
20.15 Enhancers contain the same elements that are
... itself of course lacks the ability to activate either sort of target. The LexA-GAL4 hybrid can no longer activate a gene with a UAS, but it can now activate a gene that has a LexA operator! This result fits the modular view of transcription activators. The DNA-binding domain serves to bring the prot ...
... itself of course lacks the ability to activate either sort of target. The LexA-GAL4 hybrid can no longer activate a gene with a UAS, but it can now activate a gene that has a LexA operator! This result fits the modular view of transcription activators. The DNA-binding domain serves to bring the prot ...
On the maintenance of allozyme and inversion polymorphisms in
... If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons ...
... If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons ...
DNA breathing dynamics distinguish binding from nonbinding
... fragments contain the flanking sequence (CCT) on both ends to minimize end wobbling. The gel shift results are consistent between three independent experiments. The gel shift reactions are conducted at 37 C. RESULTS LMD simulations distinguish true YY1 binding from nonbinding sites in the human PLG ...
... fragments contain the flanking sequence (CCT) on both ends to minimize end wobbling. The gel shift results are consistent between three independent experiments. The gel shift reactions are conducted at 37 C. RESULTS LMD simulations distinguish true YY1 binding from nonbinding sites in the human PLG ...
Molecular and Cellular Biology, September 2000, p
... control of a specific group of genes encoding chromatin-associated proteins (such as H10), these molecules may regulate chromatin structure and function. Transcription factors interacting with the H10 promoter are presumably part of this regulatory cascade and are believed to link cell cycle control ...
... control of a specific group of genes encoding chromatin-associated proteins (such as H10), these molecules may regulate chromatin structure and function. Transcription factors interacting with the H10 promoter are presumably part of this regulatory cascade and are believed to link cell cycle control ...
RHD - Labex
... The importance of the Rh factor was the better blood finger print for criminal matters M, N, or P factors where known and Rh factor was just an additional one Later it was recognized that the new Rh factor was associated with problem in transfusions Between 1940 to 1946 Philip Levine discove ...
... The importance of the Rh factor was the better blood finger print for criminal matters M, N, or P factors where known and Rh factor was just an additional one Later it was recognized that the new Rh factor was associated with problem in transfusions Between 1940 to 1946 Philip Levine discove ...
Introduction and Preliminaries - Department of Computer and
... Genome Rearrangement Can we use the solutions of sequence alignment to solve this problem? Answer: NO, because: Genome is a very long strings (3 million letters for a human genome Model of sequence alignment is not appropriate for human genome comparison since the differences are not in ter ...
... Genome Rearrangement Can we use the solutions of sequence alignment to solve this problem? Answer: NO, because: Genome is a very long strings (3 million letters for a human genome Model of sequence alignment is not appropriate for human genome comparison since the differences are not in ter ...
srep09383-s1
... Introduction of the ami and srf gene clusters into heterologous Bacillus hosts. The self-replicable constructs pCAPB1-ami/srf were transferred to five Bacillus host strains including three B. subtilis strains (JH642+sfp, ROM77, and 168) and two B. thuringiensis strains (GBJ001 and BMB171) 5, 6 from ...
... Introduction of the ami and srf gene clusters into heterologous Bacillus hosts. The self-replicable constructs pCAPB1-ami/srf were transferred to five Bacillus host strains including three B. subtilis strains (JH642+sfp, ROM77, and 168) and two B. thuringiensis strains (GBJ001 and BMB171) 5, 6 from ...
Real time PCR based determination of gene copy numbers in
... previously for other host systems such as animal and plant cells but no such method ...
... previously for other host systems such as animal and plant cells but no such method ...
Large-Scale Variation Among Human and Great Ape Genomes
... comparative genomic hybridization (array CGH), measuring copy-number gains and losses among these species. Using an array of 2460 human bacterial artificial chromosomes (BACs) (12% of the genome), we identified a total of 63 sites of putative DNA copy-number variation between humans and the great ap ...
... comparative genomic hybridization (array CGH), measuring copy-number gains and losses among these species. Using an array of 2460 human bacterial artificial chromosomes (BACs) (12% of the genome), we identified a total of 63 sites of putative DNA copy-number variation between humans and the great ap ...
Specific oligonucleotide primers for detection of endoglucanase
... endoglucanase gene of B. subtilis, G. stearothermophilus and P. campinasensis. Two PCR primers, EN1F and EN1R, were chosen that were predicted to specifically amplify a 1,311 bpDNA fragment of the B. Subtilis, G. stearothermophilus and P. campinasensis. The Genbank database (NCBI) search for complim ...
