Control of Gene Expression
... – Operon: series of genes that code for specific products, including regulators that control whether these genes are transcribed • Example: lac operon (bacteria) – genes for lactose metabolism only activated if lactose is present (when lactose not present, a repressor blocks transcription; if presen ...
... – Operon: series of genes that code for specific products, including regulators that control whether these genes are transcribed • Example: lac operon (bacteria) – genes for lactose metabolism only activated if lactose is present (when lactose not present, a repressor blocks transcription; if presen ...
Slide 1
... On the lagging strand replication also occurs in the 5’3’direction. This results in the formation of fragments, between 1000 and 2000 nucleotide long. These fragments are called Okazaki Fragments and are later joined together by DNA ...
... On the lagging strand replication also occurs in the 5’3’direction. This results in the formation of fragments, between 1000 and 2000 nucleotide long. These fragments are called Okazaki Fragments and are later joined together by DNA ...
DNA: Transcription & Translation
... • mRNA: transports information from DNA from the nucleus to the cell’s cytoplasm • rRNA: (makes up ribosomes): clamps on to mRNA and reads its information to assemble amino acids in the correct order • tRNA: transports amino acids to the ribosomes to be assembled into proteins ...
... • mRNA: transports information from DNA from the nucleus to the cell’s cytoplasm • rRNA: (makes up ribosomes): clamps on to mRNA and reads its information to assemble amino acids in the correct order • tRNA: transports amino acids to the ribosomes to be assembled into proteins ...
lecture_11(LP)
... Given that many different genes are involved in adenine biosynthesis, what do all of these enzymes “look” like? --how are they different? --what is the sequence of amino acids? --what is their 3-D structure? --how do the enzymes work? --do humans have the same enzymes as yeast? ...
... Given that many different genes are involved in adenine biosynthesis, what do all of these enzymes “look” like? --how are they different? --what is the sequence of amino acids? --what is their 3-D structure? --how do the enzymes work? --do humans have the same enzymes as yeast? ...
Genetics 314 – Spring 2007
... different sequences for initiation and termination of transcription and translation. To make sure you get expression of a gene you need to have the proper promoter, leader and termination sequences to match the organisms enzymes involved in transcription and translation. 6. If a chemical was discove ...
... different sequences for initiation and termination of transcription and translation. To make sure you get expression of a gene you need to have the proper promoter, leader and termination sequences to match the organisms enzymes involved in transcription and translation. 6. If a chemical was discove ...
DNA - Dickinson ISD
... - 2 illustrations that supplement the summary - Cite where you got the information from (may print a copy of article) ...
... - 2 illustrations that supplement the summary - Cite where you got the information from (may print a copy of article) ...
Stable Nuclear Transformation of the diatom Phaeodactylum
... worked better at level 2 with supercoiled DNA. ...
... worked better at level 2 with supercoiled DNA. ...
protein synthesis lab
... To define different types of mutations. To understand the three types of point mutations; silent, missense, and nonsense. To understand how an addition or deletion of a nucleotide causes a frameshift mutation. To understand the four types of chromosomal mutations; deletion, duplication, inversion, t ...
... To define different types of mutations. To understand the three types of point mutations; silent, missense, and nonsense. To understand how an addition or deletion of a nucleotide causes a frameshift mutation. To understand the four types of chromosomal mutations; deletion, duplication, inversion, t ...
File - Biology withMrs. Ellsworth
... Proteins have many functions – proteins determine structure and function of organisms : -enzymes - regulate and speed up chemical reactions - very specific (one enzyme for each reaction) - structural proteins - contractile proteins - antibodies, hormones - transport proteins - plasma membrane protei ...
... Proteins have many functions – proteins determine structure and function of organisms : -enzymes - regulate and speed up chemical reactions - very specific (one enzyme for each reaction) - structural proteins - contractile proteins - antibodies, hormones - transport proteins - plasma membrane protei ...
C2984Datasheet-Lot100
... The properties of this strain that contribute to its usefulness as a cloning strain are described below. The genotypes underlying these properties appear in parentheses. Blue/White Screening (F´ Δ(lacZ)M15): makes ω-fragment of β-gal; Δ(lacproAB) deletes the β-gal gene on the chromosome. pUC19 and s ...
... The properties of this strain that contribute to its usefulness as a cloning strain are described below. The genotypes underlying these properties appear in parentheses. Blue/White Screening (F´ Δ(lacZ)M15): makes ω-fragment of β-gal; Δ(lacproAB) deletes the β-gal gene on the chromosome. pUC19 and s ...
RNA & Protein Synthesis
... • We need to make a copy of the instructions in the form of RNA (transcription). – RNA can leave the nucleus & take the instructions to the ...
... • We need to make a copy of the instructions in the form of RNA (transcription). – RNA can leave the nucleus & take the instructions to the ...
Chapter 1 Notes
... Viruses are obligate intracellular parasites: they can only reproduce within a host cell - viruses lack the enzymes for metabolism and have no ribosomes for making proteins Viruses are merely packaged sets of genes in transit from one host cell to another. ...
