• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
GPR17 shRNA Plasmid (r): sc-270023-SH
GPR17 shRNA Plasmid (r): sc-270023-SH

... G protein-coupled receptor 17, GPR17, also known as uracil nucleotide/cysteinyl leukotriene receptor or P2Y-like receptor (P2YL), is a 367 amino acid member of the G protein-coupled receptor 1 family of proteins. While GPR17 is expressed in kidney, heart and umbilical vein endothelial cells, it is e ...
Advanced Organic Chemistry of Nucleic Acids
Advanced Organic Chemistry of Nucleic Acids

... nucleic acids to Moscow University chemistry majors already with a solid organic and physical chemistry background. To teach this particular subject was most exciting at the time when virtually every year was marked by stunning discoveries in the field of nucleic acids. We still derive a great deal ...
significance of the putative upstream polybasic nuclear localisation
significance of the putative upstream polybasic nuclear localisation

... Interferon-gamma (IFNγ) accomplishes its multiple biological effects by activating the STAT transcription factors, which are translocated to the nucleus through a specific nuclear localization sequence(s) (NLS) located in the IFNγ molecule. Two putative NLS have been pointed out in the human interfe ...
Computational Biology
Computational Biology

... Strong et al.,Genome Biology (2003) 4:R59 10. Lecture WS 2003/04 ...
w0506_tutorial3_06
w0506_tutorial3_06

... A conserved protein component of the small (40S) subunit of S. cerevisiae. ...
Behavioral Candidate Gene Worksheet (Part 2)
Behavioral Candidate Gene Worksheet (Part 2)

... method”, set it to “linear”. Hitting “Apply Changes” will close this box and redraw the graphs of gene expression as linear values. With these settings you should be able to see more clearly how expression levels change at different points during development. From this new view, which specific devel ...
Re-identification of the N-terminal amino acid residue and its
Re-identification of the N-terminal amino acid residue and its

... Key words: bacterial antenna complex, MALDI-TOF/MS, NMR, N-terminal methylation Recently, we have reported an oxidative modification of α-polypeptide of core light-harvesting complex (LH 1) from purple nonsulfur photosynthetic bacterium Rhodospirillum (R.) rubrum and its consequence for the stabilit ...
GENE MUTATIONS - The Open Door Web Site : Home Page
GENE MUTATIONS - The Open Door Web Site : Home Page

... Their effects may not be serious unless they affect an amino acid that is essential for the structure and function of the finished protein molecule (e.g. sickle cell anaemia) © 2010 Paul Billiet ODWS ...
01 Structure, properties and biological functions of proteins
01 Structure, properties and biological functions of proteins

... Glycoproteins. Glycoproteins are proteins that contain carbohydrate. Proteins destined for an extracellular location are characteristically glycoproteins. For example, fibronectin and proteoglycans are important components of the extracellular matrix that surrounds the cells of most tissues in anima ...
2O2 - + 2H+ ------> H2O2 + O2 M3+ + O2 - ------> M2+ + O2 i
2O2 - + 2H+ ------> H2O2 + O2 M3+ + O2 - ------> M2+ + O2 i

... extracellular form. The tertiary structure (right figure) is mainly beta sheet (shown in yellow), only one small helix is present (two helical regions are shown in red). Only dimers are active, although the equivalent homologous enzyme isolated from the E.coli periplasmic space is a monomeric enzyme ...


... The disaccharide of glucose and N-acetylglucose (shown to the right) can be an effective inhibitor against infection by the virus. As with many other viruses, there is a high rate of mutation in the viral proteins and enzymes. One such mutant enzyme was isolated and the Gln was found to be replaced ...
Genomic characterization and phylogenetic analysis
Genomic characterization and phylogenetic analysis

... In the present study, a novel gradient band reverse transcription-PCR method was used to identify CSBV infection in A. cerana larvae, and the nucleotide sequence of this CSBV was determined. The CSBV-SX genome were monopartite monocistronic and contained a single large open reading frame staring at ...
Mass spectrometry and proteomics Steven P Gygi* and Ruedi
Mass spectrometry and proteomics Steven P Gygi* and Ruedi

... proteins directly from tissue. Second, the stable-isotopeenriched media are costly and may themselves affect cellular growth and protein production. Third, the increase in nominal mass because of stable-isotope incorporation is not known until the sequence is determined. Therefore protein identifica ...
Protein and Glycoprotein Characterisation by Mass
Protein and Glycoprotein Characterisation by Mass

... crucial to the initial steps in blood coagulation12. During the early development of MS protein strategies involving the mixture analysis protocol, it was recognised that using specific enzymes to cut the peptide backbone led to a set of resulting peptides whose molecular masses were ...
Location and characterization of the three carbohydrate prosthetic
Location and characterization of the three carbohydrate prosthetic

