AQA A-level Biology
... to make many other carbohydrates. Two α-glucose molecules join by condensation to form a molecule of the disaccharide maltose. The bond forms between carbon 1 of one α-glucose molecule and carbon 4 of the other, and is called a glycosidic bond (see Figure 1.5). Other disaccharides form in a similar ...
... to make many other carbohydrates. Two α-glucose molecules join by condensation to form a molecule of the disaccharide maltose. The bond forms between carbon 1 of one α-glucose molecule and carbon 4 of the other, and is called a glycosidic bond (see Figure 1.5). Other disaccharides form in a similar ...
Identification of a novel human ... through its interaction with the ...
... been identified which mediate these interactions including SH21 domains, which bind specific phosphotyrosine-containing peptide sequences, SH3 domains, which target specific prolinerich motifs with a PXXP core, and PDZ domains, which interact with the C-terminal consensus (S/T/Y)X(V/I) (2,3). Anothe ...
... been identified which mediate these interactions including SH21 domains, which bind specific phosphotyrosine-containing peptide sequences, SH3 domains, which target specific prolinerich motifs with a PXXP core, and PDZ domains, which interact with the C-terminal consensus (S/T/Y)X(V/I) (2,3). Anothe ...
Mrs C`s Chem Lecture
... EXAMPLE Acts as a base; can pick up an H+ from the surrounding solution (water, in living organisms). Glycine Because it also has a carboxyl group, glycine is both an amine and a carboxylic acid; compounds with both groups are called amino acids. ...
... EXAMPLE Acts as a base; can pick up an H+ from the surrounding solution (water, in living organisms). Glycine Because it also has a carboxyl group, glycine is both an amine and a carboxylic acid; compounds with both groups are called amino acids. ...
"Value of Digestive Enzymes" by Bill Evans
... than eating, thinking, or even breathing. That may sound like an exaggeration, but the truth is that without enzymes, the body could not sustain life. All plant and animal cells produce enzymes, made from protein molecules (long chains of amino acids held together by peptide bonds). Enzymes are cata ...
... than eating, thinking, or even breathing. That may sound like an exaggeration, but the truth is that without enzymes, the body could not sustain life. All plant and animal cells produce enzymes, made from protein molecules (long chains of amino acids held together by peptide bonds). Enzymes are cata ...
Determination of the Binding Site-Size of the Protein
... crude cell extracts, it is thought that cell extracts contain many other DNA-binding proteins (and their regulatory proteins), and some small molecules (such as ATP and DNA metabolites), that are also able to interact with the DNA and the target protein; these molecules may cause some unpredictable ...
... crude cell extracts, it is thought that cell extracts contain many other DNA-binding proteins (and their regulatory proteins), and some small molecules (such as ATP and DNA metabolites), that are also able to interact with the DNA and the target protein; these molecules may cause some unpredictable ...
Marine Drugs Atypical Reactive Center Kunitz-Type Inhibitor from the Sea Heteractis crispa
... therapeutic application of protease inhibitors [1–3]. Therefore, proteases and their inhibitors are attractive targets and intensively studied protein-protein complexes. Venomous animals are known to be a rich source of protease inhibitors, which can be used in biotechnology and medicine as prototyp ...
... therapeutic application of protease inhibitors [1–3]. Therefore, proteases and their inhibitors are attractive targets and intensively studied protein-protein complexes. Venomous animals are known to be a rich source of protease inhibitors, which can be used in biotechnology and medicine as prototyp ...
Background reading from Campbell et al
... Readings from Campbell & Reece (2005) Biology 7th Ed What I shall expect from my students is that you are familiar with the basic terminology (e.g., what is a phenotype, a genotype, an allele; what is a protein, an amino acid, a nucleic acid) and concepts – what happens during meiosis and mitosis; h ...
... Readings from Campbell & Reece (2005) Biology 7th Ed What I shall expect from my students is that you are familiar with the basic terminology (e.g., what is a phenotype, a genotype, an allele; what is a protein, an amino acid, a nucleic acid) and concepts – what happens during meiosis and mitosis; h ...
bioc-2200-a-biol-2200-a-mock-final-exam
... 6. The purpose of conversion of pyruvate to lactate during anaerobic fermentation of glucose is to: a. produce carbon dioxide b. produce oxygen c. allow for the reoxidation of NADH d. allow the complete oxidation of glucose 7. Which of the following reactions of the Citric Acid Cycle produces CO2? a ...
