Tearing down barriers: understanding the
... actively growing organs, under short- (6 h) and long- (2 d or 4 d) term and low (10 mM) and high (50 mM) doses of Cd, of unreduced gametes that might eventually lead to viable triploid intermediates able to backcross or self-fertilize to through a Methylation-Sensitive Amplification Polymorphism tec ...
... actively growing organs, under short- (6 h) and long- (2 d or 4 d) term and low (10 mM) and high (50 mM) doses of Cd, of unreduced gametes that might eventually lead to viable triploid intermediates able to backcross or self-fertilize to through a Methylation-Sensitive Amplification Polymorphism tec ...
Supplementary Figure Legends - Word file
... transcription site (purple). Three theoretical positions of the episomes in 3D7/upsC are shown (1-3). Postion 1 (transcriptionally inactive zone) does not occur since parasites would be unable to survive blasticidin-S treatment. The silenced episome assumes position 2 (transcriptionally active regio ...
... transcription site (purple). Three theoretical positions of the episomes in 3D7/upsC are shown (1-3). Postion 1 (transcriptionally inactive zone) does not occur since parasites would be unable to survive blasticidin-S treatment. The silenced episome assumes position 2 (transcriptionally active regio ...
Twinning and Embryonic Left-Right Asymmetry
... body plan is often thought of as being fundamentally different from the dorso-ventral and antero-posterior axes because of the symmetry which it exhibits when viewed from the outside. Interestingly though, the internal organs of most animals reveal an individually and evolutionarily conserved asymme ...
... body plan is often thought of as being fundamentally different from the dorso-ventral and antero-posterior axes because of the symmetry which it exhibits when viewed from the outside. Interestingly though, the internal organs of most animals reveal an individually and evolutionarily conserved asymme ...
Noradrenaline and hsp70 expression in mollusc immune cells
... Furthermore, exposure of hemocytes to NA or to the αINTRODUCTION The induction of ‘heat shock’ or ‘stress’ proteins represents a homeostatic defense mechanism of cells in response to metabolic and environmental insults. Heat shock proteins (hsp) are encoded by a family of highly conserved genes pres ...
... Furthermore, exposure of hemocytes to NA or to the αINTRODUCTION The induction of ‘heat shock’ or ‘stress’ proteins represents a homeostatic defense mechanism of cells in response to metabolic and environmental insults. Heat shock proteins (hsp) are encoded by a family of highly conserved genes pres ...
Selection against migrant pathogens: the - Université Paris-Sud
... habitats rather than on true reproductive isolation, which are two distinct phenomena. It has been known for a while that strong selection allows maintenance of adaptive polymorphism when a single adaptive locus is involved (Levene, 1953) but that reproductive isolation does not necessarily follow. ...
... habitats rather than on true reproductive isolation, which are two distinct phenomena. It has been known for a while that strong selection allows maintenance of adaptive polymorphism when a single adaptive locus is involved (Levene, 1953) but that reproductive isolation does not necessarily follow. ...
model for Escherichia coli chromosome packaging supports
... dispersion from their site of transcription (19). The high localization of mRNA implies that chromosome architecture might act as a spatial organizer, which compartmentalizes the cell interior such that dedicated (regulatory) proteins are produced within those subcellular regions, where their regula ...
... dispersion from their site of transcription (19). The high localization of mRNA implies that chromosome architecture might act as a spatial organizer, which compartmentalizes the cell interior such that dedicated (regulatory) proteins are produced within those subcellular regions, where their regula ...
NeuroGeM, a knowledgebase of genetic modifiers
... The collected data of genetic modifiers allows us to identify relevant biological processes that are enriched within genetic modifiers, and genes in these processes can be prioritized for drug screens or for testing in other organisms. For this analysis, we categorized genetic modifiers according to ...
... The collected data of genetic modifiers allows us to identify relevant biological processes that are enriched within genetic modifiers, and genes in these processes can be prioritized for drug screens or for testing in other organisms. For this analysis, we categorized genetic modifiers according to ...
Agilent Whole Human Genome Oligo Microarray Kit
... than one consensus region will be selected for a given GeneBin. Figure A demonstrates the selection of consensus regions and probes to represent transcripts within a GeneBin. The transcripts (shown at the top of the diagram in green) are used to determine the location of consensus regions (shown in ...
... than one consensus region will be selected for a given GeneBin. Figure A demonstrates the selection of consensus regions and probes to represent transcripts within a GeneBin. The transcripts (shown at the top of the diagram in green) are used to determine the location of consensus regions (shown in ...
