• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Davis
Davis

... – Two-hybrid confirms mass spec – Homology searching finds homology of one to ribosomal recycling factor ...
Functional Genetic Analysis Request Form
Functional Genetic Analysis Request Form

... (TSC1, TSC2, DEPDC5, NPRL2, NPRL3, AKT1, AKT3, TBC1D7) mTOR complex 1 (TORC1) activity assay Signaling complex interaction test ...
Evolutionary history of the Rh blood group
Evolutionary history of the Rh blood group

... regions from African clawed frog and Japanese medaka fish, and examined the long-term evolution of the Rh blood group and related genes. We constructed the phylogenetic tree from amino acid sequences. Rh50 genes of African clawed frog and Japanese medaka fish formed a cluster with mammalian Rh50 gen ...
How many molecules of water needed to break a triglyceride?
How many molecules of water needed to break a triglyceride?

... How many water molecules would be needed to break this polymer? How many water molecules produced in making this polymer? ...
Biology 20 Fall 2001 Lecture #2 Jan 11, 2001
Biology 20 Fall 2001 Lecture #2 Jan 11, 2001

... Sizing agent (to make materials like cloth and paper) stiff and smooth, and as a hydrogel - “water modifying agent” - a thickener for mixtures. As structure : cellulose in cell walls - similar chemistry as starch but not readily digested by most organisms Proteins : chains of amino acids (amino acid ...
Bacterial Evasion of Host Immune Responses - Assets
Bacterial Evasion of Host Immune Responses - Assets

... antibacterial protection comes from individuals with deficiencies in individual complement genes (Table 4.2). Such genetic deficiencies can be broadly divided into seven categories: (i) classical pathway genes, (ii) mannose-binding lectin, (iii) alternative pathway genes, (iv) C3, (v) genes encoding ...
Physicochemical Analysis of the Interaction between Epstein
Physicochemical Analysis of the Interaction between Epstein

... mutant of the parent protein and is colored according to the physiological charge associated with the amino acid: blue for positively charged residues and red for negatively charged residues. The lines are terminated with circles that indicate the distance the particular residue is from the interact ...
Plant-Based Biopharmaceutical Production under Controlled
Plant-Based Biopharmaceutical Production under Controlled

... the plague (Y. pestis) This will be done using plant-made pharmaceuticals grown under a controlled environment ...
Recombinant Human GM-CSF (CSF2) Recombinant
Recombinant Human GM-CSF (CSF2) Recombinant

... Lyophilized from a 0.2 µm filtered solution in Tris and NaCl ...
Introduction to the Immune System
Introduction to the Immune System

... leukocytes bind complement proteins CR2: surface of B cells and dendritic cells. Binding of activated complement fragments to CR2 amplifies antigen-induced cellular activation - provides a link between the innate and acquired immune systems. ...
Mechanisms of Bacterial Virulence
Mechanisms of Bacterial Virulence

... • Serum resistance is usually one of the major virulence factors differentiating invasive ...
Chromosomes and Human Inheritance
Chromosomes and Human Inheritance

... molecule in red blood cells) causes red blood cells to “sickle”  Carried by 1/12 African Americans  Carriers are healthy but are highly resistant to malaria. ...
Recombinant Human MOG, His tagged
Recombinant Human MOG, His tagged

... It is recommended that sterile water be added to the vial to prepare a stock solution. Centrifuge the vial at 4ºC before opening to recover the entire contents. ...
SAR650984 binding and activity on human blood cells
SAR650984 binding and activity on human blood cells

... An expression plasmid was constructed that allows expression of amino acids 44-300 of human CD38 fused to the Fc portion of murine IgG2a. The CD38-Fc fusion protein was expressed by transient transfection in HEK-293T cells using the CalPhos Mammalian Transfection Kit according to the manufacturer’s ...
Essential nutrients
Essential nutrients

