Microarrays = Gene Chips
... The chip has almost 30,000 pieces of genetic material taken from thousands of different viruses, bacteria, fungi and parasites – represent all recognized 1,710 vertebrate viral species and 135 bacterial, 73 fungal, and 63 parasite genera. For each family or genus at least 3 separate genomic target r ...
... The chip has almost 30,000 pieces of genetic material taken from thousands of different viruses, bacteria, fungi and parasites – represent all recognized 1,710 vertebrate viral species and 135 bacterial, 73 fungal, and 63 parasite genera. For each family or genus at least 3 separate genomic target r ...
Document
... •Genes are separeted from each others by sequences which function is unknown •Only other strand of the DNA carries biological information template strand •Potential to store biological information is enormous ...
... •Genes are separeted from each others by sequences which function is unknown •Only other strand of the DNA carries biological information template strand •Potential to store biological information is enormous ...
AIR Genetics Review PPT
... • DNA will duplicate itself by separating the two strands and pairing new bases to the old strands • This process is called semi-conservative because the new DNA is made of one strand that was “old” and one new strand ...
... • DNA will duplicate itself by separating the two strands and pairing new bases to the old strands • This process is called semi-conservative because the new DNA is made of one strand that was “old” and one new strand ...
Vocabulary:
... communicates to your cells what proteins need to be made. For example, AGGGGGGGCCCAAATTTAAAATTTTAAAAA may be the recipe for making one particular protein but GGGGGGGGGCCCCCCCCCCCAAAAA would be a totally different ...
... communicates to your cells what proteins need to be made. For example, AGGGGGGGCCCAAATTTAAAATTTTAAAAA may be the recipe for making one particular protein but GGGGGGGGGCCCCCCCCCCCAAAAA would be a totally different ...
Concept 18.3. How get genetic variation in prokaryotes: • E. coli is
... E. coli is the lab rat of molecular biology. DNA is ds, circular and associated with proteins = 1mm length. Eukaryotic DNA is linear and associated with lots of proteins. 4.6 million bases = 4,400 genes, 1/1000th DNA in Human somatic cells. DNA fills nucleoid-dense region of DNA. In addition have pl ...
... E. coli is the lab rat of molecular biology. DNA is ds, circular and associated with proteins = 1mm length. Eukaryotic DNA is linear and associated with lots of proteins. 4.6 million bases = 4,400 genes, 1/1000th DNA in Human somatic cells. DNA fills nucleoid-dense region of DNA. In addition have pl ...
View PDF
... Eukaryotic DNA is linear and associated with lots of proteins. 4.6 million bases = 4,400 genes, 1/1000th DNA in Human somatic cells. DNA fills nucleoid-dense region of DNA. In addition have plasmids ( several dozen genes). Divide by binary fission. Fig. 18.14 Replication of Bacterial DNA-single orig ...
... Eukaryotic DNA is linear and associated with lots of proteins. 4.6 million bases = 4,400 genes, 1/1000th DNA in Human somatic cells. DNA fills nucleoid-dense region of DNA. In addition have plasmids ( several dozen genes). Divide by binary fission. Fig. 18.14 Replication of Bacterial DNA-single orig ...
DNA - Northern Highlands
... Complete each statement by writing in the correct word or words. Word Bank-.bacteriophage, transformation, base- pairing, replication, telomere, DNA polymerase (some words will be used more than once) ...
... Complete each statement by writing in the correct word or words. Word Bank-.bacteriophage, transformation, base- pairing, replication, telomere, DNA polymerase (some words will be used more than once) ...
Document
... 4. In the following diagrams, the vertical lines represent EcoRI restriction sites. An asterisk over the site represents a polymorphism (presence or absence of the site in individuals) in the population. The double arrow represents the boundaries of the cloned DNA used in the Southern blot analysis. ...
... 4. In the following diagrams, the vertical lines represent EcoRI restriction sites. An asterisk over the site represents a polymorphism (presence or absence of the site in individuals) in the population. The double arrow represents the boundaries of the cloned DNA used in the Southern blot analysis. ...
DNA Control Mechanisms
... D. Heterochromatin - This refers to DNA that remains condensed even during interphase. – It is NOT active. 1. This CANNOT do transcription so it is inactivated. (“hetero” means “different”) E. Euchromatin - This refers to DNA that IS loose during interphase. – It IS active. 1. It CAN do transcriptio ...