... endoglucanase gene of B. subtilis, G. stearothermophilus and P. campinasensis. Two PCR primers, EN1F and EN1R, were chosen that were predicted to specifically amplify a 1,311 bpDNA fragment of the B. Subtilis, G. stearothermophilus and P. campinasensis. The Genbank database (NCBI) search for complim ...
Development of Zinc Finger Domains for Recognition of the 5
... gests that DNA binding is predominantly achieved by the interaction of amino acid residues of the ␣-helix in positions ⫺1, 3, and 6 with the 3⬘, middle, and 5⬘ nucleotides of a 3-bp DNA subsite, respectively (11, 12). Positions 1, 2, and 5 of the ␣-helix make direct or water-mediated contacts with t ...
... gests that DNA binding is predominantly achieved by the interaction of amino acid residues of the ␣-helix in positions ⫺1, 3, and 6 with the 3⬘, middle, and 5⬘ nucleotides of a 3-bp DNA subsite, respectively (11, 12). Positions 1, 2, and 5 of the ␣-helix make direct or water-mediated contacts with t ...
Comparison of three molecular methods for typing Aeromonas
... we evaluated the results obtained by pairing the different methods. Results obtained when combining ISR-RFLP and REP, ISR-RFLP and ERIC (data not shown) or ERIC and REP (Figure 4), produced a clear differentiation among all the strains. These results suggest that to avoid misinterpretations in epide ...
... we evaluated the results obtained by pairing the different methods. Results obtained when combining ISR-RFLP and REP, ISR-RFLP and ERIC (data not shown) or ERIC and REP (Figure 4), produced a clear differentiation among all the strains. These results suggest that to avoid misinterpretations in epide ...
pdf
... utiblized the same techniques that we discussed previously for mapping the binding site of RNA polymerase on the promoter, e.g. electrophoretic mobility shift assays (does the DNA fragment bind?), DNase footprints (where does the protein bind?) and methylation interference assays (methylation of whi ...
... utiblized the same techniques that we discussed previously for mapping the binding site of RNA polymerase on the promoter, e.g. electrophoretic mobility shift assays (does the DNA fragment bind?), DNase footprints (where does the protein bind?) and methylation interference assays (methylation of whi ...
Expression of the Mitochondrial ATPase6 Gene and Tfam in Down
... cDNA synthesis and PCR amplification of cDNATwo sets of oligonucleotide primers for regions of the mitochondrial ATPase6 gene and one set for the Tfam gene region were designed from published DNA sequences (Table 1). RT-PCR was performed using the SuperScript Preamplification System for First Stran ...
... cDNA synthesis and PCR amplification of cDNATwo sets of oligonucleotide primers for regions of the mitochondrial ATPase6 gene and one set for the Tfam gene region were designed from published DNA sequences (Table 1). RT-PCR was performed using the SuperScript Preamplification System for First Stran ...
PDF
... Japan) as specified by manufacturer, with primers Lig1-attB1, 5⬘GGGGACAAGTTTGTACAAAAAAGCAGGCTGATTAGTCTGGAGGTCTTGTCGCTC-3⬘ and Lig1-attB2, 5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTAATCATCGTCACCTTTGACTTCATTAC-3⬘. In the latter primer the stop codon TGA was removed. BAC T6D22 containing At1g08130 was used as th ...
... Japan) as specified by manufacturer, with primers Lig1-attB1, 5⬘GGGGACAAGTTTGTACAAAAAAGCAGGCTGATTAGTCTGGAGGTCTTGTCGCTC-3⬘ and Lig1-attB2, 5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTAATCATCGTCACCTTTGACTTCATTAC-3⬘. In the latter primer the stop codon TGA was removed. BAC T6D22 containing At1g08130 was used as th ...
Identification of markers tightly linked to tomato yellow
... The tomato (Solanum lycopersicon) is an economically important species of the Solanaceae family, and it is cultivated all over the world for human consumption. Recently, tomato crops have often been infected by tomato yellow leaf curl virus (TYLCV), which causes significant yield losses in tomato (S ...
... The tomato (Solanum lycopersicon) is an economically important species of the Solanaceae family, and it is cultivated all over the world for human consumption. Recently, tomato crops have often been infected by tomato yellow leaf curl virus (TYLCV), which causes significant yield losses in tomato (S ...
Nucleolar caspase-2: Protecting us from DNA damage
... camptothecin, a similar phenotype to what they observed with PIDD depletion by siRNA. Supporting this observation, NPM1 depletion inhibited caspase-2 cleavage after DNA damage in ...