... The proteins in our bodies are made from a combination of building blocks called amino acids. ...
Mutations in the mechanotransduction protein
Mutations in the mechanotransduction protein

... homozygosity on chromosome 16 starting after 87445363 (last heterozygous SNP), before 87445839 (first homozygous SNP) and extending to 90109711, the last called SNP at the telomeric end of chromosome 16 (Figure 1). This region contains 100 homozygous SNPs. There are 3 possible heterozygous SNPs at t ...
PLASMA PROTEINS AND IMMUNOGLOBULINES – An Overview
PLASMA PROTEINS AND IMMUNOGLOBULINES – An Overview

... • Characteristic changes in amount of certain plasma proteins are seen after Surgery or Trauma, or during Infection or Tumor growth: • Proteins involved are called Acute Phase Proteins; • Acute Phase Protein response leads to greatly increased De Novo biosynthesis (mainly in Liver) of some plasma p ...
Name: Date: ______ Pd:_____ Modeling Protein Synthesis : Your
Name: Date: ______ Pd:_____ Modeling Protein Synthesis : Your

... A B blood (red blood cells contain A antigens and B antigens on its cell surface) o ATGTAAACCACTACATAG -(A antigen) o ATGAGAAGTAGGAGAAGCATAATCTAG -(B antigen) A and Rh+ blood (red blood cells contain A antigens and Rh+ antigens on its cell surface) o ATGTAAACCACTACATAG -(A antigen) o ATGATTCAACACATC ...
Protein Structure and Function - Wk 1-2
Protein Structure and Function - Wk 1-2

... acid residues extending outward from the axis of the spiral. Each amide carbonyl group is hydrogen-bonded to the amide hydrogen of a peptide bond that is four residues away along the same chain. There are on average 3.6 amino acid residues per turn of the helix, and the helix winds in a right-handed ...
Test Info Sheet
Test Info Sheet

... ATP2A2 gene located on chromosome 12q23-q24.1 (Sakuntabhai et al. 1999). Inheritance pattern: Autosomal Dominant Gene/Protein: ATP2A2 spans about 70 kb and has 21 coding exons. The gene encodes 3 known alternative splice variants differing in their C-terminal sequence, of which only SERCA2b is expre ...
crassirostris
crassirostris

...  Three forms in Eukaryotic Nuclei ▪ RNA Pol I –Pre-rRNA ▪ RNA Pol II**--Pre-mRNA ▪ RNA pol III –Pre-tRNA ...
Recombinant Human GM-CSF
Recombinant Human GM-CSF

... The lyophilized Recombinant human GM-CSF is very soluble in water and most aqueous buffers below and above the isoelectric point (pI=4.95). ...
1-1 - Test Bank Easy
1-1 - Test Bank Easy

... chloroplast are no longer encoded by their respective DNAs, these genes have not been lost. Instead, these “missing genes” are now in the DNA of the eucaryotic host-cell nucleus. Thus, the mitochondria and the chloroplasts are now symbionts that require their host cells for survival. ...
Bacterial complement evasion
Bacterial complement evasion

... disulfide bond and associated by non-covalent forces (Janssen et al., 2005). One of the most intriguing features of C3 is its ability to attach covalently to acceptor molecules on cells surfaces. This property is derived from the presence of an intramolecular thioester bond within the C3d region. Th ...
Chapter 4: Modification of Mendelian Ratios
Chapter 4: Modification of Mendelian Ratios

... considered LETHAL and the organism will not survive. The time of death is dependent on when the product is needed. Example: Huntington’s Disease ...
< 1 ... 24 25 26 27 28 29 30 31 32 ... 39 >

Complement component 4



Complement component 4 is a protein involved in the complement system.It is cleaved into proteins 4a and 4b; 4b can be further cleaved into 4c and 4d. C4a is an anaphylatoxin. C4b forms part of C3-convertase, in conjunction with 2a: C4b can bind CR1.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report