... and as a complex with IgA [1-3]. The free form consists o f a polypeptide chain of 183 amino acids [4-6] which carries carbohydrates and retinol [7] as well as several unidentified yellow-brown fluorescent chromophoric groups [1-9]. In the H C - I g A complex, which has antibody activity [10] and la ...
Nucleic acid enzymes
Nucleic acid enzymes

... Modified bases carrying imidazole and alkyl primary amino groups have been used to this end [45,46]. In one case, multiple turnover was obtained for the first time in a trans assay employing a DNA–RNA chimeric substrate [45]. DNAzymes with sequences carrying the two above mentioned additional functi ...


... nature of allosteric effects and then select one example from the following list and describe how allosteric effects control its function. Your answer should include a description or structure of the allosteric activator or inhibitor. (8 pts) 1. Hemoglobin 2. PFK 3. lac repressor ...
Methods S1.
Methods S1.

... (Qiagen, Venlo, Netherlands). RNA and DNA samples were quantified by spectrophotometry and stored at -80. RNA was converted to cDNA by using oligo dT as primers. Rat, COX1 (forward: 5’ATGACCCACCAATCACATGC3’ reverse: 5’ATCACATGGCTAGGCCGGAG3’), NADH1 (forward: 5’ATACCCATGGCCAACCTCCT3’ reverse: 5’GGGCC ...
Cloning, Expression, and Nucleotide Sequence of lid?
Cloning, Expression, and Nucleotide Sequence of lid?

... Cloning, Expression, and Nucleotide Sequence of lid?, the Repressor for High-Affinity Branched-Chain Amino Acid Transport in Escherichia coZi Tammy K. Antonucci, Lois M. Wagner, and Dale L. Oxender Department of Biological Chemistry, The University of Michigan, Ann Arbor, Michigan 481090606 The livR ...
Computational Protein Design as a Cost Function Network
Computational Protein Design as a Cost Function Network

... find amino acid sequences that folds into it. It can also be considered as a highly combinatorial variant of side-chain positioning [35] because of possible amino acid changes. Different computational methods have been proposed over the years to solve this problem and several success stories have de ...
Repressing Integrase attachment site operation
Repressing Integrase attachment site operation

... between two heterotypic DNA “attachment” sites (attP and attB) [4]. Without the presence of a cognate directionality factor, the integrase will not allow the reaction to proceed backwards, between the recombination products of those sites (attL and attR) [5]. Serine integrases are also notable for n ...
please click, ppt - Department of Statistics | Rajshahi University
please click, ppt - Department of Statistics | Rajshahi University

... To perform the function effectively a proper structure is essential. Without proper structure a protein is useless or even cause malfunction in system ...
fae04be7f127386
fae04be7f127386

... In the third form of transport, small closed bags made of membrane, called vesicles, carry newly synthesized protein from the endoplasmic reticulum to the Golgi apparatus and between other compartments in a process called vesicular trafficking. ...
Targets for breast cancer diagnosis and treatment
Targets for breast cancer diagnosis and treatment

... back into the chromosome (Alitalo et al.). As a result. 50 or ...
Genes & Inheritance Series: Set 3 Copyright © 2005 Version: 2.0
Genes & Inheritance Series: Set 3 Copyright © 2005 Version: 2.0

... Cells need to control the rate and frequency of protein synthesis. These controls often occur at transcription. Sometimes genes are induced (and therefore transcribed) only when an enzyme product is required to catalyze reactions that may occur infrequently, e.g. use of a particular substrate that i ...
< 1 ... 132 133 134 135 136 137 138 139 140 ... 524 >

Gene expression



Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as transfer RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea), and utilized by viruses - to generate the macromolecular machinery for life.Several steps in the gene expression process may be modulated, including the transcription, RNA splicing, translation, and post-translational modification of a protein. Gene regulation gives the cell control over structure and function, and is the basis for cellular differentiation, morphogenesis and the versatility and adaptability of any organism. Gene regulation may also serve as a substrate for evolutionary change, since control of the timing, location, and amount of gene expression can have a profound effect on the functions (actions) of the gene in a cell or in a multicellular organism.In genetics, gene expression is the most fundamental level at which the genotype gives rise to the phenotype, i.e. observable trait. The genetic code stored in DNA is ""interpreted"" by gene expression, and the properties of the expression give rise to the organism's phenotype. Such phenotypes are often expressed by the synthesis of proteins that control the organism's shape, or that act as enzymes catalysing specific metabolic pathways characterising the organism.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report