... 6. The purpose of conversion of pyruvate to lactate during anaerobic fermentation of glucose is to: a. produce carbon dioxide b. produce oxygen c. allow for the reoxidation of NADH d. allow the complete oxidation of glucose 7. Which of the following reactions of the Citric Acid Cycle produces CO2? a ...
English - Orphanet
... Cystathionine beta synthase is an enzyme that breaks down methionine. A deficiency of this enzyme leads to a build-up of toxic homocysteine in the body. Classic homocystinuria consists of chronic intoxication, without acute decompensation except for vascular accidents and acute psychiatric episodes, ...
... Cystathionine beta synthase is an enzyme that breaks down methionine. A deficiency of this enzyme leads to a build-up of toxic homocysteine in the body. Classic homocystinuria consists of chronic intoxication, without acute decompensation except for vascular accidents and acute psychiatric episodes, ...
Chemical Disinfection
... Ø Microbe type (e.g., mycobacteria, spores, and certain viruses can be very resistant to disinfection—in general vegetative cells in log phase are easiest to kill) Ø Substrate effects (e.g., high organic content interferes with ...
... Ø Microbe type (e.g., mycobacteria, spores, and certain viruses can be very resistant to disinfection—in general vegetative cells in log phase are easiest to kill) Ø Substrate effects (e.g., high organic content interferes with ...
45_Biochemistry of Muscles
... • Skeletal muscle contains phosphocreatine, which acts as an energy store for short-term (seconds) demands. • Free fatty acids in plasma are a major source of energy, particularly under marathon conditions and in prolonged starvation. • Skeletal muscle can utilize ketone bodies during starvation. • ...
... • Skeletal muscle contains phosphocreatine, which acts as an energy store for short-term (seconds) demands. • Free fatty acids in plasma are a major source of energy, particularly under marathon conditions and in prolonged starvation. • Skeletal muscle can utilize ketone bodies during starvation. • ...
Molecular Evolution Molecular differences accumulate linearly
... GCAAGCATCCCCGCCCC-GTGAGT-CACCCTCTAAATCGCCATGATCAAAAGGAACAAGT GCAAGCATCCCCGCCCCAGTGAGT-CACCCTCTAAATCACCACGATCAAAAGGAACAAGC ...
... GCAAGCATCCCCGCCCC-GTGAGT-CACCCTCTAAATCGCCATGATCAAAAGGAACAAGT GCAAGCATCCCCGCCCCAGTGAGT-CACCCTCTAAATCACCACGATCAAAAGGAACAAGC ...
Practice Exam 1
... 5. At the end of the exam, "grade" your responses. THEN go back and try and figure out the ones you answered incorrectly. Use your notes/book if you need to at this point. 6. If you are still confused, contact an instructor or TA during their office hours or by email so that you can get your questio ...
... 5. At the end of the exam, "grade" your responses. THEN go back and try and figure out the ones you answered incorrectly. Use your notes/book if you need to at this point. 6. If you are still confused, contact an instructor or TA during their office hours or by email so that you can get your questio ...
Gold Biotechnology Enzyme and Antibody Immobilization
... Enzyme and Antibody Immobilization Aminoethyl and Glyoxal Agarose Beads General Information Biomolecules can be immobilized by binding them to a support under conditions that will then determine the characteristics of the complex. Immobilization is used in different industrial processes to produce c ...
... Enzyme and Antibody Immobilization Aminoethyl and Glyoxal Agarose Beads General Information Biomolecules can be immobilized by binding them to a support under conditions that will then determine the characteristics of the complex. Immobilization is used in different industrial processes to produce c ...
Export To Word
... Proteins are essential for all functions necessary for life in organisms. Proteins are created by reading the sequence of nucleotides in genetic material (DNA). During cellular processes known as transcription and translation, the DNA code is read, transferred into a copy called mRNA, and then the c ...
... Proteins are essential for all functions necessary for life in organisms. Proteins are created by reading the sequence of nucleotides in genetic material (DNA). During cellular processes known as transcription and translation, the DNA code is read, transferred into a copy called mRNA, and then the c ...
PPT - Bruce Blumberg
... http://blumberg-serv.bio.uci.edu/bio203-w2002/index.htm http://blumberg.bio.uci.edu/bio203-w2002/index.htm ...
... http://blumberg-serv.bio.uci.edu/bio203-w2002/index.htm http://blumberg.bio.uci.edu/bio203-w2002/index.htm ...
