
The scope of Population Genetics Forces acting on allele
... Why the Poisson distribution fits badly • Time to common ancestry for a random pair of alleles is distributed exponentially. • So the Poisson parameter varies from one region to another. • Because the time to common ancestry varies widely, the expected number of segregating mutations varies widely a ...
... Why the Poisson distribution fits badly • Time to common ancestry for a random pair of alleles is distributed exponentially. • So the Poisson parameter varies from one region to another. • Because the time to common ancestry varies widely, the expected number of segregating mutations varies widely a ...
Microbiology
... (Qiagen), according to the manufacturer’s recommendations. Total RNA was checked on-gel and stored at 220 uC. The amount of isolated RNA was measured at OD480 using an Ultrospec 2100pro photospectrometer (Amersham Biosciences). Reverse transcription, followed by RT-PCR, was performed using an RT-PCR ...
... (Qiagen), according to the manufacturer’s recommendations. Total RNA was checked on-gel and stored at 220 uC. The amount of isolated RNA was measured at OD480 using an Ultrospec 2100pro photospectrometer (Amersham Biosciences). Reverse transcription, followed by RT-PCR, was performed using an RT-PCR ...
European Journal of Soil Science
... this, bacterial sequences deposited in Genbank were examined in silico to determine their expected tRFs for the restriction enzymes employed. This resulted in a data set consisting of the lengths of up to 13 restriction fragments indicative of known bacterial DNA sequences. This data set can also be ...
... this, bacterial sequences deposited in Genbank were examined in silico to determine their expected tRFs for the restriction enzymes employed. This resulted in a data set consisting of the lengths of up to 13 restriction fragments indicative of known bacterial DNA sequences. This data set can also be ...
Comparative analysis of the Geobacillus hemicellulose utilization locus reveals a highly
... Background: Members of the thermophilic genus Geobacillus can grow at high temperatures and produce a battery of thermostable hemicellulose hydrolytic enzymes, making them ideal candidates for the bioconversion of biomass to value-added products. To date the molecular determinants for hemicellulose ...
... Background: Members of the thermophilic genus Geobacillus can grow at high temperatures and produce a battery of thermostable hemicellulose hydrolytic enzymes, making them ideal candidates for the bioconversion of biomass to value-added products. To date the molecular determinants for hemicellulose ...
Supplementary Table 1: WormBase IDs and given
... polymerase PrimeSTAR™ (Takara Mirus Bio, Madison, WI) with primer pairs 9060 (GCGGATCCTGAACAGCATGGCAACCAACTG) and 7154 (TGTACTTTTCCCCTCTTGTGAAC), 7153 (CATTTTATGCAGAGTTCGAGTCAC) and 7152 (GAAGAGTGGCGGTAAAATTCGG), and 7151 (TCTTCTAACTCTCGGGCCATTTG) and 7150 (TAACATCCAAAAGCAGTAACATCC). The 2.2 kb frag ...
... polymerase PrimeSTAR™ (Takara Mirus Bio, Madison, WI) with primer pairs 9060 (GCGGATCCTGAACAGCATGGCAACCAACTG) and 7154 (TGTACTTTTCCCCTCTTGTGAAC), 7153 (CATTTTATGCAGAGTTCGAGTCAC) and 7152 (GAAGAGTGGCGGTAAAATTCGG), and 7151 (TCTTCTAACTCTCGGGCCATTTG) and 7150 (TAACATCCAAAAGCAGTAACATCC). The 2.2 kb frag ...
Selecting an Ontology for Biomedical Text Mining He Tan, Patrick Lambrix Abstract
... a direct and confident decision. Also, in many cases there exist gold standards or benchmarks which we can use to evaluate our application. Therefore, the purpose of component 3 is to evaluate the use of ontologies in a real system. This component could provide a relatively straightforward method fo ...
... a direct and confident decision. Also, in many cases there exist gold standards or benchmarks which we can use to evaluate our application. Therefore, the purpose of component 3 is to evaluate the use of ontologies in a real system. This component could provide a relatively straightforward method fo ...
Lack of expression of XIST from a small ring X chromosome
... of patients with small ring X chromosomes lacking the XIST locus, a critical player in the process of X chromosome inactivation. Surprisingly, in our patient, fluorescent in situ hybridisation demonstrated that the XIST locus was present on the ring X. However, expression studies showed that there w ...
