• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Bench Guide
Bench Guide

... out by ribosomes, which consist of ribosomal RNA (rRNA) and proteins. Amino acids for protein synthesis are delivered to the ribosome on transfer RNA (tRNA) molecules. RNAs are also part of riboproteins involved in RNA processing. In addition, many viruses contain RNA as their genome instead of DNA, ...
Big slides
Big slides

... Chemical Bonds in Biochemistry • The important “molecules of life” are organic compounds • They can be composed of many thousands of atoms chemically joined together. • Even though they are huge…the atoms that comprise them follow the same chemistry as their smaller molecular relatives ...
Review 16-18
Review 16-18

...  A polyA tail is added to 3’end & a cap is added to 5’ end ...
Introduction to Bioinformatics
Introduction to Bioinformatics

... Tertiary Structure  The overall folding of the entire polypeptide chain into a specific 3D shape ...
DNA, RNA, and Protein
DNA, RNA, and Protein

... DNA:5’ TACCGACTTGATCATTTAGGTAGACAT…3’ mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA… • mRNA exits nucleus after processing cap & tail • mRNA on ribosome is translated via tRNAs. • tRNA anticodons pair with mRNA codons (UAA, UAG, UGA). • Each tRNA carries a specific amino acid or a stop signal. ...
Slide 1
Slide 1

... is a minimized RNA which still retains catalytic activity; it has a 16 base “enzyme” strand and a 25 base substrate strand. In the crystal, however, the usual cleavage site at C17, has been replaced with a non-hydrolyzable 2’ deoxy nucleotide. The structure shows a “gamma” shaped molecule, with stem ...
1 - gcisd
1 - gcisd

... a. Find the definition of both and then explain how they are related to each other 10. KNOW ABOUT MRNA’S ROLE IN REPRODUCTION a. Where is it generated or made? The nucleus b. Where does it go after it is made? The cytoplasm c. What is its main job? To make a copy of DNA’s code to build proteins d. H ...
Evolucijska genomika 2
Evolucijska genomika 2

...  Stretches of DNA that are transcribed into RNA, then spliced out during RNA processing.  Contain functional elements such as splicing signals, regulatory promoters, and other genes.  Evolve very rapidly in size and content.  Constitute 26%, 11%, and 24% of the nematode, fly, and human genomes. ...
Protein Synthesis & Mutation
Protein Synthesis & Mutation

... • 1940’s: Beadle & Tatum; Neurospora crassa (mold) produce thousands of offspring; some cannot grow on traditional food source = nutritional mutants – Could these mutants lack an enzyme? ...
Document
Document

... gene expression • Only about 1.5% of the human genome codes for proteins. (This is also true of many other multicellular eukaryotes.) • Another small fraction of DNA consists of genes for ribosomal RNA and transfer RNA. • A flood of recent data suggests that a significant amount of the remaining gen ...
Welcome to Biology 11
Welcome to Biology 11

... acids  The amino acids link together to form a chain  These long chains of amino acids fold up in a very specific way  The differences between proteins is the sequence of the amino acids and how they are folded up ...
Interfering with the genome: A new generation of disease treatments
Interfering with the genome: A new generation of disease treatments

... type of genetic material called RNA. Like DNA, RNA is comprised of nucleic acids, although RNA nucleic acids are subtly different from those of DNA. When a gene is being expressed, the relevant section of the DNA molecule unwinds to expose the underlying code, and RNA nucleic acids then create an in ...
Players in the protein game
Players in the protein game

... microscope but in order to see the DNA you have to have a high powered mircroscope ...
Review L14 Gene to Protein L15 Gene Reg
Review L14 Gene to Protein L15 Gene Reg

... elongation and termination). Be sure to include the following: promoter, RNA polymerase, nucleotides, transcription factors, TATA box, polyadenylation signal sequence). 8. What are the cap and tail added to mRNA made of? What are their function? 9. Make a drawing that clearly shows RNA splicing. Inc ...
Nucleic Acids Powerpoint
Nucleic Acids Powerpoint