What is sequence alignment - department of computer & electrical
... and (due to the evolutionary connection) have similar function The sequence alignment problem is an optimization problem: produce the best alignment according to a scoring function A scoring function provide numeric values for each possible symbol pairing and for gaps in an alignment. ...
... and (due to the evolutionary connection) have similar function The sequence alignment problem is an optimization problem: produce the best alignment according to a scoring function A scoring function provide numeric values for each possible symbol pairing and for gaps in an alignment. ...
lecture4
... We turn now from the metabolism of carbohydrates to that of fatty acids. A fatty acid contains a long hydrocarbon chain and a terminal carboxylate group. Fatty acids have four major physiological roles. First, fatty acids are building blocks of phospholipids and glycolipids. These amphipathic molecu ...
... We turn now from the metabolism of carbohydrates to that of fatty acids. A fatty acid contains a long hydrocarbon chain and a terminal carboxylate group. Fatty acids have four major physiological roles. First, fatty acids are building blocks of phospholipids and glycolipids. These amphipathic molecu ...
Rhodopsin
... •Amino acids that provide stabilization of structure between five helices are shown •Disulfide bond between Cys110 and Cys-187 •Ala-299 peptide carbonyl hydrogen bonds with Asn-55 and Asp-83 •Asp-83 connects by a water molecule to Gly-120 •Asn-78 hydrogen bonds to Ser-127, Thr-160, and Trp161 •Asn-3 ...
... •Amino acids that provide stabilization of structure between five helices are shown •Disulfide bond between Cys110 and Cys-187 •Ala-299 peptide carbonyl hydrogen bonds with Asn-55 and Asp-83 •Asp-83 connects by a water molecule to Gly-120 •Asn-78 hydrogen bonds to Ser-127, Thr-160, and Trp161 •Asn-3 ...
FST 202: Food Biochemistry 3 Units A. Carbohydrate
... certain archaea—pyrrolysine. Shortly after or even during synthesis, the residues in a protein are often chemically modified by post-translational modification, which alters the physical and chemical properties, folding, stability, activity, and ultimately, the function of the proteins. Sometimes pr ...
... certain archaea—pyrrolysine. Shortly after or even during synthesis, the residues in a protein are often chemically modified by post-translational modification, which alters the physical and chemical properties, folding, stability, activity, and ultimately, the function of the proteins. Sometimes pr ...
Effect of peptide chain length on amino acid and
... or absorbed pancreatic proteases, before absorption [19, 201. In contrast to the results of the perfusions with LH1, 13 residues were absorbed at similar rates from LH2 and its free amino acid mixture and the remaining four were actually absorbed faster from the amino acid mixture. The most likely r ...
... or absorbed pancreatic proteases, before absorption [19, 201. In contrast to the results of the perfusions with LH1, 13 residues were absorbed at similar rates from LH2 and its free amino acid mixture and the remaining four were actually absorbed faster from the amino acid mixture. The most likely r ...
wt - EMBO
... Advantages of DT40 cells for our studies: centrosomal proteins are very stable; siRNA does not offer a good option centrosome proteins are large and modular; DT40 offers a system to study specific domains the majority of centrosomal proteins are not essential; knockouts survive little is known abou ...
... Advantages of DT40 cells for our studies: centrosomal proteins are very stable; siRNA does not offer a good option centrosome proteins are large and modular; DT40 offers a system to study specific domains the majority of centrosomal proteins are not essential; knockouts survive little is known abou ...
Proteolysis
Proteolysis is the breakdown of proteins into smaller polypeptides or amino acids. Uncatalysed, the hydrolysis of peptide bonds is extremely slow, taking hundreds of years. Proteolysis is typically catalysed by cellular enzymes called proteases, but may also occur by intra-molecular digestion. Low pH or high temperatures can also cause proteolysis non-enzymatically.Proteolysis in organisms serves many purposes; for example, digestive enzymes break down proteins in food to provide amino acids for the organism, while proteolytic processing of a polypeptide chain after its synthesis may be necessary for the production of an active protein. It is also important in the regulation of some physiological and cellular processes, as well as preventing the accumulation of unwanted or abnormal proteins in cells. Consequently, dis-regulation of proteolysis can cause diseases, and is used in some venoms to damage their prey.Proteolysis is important as an analytical tool for studying proteins in the laboratory, as well as industrially, for example in food processing and stain removal.