... D. Heterochromatin - This refers to DNA that remains condensed even during interphase. – It is NOT active. 1. This CANNOT do transcription so it is inactivated. (“hetero” means “different”) E. Euchromatin - This refers to DNA that IS loose during interphase. – It IS active. 1. It CAN do transcriptio ...
12.1 - DNA History / Discovery
... on through chromosomes ● Compacted DNA and proteins = chromosomes ● Genetic information is stored in the nucleus ...
... on through chromosomes ● Compacted DNA and proteins = chromosomes ● Genetic information is stored in the nucleus ...
Cells - Salisbury University
... 2. A complementary strand is formed along each strand of the original molecule. 3. The result is two identical DNA molecules, each with one strand from the original molecule D. very fast, very accurate (ca. 1 mutation per 100 million nucleotides copied) E. involves many enzymes and other proteins F. ...
... 2. A complementary strand is formed along each strand of the original molecule. 3. The result is two identical DNA molecules, each with one strand from the original molecule D. very fast, very accurate (ca. 1 mutation per 100 million nucleotides copied) E. involves many enzymes and other proteins F. ...
Chapter 13 Genetic Engineering - Mrs. Moyer
... the DNA code of a living organism ► Extract DNA from cells ► Cutting DNA with restriction enzymes ► Separate DNA using gel electrophoresis ► Identify the sequence using different dyes that attach to nitrogen bases ► Make copies using polymerase chain reaction ...
... the DNA code of a living organism ► Extract DNA from cells ► Cutting DNA with restriction enzymes ► Separate DNA using gel electrophoresis ► Identify the sequence using different dyes that attach to nitrogen bases ► Make copies using polymerase chain reaction ...
I Will Divide
... But then I moved on into S phase and made a copy of my DNA And I grew strong (in G2) And then I got my spindle on! Chorus Oh, no, but I, I will divide! Oh, through the stages of mitosis, I know my genes will stay alive I've made two new daughter cells, and they’ve got all my DNA I will divide! I wil ...
... But then I moved on into S phase and made a copy of my DNA And I grew strong (in G2) And then I got my spindle on! Chorus Oh, no, but I, I will divide! Oh, through the stages of mitosis, I know my genes will stay alive I've made two new daughter cells, and they’ve got all my DNA I will divide! I wil ...
Nedmolecularbio1of32013 40 KB
... one by one and extends the chain 5’ to 3’. DNA polymerases fall into two general categories. Low fidelity polymerases operate in a fast and loose manner, while high fidelity polymerases operate in a slow but tight manner. Copying/ importance of fidelity will be illustrated in class. -Step 3: REWIND/ ...
... one by one and extends the chain 5’ to 3’. DNA polymerases fall into two general categories. Low fidelity polymerases operate in a fast and loose manner, while high fidelity polymerases operate in a slow but tight manner. Copying/ importance of fidelity will be illustrated in class. -Step 3: REWIND/ ...
Inheriting Characteristics
... • DNA stands for Deoxyribose Nucleic Acid • In the 1950’s Watson and Crick were the first to come up with the structure of DNA • On each chromosome of the pair there can be different version of the same gene, i.e. blue or brown eyes • The variations are known as “alleles” ...
... • DNA stands for Deoxyribose Nucleic Acid • In the 1950’s Watson and Crick were the first to come up with the structure of DNA • On each chromosome of the pair there can be different version of the same gene, i.e. blue or brown eyes • The variations are known as “alleles” ...
Chapter 20 Terms to Know
... Techniques used to clone certain species (mammals) Reprogramming differentiated cells or using stem cells to become needed tissues in patients with diseases or physical harm Use of restriction enzymes and electrophoresis to distinguish one person from another ...
... Techniques used to clone certain species (mammals) Reprogramming differentiated cells or using stem cells to become needed tissues in patients with diseases or physical harm Use of restriction enzymes and electrophoresis to distinguish one person from another ...
Learning Target #1: Know vocabulary that builds the
... ______ 3. The process by which a cell makes a copy of the DNA. ______ 4. The building blocks of a protein. ______ 5. One form of a gene. ______ 6. An organism’s genetic makeup or the letters used to represent the trait. ______ 7. A chart or “family tree” that tracks the inheritance of a particular t ...
... ______ 3. The process by which a cell makes a copy of the DNA. ______ 4. The building blocks of a protein. ______ 5. One form of a gene. ______ 6. An organism’s genetic makeup or the letters used to represent the trait. ______ 7. A chart or “family tree” that tracks the inheritance of a particular t ...