... Viruses are obligate intracellular parasites: they can only reproduce within a host cell - viruses lack the enzymes for metabolism and have no ribosomes for making proteins Viruses are merely packaged sets of genes in transit from one host cell to another. ...
tutorialdm
... Comparative genomics help identifying region of DNA that are shared between two different species and allows the transfer of information between both species in the common region. It can also detect regions that have gone through chromosomes rearrangement occurring in many different diseases. This i ...
... Comparative genomics help identifying region of DNA that are shared between two different species and allows the transfer of information between both species in the common region. It can also detect regions that have gone through chromosomes rearrangement occurring in many different diseases. This i ...
Cleavage stage and cell division Cleavage stage and cell
... Cleavage rate = Cell division rate Cell division is the process by which a parent cell divides into two or more daughter cells, i.e. mitosis. A human being's body experiences about 10,000 trillion cell divisions in a lifetime Before division can occur, the chromosomes must be replicated and the dupl ...
... Cleavage rate = Cell division rate Cell division is the process by which a parent cell divides into two or more daughter cells, i.e. mitosis. A human being's body experiences about 10,000 trillion cell divisions in a lifetime Before division can occur, the chromosomes must be replicated and the dupl ...
future
... Chicago -> Dallas -> Miami -> New York would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence. ...
... Chicago -> Dallas -> Miami -> New York would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence. ...
Computers of the Future? Moore`s Law Ending in 2018?
... Chicago -> Dallas -> Miami -> New York would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence. ...
... Chicago -> Dallas -> Miami -> New York would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence. ...
Application of Recombinant DNA Technology
... therapies and diagnostic tests. Recombinant DNA molecules are sometimes called chimeric DNA, because they are usually made of material from two different species, like the mythical chimera. R-DNA technology uses palindromic sequences and leads to the production of sticky and blunt ends.The DNA seque ...
... therapies and diagnostic tests. Recombinant DNA molecules are sometimes called chimeric DNA, because they are usually made of material from two different species, like the mythical chimera. R-DNA technology uses palindromic sequences and leads to the production of sticky and blunt ends.The DNA seque ...
lecture_ch05_2014 honors biology_website
... DNA samples were collected from a crime scene and from three suspects. DNA fragments were analyzed using electrophoresis. Using the DNA fingerprint information below, determine which suspect was present at the crime scene. ...
... DNA samples were collected from a crime scene and from three suspects. DNA fragments were analyzed using electrophoresis. Using the DNA fingerprint information below, determine which suspect was present at the crime scene. ...
Gene Regulation - Biomedical Informatics
... 12. The bases are of two kinds: purines (A and G, their structure is two fused rings) and pyrimidines (C, T and U, with only one ring). 13. In oligonucleotides, the nucleotide at one end has a free 3’ (deoxy)ribose hydroxyl group, at the other end – a free 5’ phosphate or hydroxyl. They are related ...
... 12. The bases are of two kinds: purines (A and G, their structure is two fused rings) and pyrimidines (C, T and U, with only one ring). 13. In oligonucleotides, the nucleotide at one end has a free 3’ (deoxy)ribose hydroxyl group, at the other end – a free 5’ phosphate or hydroxyl. They are related ...
Mutations - TeacherWeb
... What do mutations do to the protein? Are they all bad or all good? The genes in your DNA code for a specific ____________________. The ____________ and ____________ of amino acids will determine the ___________ and _________________ of the protein. The DNA sequence below codes for a protein called ...
... What do mutations do to the protein? Are they all bad or all good? The genes in your DNA code for a specific ____________________. The ____________ and ____________ of amino acids will determine the ___________ and _________________ of the protein. The DNA sequence below codes for a protein called ...
DNA cloning
... 3- Inducible promoters: Inducible promoters are of high interest to genetic engineering because their performance is dependent on certain endogenous or external factors or stimuli. In the ideal case, gene expression by an inducible promoter can be controlled by the experimenter by simply adding a ce ...
... 3- Inducible promoters: Inducible promoters are of high interest to genetic engineering because their performance is dependent on certain endogenous or external factors or stimuli. In the ideal case, gene expression by an inducible promoter can be controlled by the experimenter by simply adding a ce ...
COA: TrueStart™ Taq DNA Polymerase, #EP0613
... polymerase which has been chemically modified by the addition of heat-labile blocking groups to amino acid residues. The enzyme is inactive at room temperature, avoiding extension of non-specifically annealed primers ...
... polymerase which has been chemically modified by the addition of heat-labile blocking groups to amino acid residues. The enzyme is inactive at room temperature, avoiding extension of non-specifically annealed primers ...
Cre-Lox recombination
In the field of genetics, Cre-Lox recombination is known as a site-specific recombinase technology, and is widely used to carry out deletions, insertions, translocations and inversions at specific sites in the DNA of cells. It allows the DNA modification to be targeted to a specific cell type or be triggered by a specific external stimulus. It is implemented both in eukaryotic and prokaryotic systems.The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences called the Lox sequences. This system can be implemented without inserting any extra supporting proteins or sequences. The Cre enzyme and the original Lox site called the LoxP sequence are derived from bacteriophage P1.Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many types of manipulations can be carried out. The activity of the Cre enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.The Cre-Lox system is very similar in action and in usage to the FLP-FRT recombination system.