• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
No Slide Title
No Slide Title

... built to exist in a frigid climate, with A-positive blood, dark skin, brown eyes, and thick, black hair on a scalp genetically susceptible to baldness. He was a palaeoEskimo, and by comparing his genome to other living people, they deduced that he was member of the Arctic Saqqaq, the first known cul ...
E. coli
E. coli

... The function of these nucleic acids was not known ...
D - Cloudfront.net
D - Cloudfront.net

... 2. Penicillin is widely used to kill bacteria which cause disease. However, this drug does not affect as many species of bacteria today as it did when it was first discovered. Which statement describing this situation is false? a. Thousands of years were required for bacteria to become resistant to ...
Review Sheet : DNA, RNA & Protein Synthesis
Review Sheet : DNA, RNA & Protein Synthesis

... Which of the following is not true about DNA replication?  a. It occurs during the S phase of cell cycle  b. Two complementary strands are duplicated.  c. The double strand unwinds and unzips while it is being duplicated.  d. The process is catalyzed by enzymes called DNA mutagens. ...
Genetics HARDCOPY - New Hartford Central Schools
Genetics HARDCOPY - New Hartford Central Schools

... Copying of DNA ...
PCR and Its Applications
PCR and Its Applications

... Department of Molecular Biology and Genetics ...
DNA EVIDENCE
DNA EVIDENCE

... Ideally rape kits should be processed right away. They should be compared to the FBI database. If a match is found, police can charge the rapist. In real life this doesn’t always happen. Forensics labs lack money for DNA testing. They don’t have enough trained staff. So rape kits collect dust on the ...
Protein synthesis 24 The transcription is: synthesis of RNA on DNA
Protein synthesis 24 The transcription is: synthesis of RNA on DNA

... Golgi apparatus endoplasmic reticulum nuclear pores Which codons function as terminator codons? ATP and AAA UAG and UAC UAA and UAG AUG and AAU If you recall, synthesis of both DNA and RNA started at the 5' end of the growing chain, or the 3' end of the template. Synthesis of protein, however, start ...
Recent progress in understanding transcription factor binding
Recent progress in understanding transcription factor binding

... understanding and predicting gene regulatory network function. Transcription factors typically belong to a structural family containing many other proteins with a similar amino acid sequence. Even when the difference in nucleotide sequence preference between such proteins is subtle, their target gen ...
DNA- The Molecule of Heredity
DNA- The Molecule of Heredity

tggccatcgtaaggtgcgacc ggtagca
tggccatcgtaaggtgcgacc ggtagca

Nucleic Acids and Genetics - Travis Science TAKS Practice
Nucleic Acids and Genetics - Travis Science TAKS Practice

... III. Protein synthesis: Going from DNA to Protein Transcription - mRNA will leave the nucleus and travel to the ribosomes where proteins are assembled. The ribosome reads the mRNA strand in sets of three bases (codons). These codons code for amino acids (the building blocks of proteins). Translation ...
Molecular Biology
Molecular Biology

... • RNA polymerase recognizes a region, the promoter, which lies just upstream of gene • Polymerase binds tightly to promoter causing localized separation of the two DNA strands • Polymerase starts building the RNA chain adding ribonucleotides • After several ribonucleotides are joined together the en ...
DNA polymerase
DNA polymerase

... “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material” (Watson and Crick 1953) ...
LDL receptors
LDL receptors

... Fetal DNA was isolated from two amniotic-fluid samples using the QIAamp Viral RNA Mini Kit. Individual PCRs contained primer sets specific for the RH sequences (83–158 bp) indicated, as well as hGH (434 bp) as internal control. D2–D10 refer to the specific exons targeted within the RHD gene. c(cyt48 ...
Notes
Notes

Who Killed Esmeralda Gooch
Who Killed Esmeralda Gooch

Peer-reviewed Article PDF
Peer-reviewed Article PDF

... or Medicine 1962 for their discoveries concerning the molecular structure of nucleic acids. Each strand of DNA in the double helix can serve as a pattern for duplicating the sequence of bases, which is critical when cells divide and allows each new cell to have an exact copy of the DNA present in th ...
Molecular motors: DNA takes control
Molecular motors: DNA takes control

You Light Up My Life
You Light Up My Life

... that catalyzes transcription a RNA polymerase initiates transcription at a promoter region in DNA. It recognizes a base sequence located next to the promoter as a template. It will link the nucleotides adenine, cytosine, guanine, and uracil into a strand of RNA, in the order specified by DNA. Fig. 1 ...
DNA Transcription & Protein Translation
DNA Transcription & Protein Translation

Chapter 12 Jeopardy Review
Chapter 12 Jeopardy Review

HOW TO PREPARE VECTORS TO CARRY YOUR FAVORITE GENE.
HOW TO PREPARE VECTORS TO CARRY YOUR FAVORITE GENE.

... These maps show only those enzymes that cut the plasmid in only one place. ...
Genetics 3500 winter Test ii_ansers
Genetics 3500 winter Test ii_ansers

transfer RNA
transfer RNA

< 1 ... 366 367 368 369 370 371 372 373 374 ... 657 >

Replisome



The replisome is a complex molecular machine that carries out replication of DNA. The replisome first unwinds double stranded DNA into two single strands. For each of the resulting single strands, a new complementary sequence of DNA is synthesized. The net result is formation of two new double stranded DNA sequences that are exact copies of the original double stranded DNA sequence.In terms of structure, the replisome is composed of two replicative polymerase complexes, one of which synthesizes the leading strand, while the other synthesizes the lagging strand. The replisome is composed of a number of proteins including helicase, RFC, PCNA, gyrase/topoisomerase, SSB/RPA, primase, DNA polymerase I, RNAse H, and ligase.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report