Human Insulin-Receptor Gene
... centromere and -10-15 x lo6 base pairs (bp) from the hlNSR gene (18). Most of the hlNSR gene has been isolated as a series of overlapping DNA fragments in the bacteriophage-A (19). These fragments span a region of >130,000 bp, which includes both the gene and flanking regions (Fig. 1). We have seque ...
... centromere and -10-15 x lo6 base pairs (bp) from the hlNSR gene (18). Most of the hlNSR gene has been isolated as a series of overlapping DNA fragments in the bacteriophage-A (19). These fragments span a region of >130,000 bp, which includes both the gene and flanking regions (Fig. 1). We have seque ...
Reactome Functional Interaction (FI) Network
... Output: list of genes that show significant changes in expression. Downstream analysis: 1. Validation of the top genes sorted by fold-change (or p-value): artificial cut-off, information loss; 2. Manual reviewing and gene classification based on literature, databases and own prior experience: time-c ...
... Output: list of genes that show significant changes in expression. Downstream analysis: 1. Validation of the top genes sorted by fold-change (or p-value): artificial cut-off, information loss; 2. Manual reviewing and gene classification based on literature, databases and own prior experience: time-c ...
Document
... 1.1 Background Next generation parallel sequencing technologies make m6A-specific methylated RNA immunoprecipitation followed by sequencing a popular strategy to study transcriptome-wide RNA modifications, while creating challenges for analysis , especially in peak-finding. However, there have been ...
... 1.1 Background Next generation parallel sequencing technologies make m6A-specific methylated RNA immunoprecipitation followed by sequencing a popular strategy to study transcriptome-wide RNA modifications, while creating challenges for analysis , especially in peak-finding. However, there have been ...
The ARG9 Gene Encodes the Plastid-Resident N
... Moreover, the frequency of codons in the Chlamydomonas plastid genes made it likely that the Arabidopsis cDNA would be translated by the set of plastid tRNAs. Using an existing spectinomycin resistance cassette (aadA) for plastid transformation, we designed an arg9c (c for chloroplast) cassette for ...
... Moreover, the frequency of codons in the Chlamydomonas plastid genes made it likely that the Arabidopsis cDNA would be translated by the set of plastid tRNAs. Using an existing spectinomycin resistance cassette (aadA) for plastid transformation, we designed an arg9c (c for chloroplast) cassette for ...
DROSOPHILA: GENETICS MEETS BEHAVIOUR
... genes affect behavioural processes. Insights into the genetic and molecular bases of natural variation can be gained from: first, studying naturally occurring behavioural variants30; second, studying naturally occurring behavioural variants that carry variations in a gene first identified through mu ...
... genes affect behavioural processes. Insights into the genetic and molecular bases of natural variation can be gained from: first, studying naturally occurring behavioural variants30; second, studying naturally occurring behavioural variants that carry variations in a gene first identified through mu ...
Additional data file 9
... are expressed non-exclusively in the imaginal primordia, with additional expression most commonly in the CNS and Ectoderm/Epidermis. Besides the well known imaginal disc embryonic markers, snail (sna), escargot (esg) and Distal-less (Dll) eyeless (ey) and apterous (ap), we discovered CG13894 (THAP ...
... are expressed non-exclusively in the imaginal primordia, with additional expression most commonly in the CNS and Ectoderm/Epidermis. Besides the well known imaginal disc embryonic markers, snail (sna), escargot (esg) and Distal-less (Dll) eyeless (ey) and apterous (ap), we discovered CG13894 (THAP ...
Ch. 2
... • A different inheritance pattern is seen when a person inherits heterozygous alleles in which one allele is stronger than the other yet does not completely dominate. – For example: sickle cell anemia Kuther, Lifespan Development. © 2017, SAGE Publications. ...
... • A different inheritance pattern is seen when a person inherits heterozygous alleles in which one allele is stronger than the other yet does not completely dominate. – For example: sickle cell anemia Kuther, Lifespan Development. © 2017, SAGE Publications. ...
Expression Profiling of Fixed and Unfixed Tissue - Sigma
... cDNA made with the ABI kit, except for beta -actin. Representation was the same between 5 and 100 ng starting total RNA 4. TransPlex gave better array and Q - PCR results with much less input and with much less effort and time than using standard IVT. 5. TransPlex performed very well for degraded RN ...
... cDNA made with the ABI kit, except for beta -actin. Representation was the same between 5 and 100 ng starting total RNA 4. TransPlex gave better array and Q - PCR results with much less input and with much less effort and time than using standard IVT. 5. TransPlex performed very well for degraded RN ...