... • Nucleic acids are large biomolecules (polymers) – essential for all known forms of life • Include DNA and RNA • Made from long strands of nucleotides (monomers) – A nucleotide contains a 5-carbon sugar, a phosphate group, and a nitrogenous base – The nitrogeneous bases are connected by the sugar ...
Slayt 1
Slayt 1

...  Simultaneous; m-RNAs are short-lived (afew minutes)  No splicing  M-RNA is not polyadenylated  No IRES in eukaryotes  No introns in prokayotes (except some bacteriophages) ...
Protein Synthesis A gene is a segment of DNA that is located on a
Protein Synthesis A gene is a segment of DNA that is located on a

... a. mRNA enters the ribosome. b. rRNA reads the mRNA strand and assists in the assembly of proteins c. tRNA has a 3 nucleotide anticodon on one end and its corresponding amino acid attached to its other end. It gets the amino acid from the cytosol. d. tRNA carrying the amino acid methionine at one en ...
Central dogma: from genome to proteins
Central dogma: from genome to proteins

... DNA transcription produces a single-stranded RNA molecule, complementary to one strand of DNA ...
5. Protein Synthesis
5. Protein Synthesis

... 5. Information flows from DNA to ________ to proteins. 6. What holds base pairs together? 7. What is the process of a cells making an exact copy of its DNA called? 8. What is a codon? 9. What is an anticodon and where is it found? 10. Briefly describe transcription. 11. Briefly describe translation. ...
RNA polymerase
RNA polymerase

... • Messenger RNA (mRNA) – strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription • RNA polymerase – main enzyme that catalyses the formation of mRNA from a DNA template • Sense strand – strand of nucleotides containing the instructi ...
Chapter 15
Chapter 15

... expect high or low levels of error in transcription as compared with DNA replication? Why do you think it is more important for DNA polymerase than for RNA polymerase to proofread? (Page 283) Answer: One would expect higher amounts of error in transcription over DNA replication. Proofreading is impo ...
The Origins of Life
The Origins of Life

... • If a trait occurs in all three domains it belonged to the cenancestor . …. or …. • If it occurs in two of the domains but not the 3rd , we can infer that the trait occurred in the most recent common ancestor and was lost in one of the lineages. • Otherwise the trait would have had to arise 2 or 3 ...
Document
Document

... 5. Which scientific term describes the shape of the DNA molecule? 6. What process forms messenger RNA? 7. Describe the role of the following RNA molecules in the production of proteins: (Ch. 11.2) mRNA: ___________________________________________________ tRNA: _______________________________________ ...
Name Class ______ Date ______ The Genetic Code 1. Genetic
Name Class ______ Date ______ The Genetic Code 1. Genetic

... Name _____________________________ Class __________ Date __________ 9. A researcher identifies the nucleotide sequence AAC in a long strand of RNA inside a nucleus. In the genetic code, AAC codes for the amino acid asparagine. When the RNA becomes involved in protein synthesis, will asparagines nec ...
Sentence Synthesis Instructions RNA polymerase Instructions, cont
Sentence Synthesis Instructions RNA polymerase Instructions, cont

... DNA in the nucleus (my lab bench) into mRNA. Remember that DNA cannot leave the nucleus. ...
< 1 ... 123 124 125 126 127 128 129 130 131 ... 137 >

History of RNA biology

Numerous key discoveries in biology have emerged from studies of RNA (ribonucleic acid), including seminal work in the fields of biochemistry, genetics, microbiology, molecular biology, molecular evolution and structural biology. As of 2010, 30 scientists have been awarded Nobel Prizes for experimental work that includes studies of RNA. Specific discoveries of high biological significance are discussed in this article.For related information, see the articles on History of Molecular Biology and History of Genetics. For background information, see the articles on RNA and nucleic acid.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report