• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Teacher Notes - 3D Molecular Designs
Teacher Notes - 3D Molecular Designs

DNA RNA
DNA RNA

Lesson 15a Components of DNA #3 LP
Lesson 15a Components of DNA #3 LP

... CAGACTTA and its complimentary code of GTCTGAAT as in the previous activity (green/adenine, yellow/thymine, blue/guanine, and red/cytosine). Then have 6 students be complimentary mRNA nucleotides for the middle six nitrogen bases of the CAGACTTA side of the DNA molecule. The complimentary strand of ...
Test Review ANSWERS
Test Review ANSWERS

... 5. Describe DNA in eukaryotes versus prokaryotes. Prokaryotes have one circular chromosome and when they replicate it starts at one point, moving out in both directions. Eukaryotes have many chromosomes that look like strings. They replicate by having many replication forks work their way long the c ...
RNA chapter 13.1 - Red Hook Central Schools
RNA chapter 13.1 - Red Hook Central Schools

Chapter 22 Lecture PowerPoint - McGraw Hill Higher Education
Chapter 22 Lecture PowerPoint - McGraw Hill Higher Education

... – When tail finds homologous region, nick occurs in in D-looped DNA – Nick allows RecA and ss-break create a new tail that can pair with gap in the other DNA ...
Protein Synthesis Homework
Protein Synthesis Homework

... Draw a diagram to accompany each of the five statements which outline protein synthesis. 1. The genetic code is transcribed from one strand of DNA into a strand of mRNA. 2. mRNA moves out of the nucleus through a pore to a ribosome ...
26.1 and 26.2 Notes - Westgate Mennonite Collegiate
26.1 and 26.2 Notes - Westgate Mennonite Collegiate

... i. Produces many identical copies of DNA in a laboratory ii. Starts with one copy of DNA and creates millions of copies iii. Allows tiny sample of DNA to be replicated millions of times for forensic use (only a very small original sample is needed) 4. DNA Analysis: a. DNA “fingerprints” are obtained ...
Unit 9: DNA and RNA
Unit 9: DNA and RNA

... double helix. DNA helicases break the H bonds holding complementary strands together. Once the two strands are separated, additional proteins attach to each strand, holding them apart. The areas where the double helix separates are called replication forks. ...
DNA
DNA

From Gene to Protein
From Gene to Protein

... and III) • Bacteria have one kind – it makes not only mRNA but also other types of RNA • Bacteria have one chromosome and many plasmids. Information is constantly being sent to ribosomes for translation into proteins needed by the bacterial cell ...
C. DNA is a double helix
C. DNA is a double helix

... (1) It twists clockwise as it moves away from the observer ...
Module 3
Module 3

... Copyright Cornell Institute for Biology Teachers, 2004. This work may be copied by the original recipient from CIBT to provide copies for users working under the direction of the original recipient. All other redistribution of this work without the written permission of the copyright holder is prohi ...
RNA - Lockland High School
RNA - Lockland High School

...  Ribosomal RNA (rRNA) – Ribosomes are made of rRNA and protein. ...
DNA Synthesis aka DNA Replication
DNA Synthesis aka DNA Replication

... • Because each new strand of DNA has ½ of the original DNA, its called SEMICONSERVATIVE ...
DNA Workshop - Mrs. Sills` Science Site
DNA Workshop - Mrs. Sills` Science Site

... How many seconds does it take to create a protein chain that is 400 _______________________________ ...
Ch 11 homework
Ch 11 homework

... C) the site on DNA to which activators bind. D) required to facilitate the binding of DNA polymerases. E) the products of transcription factors. 8. Outline the 4 ways genes expression can be regulated after mRNA has been processed and transported to the cytoplasm. (2) Breakdown of mRNA- mRNA digeste ...
mastering protein synthesis
mastering protein synthesis

... MASTERING PROTEIN SYNTHESIS From this DNA, you have all the information you need to build protein. 5’ ATGGTTACAGTCTATTAGATGCTATTTCAACACCAATAA 3’ 3’ TACCAATGTCAGATAATCTACGATAAAGTTGTGGTTATT 5’ ...
Chapter 12 Review Worksheet
Chapter 12 Review Worksheet

... Each strand serves as a(an) ...
DNA - Experiments and Discoveries
DNA - Experiments and Discoveries

DNA Replication - inetTeacher.com
DNA Replication - inetTeacher.com

Chapter 9 DNA: The Genetic Material Read 192
Chapter 9 DNA: The Genetic Material Read 192

Chapter 6
Chapter 6

...  The bases on one side of the DNA molecule can be put in any order, allowing an enormous variety of genes.  Each gene consists of a string of bases.  The order of the bases gives the cell information about how to make each trait. ...
The Earth - Mr. Shanks` Class
The Earth - Mr. Shanks` Class

Macromolecules and Cell Structure
Macromolecules and Cell Structure

... sugar phosphate backbone like rungs of a ladder Short piece of DNA is called an oligonucleotide ...
< 1 ... 493 494 495 496 497 498 499 500 501 ... 657 >

Replisome



The replisome is a complex molecular machine that carries out replication of DNA. The replisome first unwinds double stranded DNA into two single strands. For each of the resulting single strands, a new complementary sequence of DNA is synthesized. The net result is formation of two new double stranded DNA sequences that are exact copies of the original double stranded DNA sequence.In terms of structure, the replisome is composed of two replicative polymerase complexes, one of which synthesizes the leading strand, while the other synthesizes the lagging strand. The replisome is composed of a number of proteins including helicase, RFC, PCNA, gyrase/topoisomerase, SSB/RPA, primase, DNA polymerase I, RNAse H, and ligase.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report