• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
TRANSLASI - alanindra
TRANSLASI - alanindra

... • In prokaryotes, ribosomes bind to specific translation initiation sites. There can be several different initiation sites on a messenger RNA: a prokaryotic mRNA can code for several different proteins. Translation begins at an AUG codon, or sometimes a GUG. The modified amino acid Nformyl methionin ...
Chapter 14 – RNA molecules and RNA processing
Chapter 14 – RNA molecules and RNA processing

... polypeptide ...
Making Proteins - Hbwbiology.net
Making Proteins - Hbwbiology.net

... 3. RNA polymerase adds and then links complementary RNA nucleotides as it reads the gene, using covalent bonds, at about 60 nucleotides per second.. Transcription continues until a "stop" signal from a sequence of bases, RNA polymerase detaches and releases the RNA molecule. Behind RNA polymerase, t ...
DNA Test Review
DNA Test Review

... 1. What are the four nucleotides in DNA? Which goes with which? 2. Describe the Central Dogma of molecular biology. 3. If a DNA molecule has the sequence TACGAACCC, what would be the complimentary mRNA sequence? 4. The process by which a DNA molecule is copied is called _____. 5. What is a codon? 6. ...
DNA and PROTEIN SYNTHESIS DNA, functioning as the hereditary
DNA and PROTEIN SYNTHESIS DNA, functioning as the hereditary

... One strand of the exposed DNA, the DNA template, will pair with the free RNA nucleotides, eventually making the mRNA molecule. The opposite exposed strand of DNA does not participate. Free RNA nucleotides in the nucleus pair up with the exposed template strand of the DNA. Remind yourself that in a d ...
Chen-6-Translation
Chen-6-Translation

... A repeated experience ...
Mechanism of Translation
Mechanism of Translation

... 4. How are the termination codons different from other codons? A) They contain thymines. B) The termination codon always codes for methionine. C) They are not recognized by any tRNA molecules. D) Their conformations do not allow them to fit properly in the A site of the ribosome. ...
Unit 9 Test Review
Unit 9 Test Review

... • Why are the messenger RNA molecules received by eukaryotic ribosomes shorter than the messenger RNA molecules formed by transcription of DNA? • A. Base deletion mutations make the mRNA shorter. • B. Start codons are not at the end of the mRNA molecule. • C. Introns are removed before the RNA is t ...
Lesson6.5_Translation Process
Lesson6.5_Translation Process

... How does translation occur? 1. The ribosome attaches to the mRNA molecule. 2. The tRNA attaches to the mRNA. The tRNA anticodon attaches to the mRNA codon. 3. The first two amino acids are joined/connected and the first tRNA leaves, and the ribosome moves along the mRNA to the next codon ...
DNA  RNA  Proteins - Aurora City School
DNA RNA Proteins - Aurora City School

...  2.A large ribosomal subunit binds to the smaller one, creating a function ribosome. The initiator tRNA fits into tRNA binding site (P site) on the ribosome. A site is vacant and ready for the next amino-acid carrying tRNA. ...
Genetic Code and Transcription
Genetic Code and Transcription

... Translational Initiation • Small subunit and initiator tRNA bind to start codon. – tRNAi is in P site • Large subunit binds clamping down on mRNA • GTP is hydrolyzed to allow large subunit binding ...
15 points each
15 points each

... A. when it causes sickle-cell disease B. when a stop codon is coded for instead of Methionine C. when the mRNA sequence begins with the mutation D. when the point mutation still codes for the same amino acid. ...
Translation
Translation

... Transcription occurs in the ________, creating a single stranded ________. This _______ contains the Nitrogen base ______ instead of __________. Word Bank: Uracil, DNA, mRNA, Adenine, Guanine, Nucleus, Cytoplasm, Thymine ...
5` cap Large subunit attaches
5` cap Large subunit attaches

... Central Dogma DNA=genotype Transcription RNA= the messenger Translation Polypeptide= phenotype ...
Build a Paper Model of Transfer RNA (tRNA)
Build a Paper Model of Transfer RNA (tRNA)

... double line (16 total). Be careful not to cut through the entire strip. ...
Select one of your Biology instructors from another class and look
Select one of your Biology instructors from another class and look

... sequence of four ribonucleotides, all with equal frequency, what is the probability that any three adjacent nucleotides will be a start codon? A stop codon? In an mRNA molecule of random sequence, what is the average distance between stop codons? 8.2 If DNA consisted of only two nucleotides (say, A ...
Decoding DNA
Decoding DNA