... of patients with small ring X chromosomes lacking the XIST locus, a critical player in the process of X chromosome inactivation. Surprisingly, in our patient, fluorescent in situ hybridisation demonstrated that the XIST locus was present on the ring X. However, expression studies showed that there w ...
PDF
... Isotope labeling studies in Nicotiana plumbaginifolia suspension cells have shown that methyl groups released from nicotine by N-demethylation find their way into many primary metabolites, such as Met and Ser, suggesting that they re-enter the C1-folate pool (Mesnard et al., 2002; Bartholomeusz et a ...
... Isotope labeling studies in Nicotiana plumbaginifolia suspension cells have shown that methyl groups released from nicotine by N-demethylation find their way into many primary metabolites, such as Met and Ser, suggesting that they re-enter the C1-folate pool (Mesnard et al., 2002; Bartholomeusz et a ...
Pain Genes?: Natural Variation and Transgenic Mutants
... the disruption or mutation of which might significantly affect the incidence of pain as a disease. Our aim in this review is to consider the involvement of genes in the mediation of pain. In addition to highlighting a few profound examples in which a particular pain syndrome in humans has been linke ...
... the disruption or mutation of which might significantly affect the incidence of pain as a disease. Our aim in this review is to consider the involvement of genes in the mediation of pain. In addition to highlighting a few profound examples in which a particular pain syndrome in humans has been linke ...
Gene Section TSHR (thyroid stimulating hormone receptor) Atlas of Genetics and Cytogenetics
... Miccoli P, Pacini F. Genetic analysis of the TSH receptor gene in differentiated human thyroid carcinomas. J Endocrinol ...
... Miccoli P, Pacini F. Genetic analysis of the TSH receptor gene in differentiated human thyroid carcinomas. J Endocrinol ...
powerpoint
... protein-coding sequence may block protein production • Insertion of transposable elements within a regulatory sequence may increase or decrease protein production © 2005 Pearson Education, Inc. publishing as Benjamin Cummings ©Copyright 2011 Pearson Education, Inc. ...
... protein-coding sequence may block protein production • Insertion of transposable elements within a regulatory sequence may increase or decrease protein production © 2005 Pearson Education, Inc. publishing as Benjamin Cummings ©Copyright 2011 Pearson Education, Inc. ...
Rolling circle transcription on smallest size double stranded DNA
... Transcription kinetics of the RNAP T7 on small circular templates .................................................. 30 Summary and prospects .................................................................................................................... 35 Materials and methods ................ ...
... Transcription kinetics of the RNAP T7 on small circular templates .................................................. 30 Summary and prospects .................................................................................................................... 35 Materials and methods ................ ...
p16INK4a immunocytochemical analysis is an
... have shown that p16INK4a protein expression in leukemic cells is a complex phenomenon and can be altered not only by gene deletion but also by promoter methylation and other, unknown mechanisms.18-21 We also observed, both in adult ALL and in the present pediatric study, that a few samples of leukem ...
... have shown that p16INK4a protein expression in leukemic cells is a complex phenomenon and can be altered not only by gene deletion but also by promoter methylation and other, unknown mechanisms.18-21 We also observed, both in adult ALL and in the present pediatric study, that a few samples of leukem ...
Biology: semester one: course outline
... List the components of the endomembrane system, and describe the structure and function of each component. Understand means of intracellular digestion by lysosomes. Understand the roles of vacuoles. Be able to explain the energy conversions carried out by mitochondria and chloroplasts. Describe the ...
... List the components of the endomembrane system, and describe the structure and function of each component. Understand means of intracellular digestion by lysosomes. Understand the roles of vacuoles. Be able to explain the energy conversions carried out by mitochondria and chloroplasts. Describe the ...
A genome screen for linkage in Australian sibling-pairs with
... a number of interesting immunological candidates. For example, IL-2 and IL-21 which are both involved in T and B cell proliferation map to chromosome 4q26-27, while the cluster of genes for the immunoglobulin kappa light chain and CD8 are encoded at chromosome 2p12. These candidates are worthy of fu ...
... a number of interesting immunological candidates. For example, IL-2 and IL-21 which are both involved in T and B cell proliferation map to chromosome 4q26-27, while the cluster of genes for the immunoglobulin kappa light chain and CD8 are encoded at chromosome 2p12. These candidates are worthy of fu ...
