp that is not albumin-bound is freely available for uptake by organs and tissues. Free Trp is a labile parameter, the concentration of which can be influenced by hormonal, metabolic, nutritional and pharmac ...
Telomere maintenance without telomerase
Telomere maintenance without telomerase

... themselves become hyper-recombinogenic, a point that will be re-addressed later in this review. Although all survivors recovered from an est1-D strain shared common features, such as RAD52dependence and highly dynamic changes at their telomeres, they could be grouped into two classes based on notabl ...
PDF
PDF

... for paracrine secretion) with the prototypical members, FGF1 and 2 (Ornitz and Itoh 2001). During embryonic and fetal development of the mouse, Fgf5 is first expressed in the extraembryonic ectoderm of the epiblast and then restricted to differentiating myotomes, skeletal muscles, and neurons (Haub ...
Fanconi anemia and RAD50 deficiency: genetic and functional
Fanconi anemia and RAD50 deficiency: genetic and functional

... Basic research involving human chromosomal instability and cancer susceptibility syndromes is necessary to gain insights into molecular mechanisms which maintain genomic integrity. The focus of this thesis is directed at the molecular, cellular and clinical aspects of two groups of inherited disease ...
Design-O-Saur - Beyond Benign
Design-O-Saur - Beyond Benign

...  Tell the students that today they will be making another scientific model. This model will allow them to observe the connection between DNA, RNA and amino acid sequences and to see the variation of traits that can occur in the offspring by doing a dihybrid cross or monohybrid cross of the parents. ...
the hemophilia gene, click here
the hemophilia gene, click here

Rubella in pregnancy - Women and Newborn Health Service
Rubella in pregnancy - Women and Newborn Health Service

... having received a rubella vaccine) who contact KEMH after exposure to any person with rash, including rubella (suspected or proven), or if they develop a generalised rash should be advised to see their GP as soon as possible. Blood tests should be taken for rubella and parvovirus IgG and IgM, and a ...
Optimal estimation of diffusion coefficients from single
Optimal estimation of diffusion coefficients from single

... These proofs are not valid here, however, because both these estimators depend nonlinearly on the parameters of interest—the diffusion coefficient D and the variance σ 2 of localization errors—and we show below that OLSF and GLS are suboptimal. The complicated dependence of the MSDs on data makes it ...
Requirement for chitin biosynthesis in epithelial tube morphogenesis. Proc. Natl. Acad. Sci. USA 102: 17014-17019. pdf
Requirement for chitin biosynthesis in epithelial tube morphogenesis. Proc. Natl. Acad. Sci. USA 102: 17014-17019. pdf

... (GCCTCGAGATCCATCAAATCATCAATGAT). The knkGFP genomic construct was generated by PCR of Canton-S genomic DNA using primers Knk-genomic-5⬘-BamHI (ATGAGAGTAAATTATAAACCATGC) and Knk-genomic-3⬘HindIII (AAGCTTGTTCTGGAGCACGAGCCACGG) to amplify the knk genomic locus including ⬇3 kb upstream of the transcript ...
A mixed group ll/group III twintron in the Euglena
A mixed group ll/group III twintron in the Euglena

... rps3 exon 1 PCR deoxyoligonucleotide was used to prime the sequencing reaction by the optimized method of Casanova et al. (19). In order to sequence close to the primer, the Mn + + buffer was included under these conditions. Northern blot analysis 5 tig each of total chloroplast RNA, high molecular ...
Dynamic Changes in Aromatic Hydrocarbon Associated Catabolic
Dynamic Changes in Aromatic Hydrocarbon Associated Catabolic

... Results from this work also indicate that more bcr copies were detected overall within the benzoate microcosms compared to the toluene microcosms. This could reflect the differences in the types of microorganisms present in the two inocula. For example microorganisms present in the river sediment us ...
< 1 2 3 4 5 6 7 8 ... 494 >

Cell-free fetal DNA

Cell-free fetal DNA (cffDNA) is fetal DNA circulating freely in the maternal blood stream. It can be sampled by venipuncture on the mother. Analysis of cffDNA provides a method of non-invasive prenatal diagnosis.cffDNA originates from the trophoblasts making up the placenta. It is estimated that 2-6% of the DNA in the maternal blood is fetal in origin. The fetal DNA is fragmented and makes its way into the maternal bloodstream via shedding of the placental microparticles into the maternal bloodstream (figure 1). Studies have shown that cffDNA can first be observed as early as 7 weeks gestation, and the amount of cffDNA increases as the pregnancy progresses. cffDNA diminishes quickly after the birth of the baby, so that it is no longer detectable in the maternal blood approximately 2 hours after birth. cffDNA is significantly smaller than the maternal DNA in the bloodstream, with fragments approximately 200bp in size. Many protocols to extract the fetal DNA from the maternal plasma use its size to distinguish it from the maternal DNA.Studies have looked at, and some even optimized, protocols for testing non-compatible RhD factors, sex determination for X-linked genetic disorders and testing for single gene disorders. Current studies are now looking at determining aneuploidies in the developing fetus. These protocols can be done earlier than the current prenatal testing methods, and have no risk of spontaneous abortion, unlike current prenatal testing methods. Non-invasive prenatal diagnosis (NIPD) has been implemented in the UK and parts of the US; it has clear benefits above the standard tests of chorionic villi sample (CVS) and amniocentesis which have procedure-related miscarriage risks of about 1 in 100 pregnancies and 1 in 200 pregnancies, respectively.As a method of prenatal diagnosis, cell-free fetal DNA techniques share the same ethical and practical issues, such as the possibility of prenatal sex discernment and sex selection.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report