... Use your knowledge of transcription and translation to decode this secret message! STEP 1: “Build” a mRNA molecule that is complimentary to the DNA molecule, base pair by base pair. (REMEMBER: in RNA, adenine pairs with uracil) STEP 2: Determine the tRNA codons that would compliment with the mRNA st ...
Document
Document

... The required signal sequence for a protein to enter the ER is 15– 30 N-terminal amino acids. As the signal sequence is produced by translation, it is bound by a signal recognition particle (SRP) composed of RNA and protein. The SRP suspends translation until the complex binds a docking protein on th ...
How cells use DNA, part 1: TRANSCRIPTION
How cells use DNA, part 1: TRANSCRIPTION

...  DNA students and mRNA students remain in nucleus during transcription. After transcription, mRNA students move into cytoplasm, where tRNA students are waiting for translation.  DNA students begin by writing down the complimentary RNA sequence to their DNA sequence (transcription). They then searc ...
WS 8 – 3: Translation and Protein Synthesis Name
WS 8 – 3: Translation and Protein Synthesis Name

... DNA is the molecule of life. It contains genes that provide the code to make proteins that control an organism’s functions. It is shaped like a double helix which allows it to replicate itself. Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a ...
tacaatccgttat g c cactcatgattagagtcgcgg gatt
tacaatccgttat g c cactcatgattagagtcgcgg gatt

... DNA is the molecule of life. It contains genes that provide the code to make proteins that control an organism’s functions. It is shaped like a double helix which allows it to replicate itself. Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a ...
AP Protein Synthesis Quiz
AP Protein Synthesis Quiz

... b. a single gene codes for a single polypeptide chain, and many enzymes are made up of more than one polypeptide chain. c. many genes code for RNA molecules that have no enzymatic activity. d. A and B only e. A, B, and C 2. Which of the following represents a similarity between RNA and DNA? a. Both ...
Chapter 14 Review
Chapter 14 Review

... tRNA; mRNA; nucleotide; amino acid; polypeptide. Please underline each vocabulary word used. • Three nucleotides on mRNA is a codon, which are complementary to anticodons on tRNA. Each tRNA molecule carries a specific amino acid, which are joined by bonds to form a polypeptide chain. ...
Alien Protein Synthesis
Alien Protein Synthesis

... Genes are the units that determine inherited characteristics, like hair color and blood type. Genes are composed of DNA. The DNA code is based on a triplet of nitrogen bases. Each triplet code corresponds to a specific amino acid. Amino acids combine to form proteins. In a process known as transcrip ...
Worksheet 13.2
Worksheet 13.2

... Biology Honors I! ...
< 1 ... 60 61 62 63 64 65 66 67 68 ... 84 >

Transfer RNA



A transfer RNA (abbreviated tRNA and archaically referred to as sRNA, for soluble RNA) is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length, that serves as the physical link between the mRNA and the amino acid sequence of proteins. It does this by carrying an amino acid to the protein synthetic machinery of a cell (ribosome) as directed by a three-nucleotide sequence (codon) in a messenger RNA (mRNA). As such, tRNAs are a necessary component of translation, the biological synthesis of new proteins according to the genetic code.The specific nucleotide sequence of an mRNA specifies which amino acids are incorporated into the protein product of the gene from which the mRNA is transcribed, and the role of tRNA is to specify which sequence from the genetic code corresponds to which amino acid. One end of the tRNA matches the genetic code in a three-nucleotide sequence called the anticodon. The anticodon forms three base pairs with a codon in mRNA during protein biosynthesis. The mRNA encodes a protein as a series of contiguous codons, each of which is recognized by a particular tRNA. On the other end of the tRNA is a covalent attachment to the amino acid that corresponds to the anticodon sequence. Each type of tRNA molecule can be attached to only one type of amino acid, so each organism has many types of tRNA (in fact, because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which also carry the same amino acid).The covalent attachment to the tRNA 3’ end is catalyzed by enzymes called aminoacyl tRNA synthetases. During protein synthesis, tRNAs with attached amino acids are delivered to the ribosome by proteins called elongation factors (EF-Tu in bacteria, eEF-1 in eukaryotes), which aid in decoding the mRNA codon sequence. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3’ end to the amino acid attached to the 3’ end of the newly delivered tRNA, a reaction catalyzed by the ribosome.A large number of the individual nucleotides in a tRNA molecule may be chemically modified, often by methylation or deamidation. These unusual bases sometimes affect the tRNA's interaction with ribosomes and sometimes occur in the anticodon to alter base-pairing properties.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report