K - FJchimie11
... Diffusion and osmosis share many similarities. In both diffusion and osmosis, molecules move around to create equilibrium. It is a passive movement of molecules from high concentration to low concentration. However, there are some key differences between the two. Osmosis involves only water. Osmosis ...
... Diffusion and osmosis share many similarities. In both diffusion and osmosis, molecules move around to create equilibrium. It is a passive movement of molecules from high concentration to low concentration. However, there are some key differences between the two. Osmosis involves only water. Osmosis ...
Units of Life
... 2. Calvin Cycle (the synthesis part) This uses the NADPH2 and ATP (energy) a. Carbon dioxide is captured from the air and fixed into a molecule (CO2 fixation) b. The Calvin cycle reduces the fixed carbon with the hydrogen from the NADPH2 changing it back to NADP and using energy of ATP This is a cy ...
... 2. Calvin Cycle (the synthesis part) This uses the NADPH2 and ATP (energy) a. Carbon dioxide is captured from the air and fixed into a molecule (CO2 fixation) b. The Calvin cycle reduces the fixed carbon with the hydrogen from the NADPH2 changing it back to NADP and using energy of ATP This is a cy ...
Cells - Fort Bend ISD
... No Ribosomes are found on the surface. Synthesizes lipids, fatty acids, and steroids Plays an important part in Carbohydrate metabolism Enzymes in the Smooth ER detoxify drugs ...
... No Ribosomes are found on the surface. Synthesizes lipids, fatty acids, and steroids Plays an important part in Carbohydrate metabolism Enzymes in the Smooth ER detoxify drugs ...
Cellular Transport PowerPoint
... from over-expanding. In plants the pressure exerted on the cell wall is called tugor pressure. •A protist like paramecium has contractile vacuoles that collect water flowing in and pump it out to prevent them from over-expanding. •Salt water fish pump salt out of their specialized gills so they do n ...
... from over-expanding. In plants the pressure exerted on the cell wall is called tugor pressure. •A protist like paramecium has contractile vacuoles that collect water flowing in and pump it out to prevent them from over-expanding. •Salt water fish pump salt out of their specialized gills so they do n ...
REVIEW SHEET.acp_Cells
... ! Compare and contrast the four different microscopes. ! Differentiate between magnification and resolution. ! Calculate the total magnification of a light compound microscope. ! Calculate the field of view under hig ...
... ! Compare and contrast the four different microscopes. ! Differentiate between magnification and resolution. ! Calculate the total magnification of a light compound microscope. ! Calculate the field of view under hig ...
Plant cells
... What do animal cells look like? • Animal cells tend to be sphere or round shaped. • Animal cells have: -cell membrane to hold the cell together, -cytoplasm a watery gel inside the cell, -nucleus with a nuclear membrane, and -sometimes small vacuoles where food and chemicals are stored. ...
... What do animal cells look like? • Animal cells tend to be sphere or round shaped. • Animal cells have: -cell membrane to hold the cell together, -cytoplasm a watery gel inside the cell, -nucleus with a nuclear membrane, and -sometimes small vacuoles where food and chemicals are stored. ...
Origin of Eukaryotic Cells
... that the prokaryotic cell membrane invaginated (folded inward) to enclose copies of its genetic material (figure 1b). This invagination re- ...
... that the prokaryotic cell membrane invaginated (folded inward) to enclose copies of its genetic material (figure 1b). This invagination re- ...
Exocytosis and Endocytosis
... and withdraw patches of the plasma membrane New membrane proteins and lipids are made in the ER, modified in Golgi bodies, and form vesicles that fuse with plasma membrane ...
... and withdraw patches of the plasma membrane New membrane proteins and lipids are made in the ER, modified in Golgi bodies, and form vesicles that fuse with plasma membrane ...
The Cell (including cell division)
... just before nuclear division, chromatin condenses into chromatids (so they won’t break apart during division) and are held together by centromeres. ...
... just before nuclear division, chromatin condenses into chromatids (so they won’t break apart during division) and are held together by centromeres. ...
NQ Cells
... harvests energy from organic material. Muscles use a lot of energy- so a muscle cell has to have numerous mitochondria. (Mitochondria is the plural – a single one is a mitochondrion) Mitochondria are about the size of a bacterial cell. ...
