• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Core – Practice test 4
Core – Practice test 4

... chromosomes. After a cell undergoes meiosis, how many chromosomes will the resulting cells have? ...
Answers section 4
Answers section 4

... 6. if you are given 3’-CAT-5’ as the template strand of DNA, then the mRNA will be 5’GUA-3’. The mRNA will be 5’-CAU-3’ if it is the coding strand of DNA that you are given. 7. A 8. B 9. A 10. B 11. C 12. D 13. B 14. A 15. C 16. E 17. D 18. E 19. D 20. C 21. A 22. E 23. B 24. ribose vs. deoxyribose ...
Lecture 18
Lecture 18

... species remains fairly constant over time. Prediction A: If 1 and 2 are true, then not all individuals realize their reproductive potential. Hypothesis 3: Individuals within a species vary in terms of their traits. Hypothesis 4: At least some of these traits are inherited. Prediction B: If A, 3, and ...
Lecture 18
Lecture 18

... 1. Essay on the Principles of Population (1798) a. populations of organisms increase geometrically b. rate of reproduction too high to be sustained c. warning against human overpopulation 2. but in nature, this does not seem to occur 3. Darwin’s answer: death (selection) limits population numbers 4. ...
Chapter 16 Outline
Chapter 16 Outline

... What Are Genomic Libraries? ...
Ribonucleic acids are found in both the nucleus and the cytoplasm
Ribonucleic acids are found in both the nucleus and the cytoplasm

... two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds. These two strands run in opposite directions to each other and are therefore anti-parallel. Attached to each sugar is one of four types of molecules called nucleobases (inf ...
R 9.1
R 9.1

... biotechnology. Some examples include sequencing genes, copying (or cloning) genes, chemically mutating genes, analyzing and organizing genetic information with computer databases, and transferring genes between organisms. In many of these research areas, DNA must first be cut so that it can be studi ...
Transcription and Translation Candy Activity
Transcription and Translation Candy Activity

... Notes labels Other? RNA: RNA has some key differences from DNA. List them below and make a key for the 4 RNA nucleotides. Paste a picture of the 4 RNA nucleotides clearly labeling: ribose, base, phosphate group and nucleotide name. ...
Gene expressions analysis by massively parallel signature
Gene expressions analysis by massively parallel signature

... (ddATP,ddGTP,ddCTP, ddTTP) ...
DNA to Protein Synthesis Internet Quest
DNA to Protein Synthesis Internet Quest

... 8.   What  happens  to  the  mRNA  molecule  when  protein  production  is  complete?   ...
BINF6201/8201 Basics of Molecular Biology
BINF6201/8201 Basics of Molecular Biology

... Ø A string of bout 200 adenosines are added to the 3’ end. This poly-A tail is bound by poly-A binding proteins. Ø Splicing: introns are cut out, and exons are linked. •  There can be many forms of splicing, generating different mRNAs —alternative splicing, so a gene can code for many proteins. •  S ...
SUMMATIVE ASSIGNMENT SBI4U1 - June 2015 Weight: 5% of
SUMMATIVE ASSIGNMENT SBI4U1 - June 2015 Weight: 5% of

... Written in point form Identifies diagrams Include at least two other references beyond the textbook Find at least two other references: YouTube video, animation, practice problem ...
Unit 7a * Structure of DNA
Unit 7a * Structure of DNA

Organism Genome (kb) Form
Organism Genome (kb) Form

... • In eukaryotes, the first level of DNA packing is the chromatin fibre • Chromatin is formed by wrapping the DNA around complexes of the 4 histone proteins (2 molecules each of histones H2A, H2B, H3, H4) to form “beads on string” arrangement - the beads are nucleosomes • See figures 24-23, 24-24, ta ...