... camptothecin, a similar phenotype to what they observed with PIDD depletion by siRNA. Supporting this observation, NPM1 depletion inhibited caspase-2 cleavage after DNA damage in ...
Molecular events during translocation and proofreading extracted
... the polymerase active site prior to the reaction. Second, the enzyme translocates by one nucleotide space along the single-stranded DNA template after a correct incorporation. Third, if an incorrect nucleotide is accidentally incorporated into the primer, the 3 terminus of the primer is switched to ...
... the polymerase active site prior to the reaction. Second, the enzyme translocates by one nucleotide space along the single-stranded DNA template after a correct incorporation. Third, if an incorrect nucleotide is accidentally incorporated into the primer, the 3 terminus of the primer is switched to ...
AP & Regents Biology
... 1. The mechanism of action of restriction enzymes 2. The different results you would expect if a mutation occurred at the recognition site for enzyme Y. ...
... 1. The mechanism of action of restriction enzymes 2. The different results you would expect if a mutation occurred at the recognition site for enzyme Y. ...
beckwith-wiedemann syndrome
... chromosome 11p15 that are subject to imprinting. Most autosomal genes are expressed from both the paternally and maternally derived alleles; however imprinted genes are expressed in a parent of origin specific manner. Several imprinted genes on chromosome 11p15.5 have been implicated in BWS: ...
... chromosome 11p15 that are subject to imprinting. Most autosomal genes are expressed from both the paternally and maternally derived alleles; however imprinted genes are expressed in a parent of origin specific manner. Several imprinted genes on chromosome 11p15.5 have been implicated in BWS: ...
Aberrant replication timing induces defective chromosome
... The origin recognition complex (ORC) is composed of six subunits, ORC1–6 [1]. ORCs have been identified in yeast, flies, frogs, mice and humans [2], and several of the homologous subunits or even whole complexes are functionally interchangeable between species, suggesting a high degree of conservati ...
... The origin recognition complex (ORC) is composed of six subunits, ORC1–6 [1]. ORCs have been identified in yeast, flies, frogs, mice and humans [2], and several of the homologous subunits or even whole complexes are functionally interchangeable between species, suggesting a high degree of conservati ...
Gene Regulatory Network of Ikaros in T cell development and
... risks of relapse of leukemia and poor outcome of therapy. However, it remains unclear about the gene regulatory network associated with Ikaros. How exactly the transcription of Ikaros itself is regulated? Ikaros can positively or negatively regulate its target genes, and how Ikaros' activity is regu ...
... risks of relapse of leukemia and poor outcome of therapy. However, it remains unclear about the gene regulatory network associated with Ikaros. How exactly the transcription of Ikaros itself is regulated? Ikaros can positively or negatively regulate its target genes, and how Ikaros' activity is regu ...
RecA maintains the integrity of chloroplast DNA molecules in
... Fig. 2. The effect of a T-DNA insertion in cpRecA on cpDNA amount and structure. (A) PFGE of cpDNA obtained from an equal volume of pelleted chloroplasts from wt and cprecA mutant plants after staining with ethidium bromide. (B) Blot hybridization of the gel in (A) with a petA probe. Immature, entir ...
... Fig. 2. The effect of a T-DNA insertion in cpRecA on cpDNA amount and structure. (A) PFGE of cpDNA obtained from an equal volume of pelleted chloroplasts from wt and cprecA mutant plants after staining with ethidium bromide. (B) Blot hybridization of the gel in (A) with a petA probe. Immature, entir ...
Chapter 2: Introduction to Molecular Genetics
... transcribe it into RNA, and regulate the transcriptional process (central dogma of molecular biology – see later). Proteins are long chains of amino acids An amino acids being an organic compound containing amongst others an amino group (NH2) and a carboxylic acid group (COOH)) [Think of aminco ...
... transcribe it into RNA, and regulate the transcriptional process (central dogma of molecular biology – see later). Proteins are long chains of amino acids An amino acids being an organic compound containing amongst others an amino group (NH2) and a carboxylic acid group (COOH)) [Think of aminco ...
Week 2. DNA isolation and PCR
... begins with having the students volunteer similarities and differences between PCR and DNA replication. I like to show the PCR video (https://www.youtube.com/watch?v=2KoLnIwoZKU) in the laboratory and provide my own commentary to ensure that students understand the PCR process. As a class, I then as ...
... begins with having the students volunteer similarities and differences between PCR and DNA replication. I like to show the PCR video (https://www.youtube.com/watch?v=2KoLnIwoZKU) in the laboratory and provide my own commentary to ensure that students understand the PCR process. As a class, I then as ...