• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
3D-structure of bacterial ribosomes, the machines that make
3D-structure of bacterial ribosomes, the machines that make

... most proteins don’t During production many proteins can only obtain correct folding if assisted by other proteins (chaperones) during production in living cells If large quantities of a specific chaperone-dependent protein is produced in a cell, it may become misfolded. This represents a very seriou ...
BICH 605
BICH 605

... subunits of different molecular size will be resolved into constituent polypeptides. Screen fractions during protein purification. Quaternary structure profile: Comparison of the protein bands obtained under non-reducing and reducing conditions provides information about the molecular size of subuni ...
Chapter Twelve Protein Synthesis: Translation of the
Chapter Twelve Protein Synthesis: Translation of the

... • In all organisms, synthesis of polypeptide chain starts at the N-terminal end, and grows from Nterminus to C-terminus • Initiation requires: ...
Supplemental Methods and Figure Legends
Supplemental Methods and Figure Legends

... Supplemental methods. Plasmids for expressing P. angusta H3 and H4 in S. cerevisiae: The S. cerevisiae HHT2 and HHF2 genes (respectively, chr. XIV coordinates 575,265-576,092 and 576,046-577,238) were amplified by PCR and cloned separately into pGEM-T (Promega). An XhoI site was incorporated into th ...
Proteins - ISMScience.org
Proteins - ISMScience.org

... These include enzymes like the DNA and RNA polymerases, DNA ligase, helicase, and 1000’s of others ...
1X Equilibration/Wash Buffer (pH 7.0)
1X Equilibration/Wash Buffer (pH 7.0)

... Protein expression and purification from E. coli 1. Seed culture - Inoculate 5 ml of LB medium containing the appropriate antibiotics (ampicillin) with a fresh bacterial colony harboring the expression plasmid. Grow at 37°C 2. Main culture - Dilute the non-induced overnight culture 1:100 (e.g., ino ...
No Slide Title
No Slide Title

... *All restraints were picked so that they were incorrect **All restraints were picked so that they were correct ...
Essential amino acids
Essential amino acids

... made of protein, has been degraded ◦ At this point, attempts to prevent death by giving food or protein fail ...
2014
2014

... Indicate the tRNA anticodon sequences (correctly labeling 5' and 3' ends) that would recognize each of the six codons for this minimal number of tRNA molecules: Anticodon sequence (label polarity) 3'-GCI-5' or 3'-GCG-5' ...
protein intake for optimal muscle maintenance
protein intake for optimal muscle maintenance

... amino acids are those that our body cannot make on its own and thus, these amino acids must come from the foods we eat. A complete protein is named just that because it will contain all of the essential amino acids our body needs to repair and grow. These proteins sources are animal-based and includ ...
Mass spectrometry and proteomics Steven P Gygi* and Ruedi
Mass spectrometry and proteomics Steven P Gygi* and Ruedi

... proteins directly from tissue. Second, the stable-isotopeenriched media are costly and may themselves affect cellular growth and protein production. Third, the increase in nominal mass because of stable-isotope incorporation is not known until the sequence is determined. Therefore protein identifica ...
Identification of a putative flexible loop in Arabidopsis glutathione
Identification of a putative flexible loop in Arabidopsis glutathione

... the Arabidopsis cDNA clone (wild type and the three mutants) was subcloned from pGSH222 and its derivatives by PCR using two primers, GCGAATTCATGGAATCACAGAAACC and GTTGTCGACTGATCAAGATGGTTGTGAA (the underlined sequences introduced EcoRI and SalI restriction sites). The DNA was then cloned following E ...
activator - Cardinal Newman High School
activator - Cardinal Newman High School

... • When tryptophan is present, it binds to the trp repressor protein, which turns the operon off • The repressor is active only in the presence of its corepressor tryptophan; thus the trp operon is turned off (repressed) if tryptophan levels are ...
12.1 Mechanisms regulating enzyme synthesis 12.1.2.2 Enzyme
12.1 Mechanisms regulating enzyme synthesis 12.1.2.2 Enzyme

... constitutively with its own promoter.  In the absence of the inducer, the LacI protein binds the operator region of the lac operon, inhibiting RNA polymerase from binding the promoter region.  When the inducer (lactose or IPTG, an analogue of lactose) is available, it binds the LacI protein, remov ...
2012-ISB-symposium
2012-ISB-symposium

