Genetics webquest - Sciencelearn Hub
... when talking about the genetics of a particular trait (like eye colour). Phenotype: the observable physical or biochemical characteristics of an individual organism, for example, height, weight and skin colour. 9. How are your genotype and phenotype related? Your genotype acts like a set of instruct ...
... when talking about the genetics of a particular trait (like eye colour). Phenotype: the observable physical or biochemical characteristics of an individual organism, for example, height, weight and skin colour. 9. How are your genotype and phenotype related? Your genotype acts like a set of instruct ...
Sir Alec Jeffreys minisatellites
... Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG ...
... Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG ...
DNA Fingerprinting
... – RNA is extracted from the cell, undergoes gel electrophoresis, and is bound to a filter. – Hybridization between bound cellular RNA and a labeled probe occurs. The sizes of the RNA fragments detected by the probe can be determined ...
... – RNA is extracted from the cell, undergoes gel electrophoresis, and is bound to a filter. – Hybridization between bound cellular RNA and a labeled probe occurs. The sizes of the RNA fragments detected by the probe can be determined ...
PEARSON
... gut, this could reduce the effectiveness of antibiotics given to patients to treat infections. For this to happen the marker gene would have to remain intact after digestion and a long chain of events would have to occur before the antibiotic resistance gene became part of the genetic material of th ...
... gut, this could reduce the effectiveness of antibiotics given to patients to treat infections. For this to happen the marker gene would have to remain intact after digestion and a long chain of events would have to occur before the antibiotic resistance gene became part of the genetic material of th ...
Promoters - Pennsylvania State University
... – Well-conserved sequence centered about 25 bp 5’ to start site – TBP and TFIID bind ...
... – Well-conserved sequence centered about 25 bp 5’ to start site – TBP and TFIID bind ...
The Evolution of Populations
... • Often many compromises ex: human knee is amazing in function, but often weak in structure ...
... • Often many compromises ex: human knee is amazing in function, but often weak in structure ...
Transcriptional Deregulation of Mutated BCL6 Alleles by Loss of
... The BCL6 proto-oncogene encodes a POZ/zinc finger transcriptional repressor expressed in germinal center (GC) B cells and required for GC formation. In ~35% of diffuse large B cell lymphomas (DLBCL) and 5–14% of follicular lymphomas (FL), the BCL6 locus is altered by chromosomal translocations that ...
... The BCL6 proto-oncogene encodes a POZ/zinc finger transcriptional repressor expressed in germinal center (GC) B cells and required for GC formation. In ~35% of diffuse large B cell lymphomas (DLBCL) and 5–14% of follicular lymphomas (FL), the BCL6 locus is altered by chromosomal translocations that ...
Genetic Engineering ppt
... As plasmids are extremely small, we cannot tell by looking which ones have got the human gene in the right place. We need to use a ‘shotgun’ approach and incubate thousands of plasmids with hundreds of bacterial cells ...
... As plasmids are extremely small, we cannot tell by looking which ones have got the human gene in the right place. We need to use a ‘shotgun’ approach and incubate thousands of plasmids with hundreds of bacterial cells ...
Structural
... Tertiary Structure (3o) The three dimensional folding of a polypeptide is its tertiary structure. Both the a-helix and b-sheet may exist within the tertiary structure. Generally the distribution of amino acid sidechains in a globular protein finds mostly nonpolar residues in the interior of the pro ...
... Tertiary Structure (3o) The three dimensional folding of a polypeptide is its tertiary structure. Both the a-helix and b-sheet may exist within the tertiary structure. Generally the distribution of amino acid sidechains in a globular protein finds mostly nonpolar residues in the interior of the pro ...
Deamination of 5-methylcytosine yields thymine
... 1. Why is radiolabeled thymidine the best substrate to use in experiments designed to determine the rate of cell proliferation in vitro? Thymidine will be incorporated into replicating DNA but not RNA. 2. Provide a biochemical rationale for why AT-rich sequences are commonly found in zones of initia ...
... 1. Why is radiolabeled thymidine the best substrate to use in experiments designed to determine the rate of cell proliferation in vitro? Thymidine will be incorporated into replicating DNA but not RNA. 2. Provide a biochemical rationale for why AT-rich sequences are commonly found in zones of initia ...
Amino Acids - Biology Learning Center
... --Matt Ridley in Francis Crick, discoverer of the genetic code ...
... --Matt Ridley in Francis Crick, discoverer of the genetic code ...
Genomics presentation
... - Polymerase concentration: about 1000 fold higher - Even 30 polymerase working at a time together - From 50 to 500nm in width - Tethered to nuclear matrix ...
... - Polymerase concentration: about 1000 fold higher - Even 30 polymerase working at a time together - From 50 to 500nm in width - Tethered to nuclear matrix ...
Functional Genomics
... ∵ ① many genes involved in essential life processes are conserved among microorganisms ② Mitochondria and chloroplasts are important components of eukaryotic life processes ③ Many microorganisms have formed intimate relationships with higher eukaryotes ...