... harvests energy from organic material. Muscles use a lot of energy- so a muscle cell has to have numerous mitochondria. (Mitochondria is the plural – a single one is a mitochondrion) Mitochondria are about the size of a bacterial cell. ...
Cell Transport Review_Answers
... a) a protein carrier must be at work b) the cell membrane is partly composed of lipid molecules c) the cell is expending energy to do this d) phagocytosis has enclosed this molecule in a vacuole 15.Which of these does not require an expenditure of energy? a) diffusion b) osmosis c) facilitated tran ...
... a) a protein carrier must be at work b) the cell membrane is partly composed of lipid molecules c) the cell is expending energy to do this d) phagocytosis has enclosed this molecule in a vacuole 15.Which of these does not require an expenditure of energy? a) diffusion b) osmosis c) facilitated tran ...
Name________________________ Quarter Final 1—Study Guide
... a. Carbon atoms can bond to one another and form a lot of different structures. b. Carbon atoms have four valence electrons and can form quadruple bonds. c. Only carbon atoms can form covalent bonds with oxygen and hydrogen. d. Only carbon atoms can be dissolved in water solutions and suspensions. ...
... a. Carbon atoms can bond to one another and form a lot of different structures. b. Carbon atoms have four valence electrons and can form quadruple bonds. c. Only carbon atoms can form covalent bonds with oxygen and hydrogen. d. Only carbon atoms can be dissolved in water solutions and suspensions. ...
Botany
... layers. Cellulose polymers associate through H bonds. The H bonding of many cellulose molecules to each results in the formation of microfibers and the microfibers can interact to form fibers. Certain cells, like those in cotton ...
... layers. Cellulose polymers associate through H bonds. The H bonding of many cellulose molecules to each results in the formation of microfibers and the microfibers can interact to form fibers. Certain cells, like those in cotton ...
plant, animal, and Fungus
... • Diffusion - the process by which molecules spread from areas of high concentration, to areas of low concentration. When the molecules are even throughout a space - it is called EQUILIBRIUM ...
... • Diffusion - the process by which molecules spread from areas of high concentration, to areas of low concentration. When the molecules are even throughout a space - it is called EQUILIBRIUM ...
HOW CELLS FUNCTION – Practice Questions 1. Which process
... carbohydrates, they can use a reserve source of energy in the form of a. lipids b. glucose c. chlorophyll d. glycogen 23. Which of these molecules hold the instructions for the growth and development of cells? a. amino acids b. lipids c. enzymes d. nucleic acids 24. How does the polarity of water mo ...
... carbohydrates, they can use a reserve source of energy in the form of a. lipids b. glucose c. chlorophyll d. glycogen 23. Which of these molecules hold the instructions for the growth and development of cells? a. amino acids b. lipids c. enzymes d. nucleic acids 24. How does the polarity of water mo ...
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`
... 6a. If molecule #4a was destined to be secreted from the cell and used elsewhere in the body, what kind of ribosome would be involved in its translation? a bound ribosome (bound to RER) b. ...
... 6a. If molecule #4a was destined to be secreted from the cell and used elsewhere in the body, what kind of ribosome would be involved in its translation? a bound ribosome (bound to RER) b. ...
plant cells
... viruses differ in complexity and general structure. d. the central dogma of molecular biology outlines the flow of information from transcription of ribonucleic acid (RNA) in the nucleus to translation of proteins on ribosomes in the cytoplasm. e. the role of the endoplasmic reticulum and Golgi appa ...
... viruses differ in complexity and general structure. d. the central dogma of molecular biology outlines the flow of information from transcription of ribonucleic acid (RNA) in the nucleus to translation of proteins on ribosomes in the cytoplasm. e. the role of the endoplasmic reticulum and Golgi appa ...
Prokaryotic Eukaryotic
... •cells cells with a distinct nucleus that encases their DNA •can can be single single-celled organisms or multi-celled •contain contain membrane bound organelles •in in multi multi-celled, cells work together to perform a specialized function (tissues) •ex. ex. Kingdom Protista, Fungi, Plantae, Anim ...
... •cells cells with a distinct nucleus that encases their DNA •can can be single single-celled organisms or multi-celled •contain contain membrane bound organelles •in in multi multi-celled, cells work together to perform a specialized function (tissues) •ex. ex. Kingdom Protista, Fungi, Plantae, Anim ...