... relationship between observed peptides and protein structure including visualization of the locations of the peptides. Coverage statistics and analysis are provided. This tool has been coupled with the Peptide Atlas, a compendium of millions of peptide observations from experiments conducted in doze ...
Product Data Sheet - Max Muscle Sports Nutrition
Product Data Sheet - Max Muscle Sports Nutrition

... Naturliga™ Protein is a new and exciting all natural, 100% plant-based vegetarian protein. Naturliga™ Protein provides a pure and high quality pea protein isolate delivering 16 grams protein and 9 grams fiber per serving. Naturliga™ Protein is dairy and soy free, gluten free, cholesterol free, is no ...
An acidic region of the 89K murine cytomegalovirus immediate early
An acidic region of the 89K murine cytomegalovirus immediate early

... were reacted with MAb 6/20/1 or antisera raised against peptides of pp89 (Miinch et al., 1991) (not shown). Extracts of bacterial cells expressing the fl-gal (Fig. 4b, lanes 1 to 8) or the TrpE proteins (Fig. 4b, lanes 9 to 16) contained only one bacterial protein of Mr 170K with significant DNA-bin ...
Table of Contents - Arizona Science Center
Table of Contents - Arizona Science Center

... Of all the molecules found in living organisms, proteins are the most important. Proteins carry out vital functions in every cell. Without some very special proteins, called enzymes, the cells in our bodies would not be able to perform important chemical reactions fast enough to sustain life. Back t ...
PDF
PDF

... Degenerate oligos designed against the highly conserved b-HLH region of known twist-class genes were used to amplify an 87-bp fragment from genomic DNA of H. robusta. This gene fragment encodes a 29-aminoacid peptide that is homologous to the b-HLH domain of the twist-class genes, starting with the ...
Various Career Options Available
Various Career Options Available

... Visualization of these “complexes” of proteins and potential drugs can help scientists understand the mechanism of action of the drug and to improve the design of a drug Visualization uses computational “ball and stick” model of atoms and bonds, as well as surfaces ...
The Number of Protein Subunits Per Helix Turn in Narcissus Mosaic
The Number of Protein Subunits Per Helix Turn in Narcissus Mosaic

... (Tollin et al., 1968) also slightly favoured a q value of 9, we have now combined the results of Fourier transform calculations based on digitization of the electron micrographs (Low, 1982), and molecular volume calculations based on the amino acid composition of the N M V protein and the R N A cont ...
Amino Acid Differences in the Deduced 5
Amino Acid Differences in the Deduced 5

... borohydride from Serva; ampicillin from Gibco; dipalmitoyl phosphatidylcholine, isopropyl-␤-D-thiogalactopyranoside (IPTG), and ATP-sepharose from Sigma-Aldrich; and HPLC standards of hydroxy fatty acids and LT A4 methyl ester from Cayman Chemical (distributed by Alexis GmbH). HPLC solvents were obt ...
Environmental DNA-Encoded Antibiotics Fasamycins A and B Inhibit
Environmental DNA-Encoded Antibiotics Fasamycins A and B Inhibit

... these mutants, in conjunction with in vitro biochemical assays, showed that the fasamycins inhibit FabF of type II fatty acid biosynthesis (FASII). Candidate gene overexpression studies also showed that fasamycin resistance is conferred by fabF overexpression. On the basis of comparisons with known ...
2. Snuffle Snork
2. Snuffle Snork

... During one of my recent excursions to the wilds of Schmidlandia, I discovered a previously unknown creature. I have named this new life form Snorkus schmiddicus, or “Snork” for short. I was able to capture four different individuals and collect a sample of their DNA. They were then released unharmed ...
Materials and Methods
Materials and Methods

... Analyses of sequence parameters influencing suitability for NMR structure determination. Nearly 1,000 protein constructs less than 200 amino acids in length that were expressed and soluble at a sufficient level were screened for their suitability for NMR solution-structure determination by the NESG. ...
< 1 ... 127 128 129 130 131 132 133 134 135 ... 221 >

Expression vector

An expression vector, otherwise known as an expression construct, is usually a plasmid or virus designed for protein expression in cells. The vector is used to introduce a specific gene into a target cell, and can commandeer the cell's mechanism for protein synthesis to produce the protein encoded by the gene. Expression vectors are the basic tools in biotechnology for the production of proteins.The plasmid is engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the production of protein, and this may be achieve by the production of significant amount of stable messenger RNA, which can then be translated into protein. The protein may be expressed constitutively, or induced when necessary using an inducer. Escherichia coli is commonly used as the host for protein expression, other cell types however may also be used. An example of the use of expression vector is the production of insulin which is used for medical treatments of diabetes.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report