... ∵ ① many genes involved in essential life processes are conserved among microorganisms ② Mitochondria and chloroplasts are important components of eukaryotic life processes ③ Many microorganisms have formed intimate relationships with higher eukaryotes ...
chapter3_Sections 4
... • Lipid with a highly polar phosphate group in its hydrophilic head, and two nonpolar, hydrophobic fatty-acid tails • Main constituent of eukaryotic cell membranes • Opposing properties of a phospholipid molecule give rise to cell membrane structure • Two layers of lipids (lipid bilayer) • Hydrophob ...
... • Lipid with a highly polar phosphate group in its hydrophilic head, and two nonpolar, hydrophobic fatty-acid tails • Main constituent of eukaryotic cell membranes • Opposing properties of a phospholipid molecule give rise to cell membrane structure • Two layers of lipids (lipid bilayer) • Hydrophob ...
Chapter 3 Biological Molecules
... An amino group reacts with a carboxyl group, and water is lost ...
... An amino group reacts with a carboxyl group, and water is lost ...
Review-Qs-for-modern-genetics
... replace the underlined word/phrase to make the statement read true. 1. The main enzyme involved in DNA replication is RNA polymerase. FALSE – DNA polymerase. 2. To determine the amino acid, look up the three base anticodon on the genetic dictionary FALSE – codon. 3. Ligase joins DNA fragments of the ...
... replace the underlined word/phrase to make the statement read true. 1. The main enzyme involved in DNA replication is RNA polymerase. FALSE – DNA polymerase. 2. To determine the amino acid, look up the three base anticodon on the genetic dictionary FALSE – codon. 3. Ligase joins DNA fragments of the ...
pro amino crème
... pro amino crème for younger, healthier skin pro amino crème has the ability to boost the skin’s natural moisture levels, restoring free water levels and natural lipids to enhance barrier function and maintain a balanced, youthful complexion. pro amino is a crème that is formulated with the eight ess ...
... pro amino crème for younger, healthier skin pro amino crème has the ability to boost the skin’s natural moisture levels, restoring free water levels and natural lipids to enhance barrier function and maintain a balanced, youthful complexion. pro amino is a crème that is formulated with the eight ess ...
Ch 11 Standards Test Practice
... fox produces enzymes that cause its fur to become reddish brown. During the cold temperatures of winter, these enzymes do not function. As a result, the fox has a white coat that blends into the snowy background. What explains this change in color? A The genes of a fox are made of unstable DNA. B Mu ...
... fox produces enzymes that cause its fur to become reddish brown. During the cold temperatures of winter, these enzymes do not function. As a result, the fox has a white coat that blends into the snowy background. What explains this change in color? A The genes of a fox are made of unstable DNA. B Mu ...
Important Terminology
... Protein – a biological macromolecule that contains the principal components of organism; carbon, hydrogen, oxygen, and nitrogen; performs a variety of structural and regulatory functions for cells Catalyst – a substance that enables a chemical reaction to proceed at an unusually faster rate or under ...
... Protein – a biological macromolecule that contains the principal components of organism; carbon, hydrogen, oxygen, and nitrogen; performs a variety of structural and regulatory functions for cells Catalyst – a substance that enables a chemical reaction to proceed at an unusually faster rate or under ...
Evolution: Natural and Artificial Selection
... 4. Investigate: Any insect that has a mutation will be circled. Place your cursor on an insect with a mutation to examine its genotype. (If there are none in this generation, click Play and then Pause when a mutation appears.) A. Examine the genotype of the mutated insect as well as the genotypes of ...
... 4. Investigate: Any insect that has a mutation will be circled. Place your cursor on an insect with a mutation to examine its genotype. (If there are none in this generation, click Play and then Pause when a mutation appears.) A. Examine the genotype of the mutated insect as well as the genotypes of ...
Chapter 3 Review Questions
... 20. Proteins will not function properly if they have the wrong __shape__________. 21. An ___enzyme__________ is made of proteins and catalyzes reactions 22. Monomers are linked together by the process of _____polymerization__________. 23. Polymers are broken apart by the process of ___hydrolysis___ ...
... 20. Proteins will not function properly if they have the wrong __shape__________. 21. An ___enzyme__________ is made of proteins and catalyzes reactions 22. Monomers are linked together by the process of _____polymerization__________. 23. Polymers are broken apart by the process of ___hydrolysis___ ...
human genetic potential and chiropractic
... Mutations that occur only in an egg or sperm cell, or those that occur just after fertilization, are called new (de novo) mutations. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell, but has no family history of the disorder. Acquired (or somati ...
... Mutations that occur only in an egg or sperm cell, or those that occur just after fertilization, are called new (de novo) mutations. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell, but has no family history of the disorder. Acquired (or somati ...
Point mutation
A point mutation, or single base modification, is a type of mutation that causes a single nucleotide base change, insertion, or deletion of the genetic material, DNA or RNA. The term frameshift mutation indicates the addition or deletion of a base pair. A point mutant is an individual that is affected by a point mutation.Repeat induced point mutations are recurring point mutations, discussed below.