UNUSUAL FLORAL ORGANS Controls Meristem ldentity and Organ
... three times during the growth of an individual plant, with each coflorescence phase being separated by one to five Ufo-1 flowers. As in CL, all apical meristems terminate in carpel-like structures. Bracts or filamentous structures and stipules subtend most Ufo-1 flowers. Typically, morphologically n ...
... three times during the growth of an individual plant, with each coflorescence phase being separated by one to five Ufo-1 flowers. As in CL, all apical meristems terminate in carpel-like structures. Bracts or filamentous structures and stipules subtend most Ufo-1 flowers. Typically, morphologically n ...
Technical standards and guidelines for spinal muscular atrophy testing
... that the neuronal population is more sensitive to decreases in the SMN protein level. Possibly, the altered splicing of a unique set of premessenger RNAs results in deficient proteins, which are necessary for motor neuron growth and survival. In addition to its role in spliceosomal ribonucleoprotein ...
... that the neuronal population is more sensitive to decreases in the SMN protein level. Possibly, the altered splicing of a unique set of premessenger RNAs results in deficient proteins, which are necessary for motor neuron growth and survival. In addition to its role in spliceosomal ribonucleoprotein ...
Hypoxia-inducible factor 1 is a new target of microphthalmia
... through PKA and CREB activation, increases the expression of the melanocyte-specific form of microphthalmia-associated transcription factor (MITF) (Bertolotto et al., 1998a), a basic helix-loop-helix transcription factor that plays a key role not only in melanin synthesis, but also in melanocyte dev ...
... through PKA and CREB activation, increases the expression of the melanocyte-specific form of microphthalmia-associated transcription factor (MITF) (Bertolotto et al., 1998a), a basic helix-loop-helix transcription factor that plays a key role not only in melanin synthesis, but also in melanocyte dev ...
by Vanessa Di Gioacchino A thesis submitted to the Department of Biology
... Goα47A is a candidate gene in a putative haloperidol-affected pathway that is highly expressed in the nervous system. The gene encodes nine transcripts and two isoforms, which are 98% identical and differ only in the N-terminal region. However, the individual roles for each of the two different prot ...
... Goα47A is a candidate gene in a putative haloperidol-affected pathway that is highly expressed in the nervous system. The gene encodes nine transcripts and two isoforms, which are 98% identical and differ only in the N-terminal region. However, the individual roles for each of the two different prot ...
Assaying … promoter activity
... …the plasmid integrated into the genome by homologous recombination with the nimB and ORF5468 gene. We tested the stability of the integrated plasmid via a true breeding experiment. In this experiment, recombinant cells were grown at the non-permissive temperature in the absence of antibiotic select ...
... …the plasmid integrated into the genome by homologous recombination with the nimB and ORF5468 gene. We tested the stability of the integrated plasmid via a true breeding experiment. In this experiment, recombinant cells were grown at the non-permissive temperature in the absence of antibiotic select ...
Characterization of microbial activity in the surface layers of a
... seconds) and subsequent increases were slight. 3HDNA measurements, on the other hand, were unaffected by the adsorbed adenine and hence no corrective measures were required. Consequently, w e have more confidence in the DNA rate determinations. Overall, the results from the abiotic binding experimen ...
... seconds) and subsequent increases were slight. 3HDNA measurements, on the other hand, were unaffected by the adsorbed adenine and hence no corrective measures were required. Consequently, w e have more confidence in the DNA rate determinations. Overall, the results from the abiotic binding experimen ...
Phage
... multiply inside bacteria by making use of some or all of the host biosynthetic machinery • Significance – Models for animal cell viruses – Gene transfer in bacteria – Medical applications • Identification of bacteria - phage typing • Treatment and prophylaxsis??? ...
... multiply inside bacteria by making use of some or all of the host biosynthetic machinery • Significance – Models for animal cell viruses – Gene transfer in bacteria – Medical applications • Identification of bacteria - phage typing • Treatment and prophylaxsis??? ...
RNA-Seq

RNA-seq (RNA sequencing), also called whole transcriptome shotgun sequencing (WTSS), is a technology that uses the capabilities of next-generation sequencing to reveal a snapshot of RNA presence and quantity from a genome at a given moment in time.