Development of a DNA vaccine against chicken anemia virus by
... IL-6 which play critical role in differentiation of CD4+ T cells into Th1 or Th2 cells, transcriptional expression of these cytokines were evaluated in the spleen of the immunized chickens by RT-PCR using the specific primers 5 ACACATCTGATGAAGCACTGCC3 and 5 TTGGGATATGTCCAGGTCACAG3 for IL-12 (Acce ...
... IL-6 which play critical role in differentiation of CD4+ T cells into Th1 or Th2 cells, transcriptional expression of these cytokines were evaluated in the spleen of the immunized chickens by RT-PCR using the specific primers 5 ACACATCTGATGAAGCACTGCC3 and 5 TTGGGATATGTCCAGGTCACAG3 for IL-12 (Acce ...
The Genetic Basis of Inheritance
... trait is used to represent the dominant allele The recessive allele is then lower case of the same letter (e.g. T for tall, so t for short) Each characteristic can be represented by a pair of letters representing the genes Some multi-allele systems (more than 2 possible forms of the trait) use diffe ...
... trait is used to represent the dominant allele The recessive allele is then lower case of the same letter (e.g. T for tall, so t for short) Each characteristic can be represented by a pair of letters representing the genes Some multi-allele systems (more than 2 possible forms of the trait) use diffe ...
Identification of R-Gene Homologous DNA Fragments Genetically
... Col×Ler population of recombinant inbred lines (RILs) available for mapping (Lister and Dean 1993). For the PCR, degenerate primers RG1 and RG2 were used whose sequences were based on the conserved P-loop and domain 5 region of the NBS in the N, L6, and RPS2 R-genes from tobacco, flax, and A. thalia ...
... Col×Ler population of recombinant inbred lines (RILs) available for mapping (Lister and Dean 1993). For the PCR, degenerate primers RG1 and RG2 were used whose sequences were based on the conserved P-loop and domain 5 region of the NBS in the N, L6, and RPS2 R-genes from tobacco, flax, and A. thalia ...
An assessment of the risks associated with the
... deleted, or have their expression altered, to add, remove, or enhance a particular trait (e.g. improved seed yield, shorter stems that better resist wind damage, herbicide resistance, frost resistance, salt tolerance, etc.). Unlike traditional crop development methods, the use of genetic modificatio ...
... deleted, or have their expression altered, to add, remove, or enhance a particular trait (e.g. improved seed yield, shorter stems that better resist wind damage, herbicide resistance, frost resistance, salt tolerance, etc.). Unlike traditional crop development methods, the use of genetic modificatio ...
C. elegans Life Cycle
... Description of genome Life cycle and anatomy Precise patterns of cell lineage throughout development Techniques of genetic and molecular analysis Specification of early embryonic blastoderms Role of programmed cell death Timing of decision during larval development ...
... Description of genome Life cycle and anatomy Precise patterns of cell lineage throughout development Techniques of genetic and molecular analysis Specification of early embryonic blastoderms Role of programmed cell death Timing of decision during larval development ...
Survival of the Sickest Reading Guide
... 48. How does streptococcus cause your body to attack itself? 49. Define xenophobia and how does it affect the spread of disease? 50. What is virulence? 51. Describe three ways microbes move from host to host. 52. How can we treat pathogens by changing their evolutionary path? 53. What does vaccine l ...
... 48. How does streptococcus cause your body to attack itself? 49. Define xenophobia and how does it affect the spread of disease? 50. What is virulence? 51. Describe three ways microbes move from host to host. 52. How can we treat pathogens by changing their evolutionary path? 53. What does vaccine l ...
Gene expression profiling
In the field of molecular biology, gene expression profiling is the measurement of the activity (the expression) of thousands of genes at once, to create a global picture of cellular function. These profiles can, for example, distinguish between cells that are actively dividing, or show how the cells react to a particular treatment. Many experiments of this sort measure an entire genome simultaneously, that is, every gene present in a particular cell.DNA microarray technology measures the relative activity of previously identified target genes. Sequence based techniques, like serial analysis of gene expression (SAGE, SuperSAGE) are also used for gene expression profiling. SuperSAGE is especially accurate and can measure any active gene, not just a predefined set. The advent of next-generation sequencing has made sequence based expression analysis an increasingly popular, ""digital"" alternative to microarrays called RNA-Seq. However, microarrays are far more common, accounting for 17,000 PubMed articles by 2006.