... Write notes in your Milestone Journal and answer the practice questions. ...
Protein Synthesis Notes File
Protein Synthesis Notes File

... 3. RNA polymerase slides along the DNA molecule __________________ until it hits a ______________ _________________. a) The DNA start codon is _____________ b) This creates the first RNA codon ____________ and the nucleotides are added 5'--> 3' 4. RNA polymerase will copy the DNA codons until it enc ...
Advances in Genetics
Advances in Genetics

... • Inbred organisms have alleles very similar to their parents • This increases the chance of a genetic disorder showing in the offspring ...
SI Worksheet 11
SI Worksheet 11

... 7. A sequence of pictures of polypeptides synthesis shows a ribosome holding two transfer RNAs. One tRNA has a polypeptide chain attached to it, the other tRNA has a single amino acid attaches to it. What does the next picture show? a. the polypeptide chain moves over and bonds to the single amino a ...
Gel Electrophoresis DNA Fingerprinting
Gel Electrophoresis DNA Fingerprinting

... • In this hypothetical case, DNA was extracted from samples obtained from the five possible suspects, and the crime scene sample • You will cleave the DNA with a restriction enzyme and simulated a “mock” DNA fingerprint analysis using Southern Blotting ...
DNA Structure - Colorado State University
DNA Structure - Colorado State University

... still generally have the same proteins, but make them very differently (such as English vs. German). Generally, the more closely related two species (or organisms) are, the more similar their DNA and protein sequences are to each other. The greater the time since the two species shared a common ance ...
DNA Replication
DNA Replication

... • 5) The ribosome slides along the mRNA to the next codon • 6) A new tRNA molecule carrying amino acid pairs with the 2nd ...
ppt
ppt

... •After transcription, mRNA introns are cut out •The exons are reattached to form “mature” mRNA •Exons are rearranged to form different proteins (alt. splicing) •This allows 30,000 genes to produce 120,000 diff. proteins. ...
Chapter 4 Review PP
Chapter 4 Review PP

... What type of mutation is occurring in the following DNA sequence (and where): CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Substitution – CATGCCTGACCTCTGATGCCA Mutation 2: CATGCCTGACGTCTGATGCCAA A – Addition – CATGCCTGACGTCTGATGCCAA Mutation 3: CATCCTGACGTCTGATGCCA A – Deletion - CATC ...
2.6 Structure of DNA and RNA
2.6 Structure of DNA and RNA

PASS Leader Info
PASS Leader Info

... 3) Possible changes to the amino acid where it occurs as well as to all downstream amino acids from that point. 4) Poor replication of the DNA. 5) Immediate death to the cell. ...
< 1 ... 926 927 928 929 930 931 932 933 934 ... 1026 >

Deoxyribozyme



Deoxyribozymes, also called DNA enzymes, DNAzymes, or catalytic DNA, are DNA oligonucleotides that are capable of catalyzing specific chemical reactions, similar to the action of other biological enzymes, such as proteins or ribozymes (enzymes composed of RNA).However, in contrast to the abundance of protein enzymes in biological systems and the discovery of biological ribozymes in the 1980s,there are no known naturally occurring deoxyribozymes.Deoxyribozymes should not be confused with DNA aptamers which are oligonucleotides that selectively bind a target ligand, but do not catalyze a subsequent chemical reaction.With the exception of ribozymes, nucleic acid molecules within cells primarily serve as storage of genetic information due to its ability to form complementary base pairs, which allows for high-fidelity copying and transfer of genetic information. In contrast, nucleic acid molecules are more limited in their catalytic ability, in comparison to protein enzymes, to just three types of interactions: hydrogen bonding, pi stacking, and metal-ion coordination. This is due to the limited number of functional groups of the nucleic acid monomers: while proteins are built from up to twenty different amino acids with various functional groups, nucleic acids are built from just four chemically similar nucleobases. In addition, DNA lacks the 2'-hydroxyl group found in RNA which limits the catalytic competency of deoxyribozymes even in comparison to ribozymes.In addition to the inherent inferiority of DNA catalytic activity, the apparent lack of naturally occurring deoxyribozymes may also be due to the primarily double-stranded conformation of DNA in biological systems which would limit its physical flexibility and ability to form tertiary structures, and so would drastically limit the ability of double-stranded DNA to act as a catalyst; though there are a few known instances of biological single-stranded DNA such as multicopy single-stranded DNA (msDNA), certain viral genomes, and the replication fork formed during DNA replication. Further structural differences between DNA and RNA may also play a role in the lack of biological deoxyribozymes, such as the additional methyl group of the DNA base thymidine compared to the RNA base uracil or the tendency of DNA to adopt the B-form helix while RNA tends to adopt the A-form helix. However, it has also been shown that DNA can form structures that RNA cannot, which suggests that, though there are differences in structures that each can form, neither is inherently more or less catalytic due to their possible structural motifs.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report