• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
(Heterobasidion annosum) in
(Heterobasidion annosum) in

... invasion and vascular colonization, respectively, with corresponding host responses in the form of recognition, active defence and loss of root vigor. Several pathways potentially used by conifers in responding to fungal infection were identified and are discussed with reference to the literature on ...
Combinatorial Expression of Three Zebrafish Genes Related to
Combinatorial Expression of Three Zebrafish Genes Related to

... obtained clones corresponding to two additional dlx genes, dlx2 and dlx4, and several more dlx3 cDNA clones. The longest dfx3 cDNA clone, with 1532 bp, contains an open reading frame of 843 bp (Fig. 1). Several potential ATG initiation codons are located near the 5’ end of the open reading frame; th ...
The Euglena gracilis chloroplast rpoB gene
The Euglena gracilis chloroplast rpoB gene

... the rpoB locus were characterized by Northern hybridization. Fully-spliced, monocistronic rpoB mRNA, as well as rpoB-rpoC1 and rpoB1-rpoC1-rpoC2 mRNAs were identified. INTRODUCTION Chloroplast genes are transcribed, and the resulting mRNAs are translated via plastid-specific RNA polymerase(s) and ri ...
No Slide Title
No Slide Title

... IFNs consist of two types: type I (IFN-a, IFN-b) and type II (IFN-g). Type I and II IFNs bind to different receptors and activate overlapping but distinct genes. 2. Identification of genes which are specifically activated by IFN-a and IFN-g, characterizing the specific DNA sequences responsible for ...
Engineering Programmable Nucleases: Applications in the Study of
Engineering Programmable Nucleases: Applications in the Study of

... How do we locate a specific “address” within the genome? Gene X ...
Gene Expression Profiling During Asexual Development of the Late
Gene Expression Profiling During Asexual Development of the Late

... be purified from hyphae, and each developmental stage described above can be induced without a plant host, which is not the case for many oomycetes (Hardham and Hyde 1997). Also, progress has begun to be made toward identifying genes and proteins involved in the different life stages. For example, e ...
Biological Sequence Data Formats
Biological Sequence Data Formats

... You do not have to have complicated titles. It is easy to make up your own titles. For example: > Seq1 CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAA ...
Sulfuritalea hydrogenivorans gen. nov., sp. nov., a facultative
Sulfuritalea hydrogenivorans gen. nov., sp. nov., a facultative

... 280 mM NaCl) and temperature (2, 5, 8, 13, 20, 22, 25, 28, 30, 32, 34, 37, 42 uC) on growth of the strain were tested under aerobic conditions by using MOPS-buffered medium supplemented with 16 mM sodium acetate. Growth was tested at pH 6.0, 6.4, 6.5, 6.7, 6.8, 6.9, 7.1, 7.3, 7.6, 7.9, 8.2 and 9.0 i ...
blast
blast

... Global alignment • One approach for searching a query sequence is to align the entire sequence against all sequences in a database • This approach is very slow and hence ...
PCR
PCR

... random hexamers or oligo(dT) primer). To differentiate between amplification of cDNA and amplification of contaminating genomic DNA, design primers to anneal to sequences in exons on opposite sides of an intron, so any amplification product derived from genomic DNA will be much larger than the produ ...
BB30055: Genes and genomes
BB30055: Genes and genomes

... Tandem repeats – replication slippage etc Interspersed repeats – transposition events ...
Fastest, Easiest Adenoviral System Ever
Fastest, Easiest Adenoviral System Ever

... Adenoviral gene transfer is one of the most reliable methods for introducing genes into mammalian cells. Because infection by adenovirus is not cell-cycle dependent, you can deliver your gene to primary as well as transformed cell lines. Adenoviruses are ideal tools for protein production in mammali ...
Article Parallel Histories of Horizontal Gene
Article Parallel Histories of Horizontal Gene

... Husnik et al. 2013). Similar to the endosymbionts of many phloem-feeding insects (Hansen and Moran 2013), Carsonella has lost the genes necessary for production of ornithine, a substrate in the arginine biosynthesis pathway, and for catalyzing the terminal transamination reaction in the synthesis of ...
DETERMINATIVE DEGREE AND NUCLEOTIDE CONTENT OF DNA
DETERMINATIVE DEGREE AND NUCLEOTIDE CONTENT OF DNA

... The trinucleotide DNA can be listed in the similar and more cumbersome way. The full DNA sequences consist of nucleotides of all four types and are described by (10)-(11). The introduction of the determinative degree allows us to single out a kind of double-helix DNA sequences which have an addition ...
Document
Document

... are needed to see this picture. Why use a proofreading polymerase? ...
No Slide Title
No Slide Title

... • First strand synthesis often does not go to completion. – Individual cDNA clones will frequently have the reverse complement of only part of the mRNA. – Multiple cDNA clones from a single mRNA will be present in the library ...
Yeast Transformation
Yeast Transformation

... Yeast transformation exactly how these components promote transformation, a number of hypotheses have been advanced. Lithium ions neutralize the negative charges on DNA molecules to be transformed and the phospholipid bilayer of the yeast cell, and they may also generate small holes in the plasma m ...
Biosynthesis of heme in mammals
Biosynthesis of heme in mammals

... In contrast to ALAS, there is only a single ALAD gene in humans, located on chromosome 9q34 [32], which consists of two alternatively spliced non-coding exons (1A and 1B) and eleven coding exons (Fig. 4) [33]. The translational start site (ATG) is located in exon 2. A “housekeeping” promoter is loca ...
Tissue-specific codon usage and the expression of
Tissue-specific codon usage and the expression of

... We have compared codon usage between pairs of the six tissues. When comparing testis to uterus, for example, we calculate the distance between the codon usage of every pair of genes (including pairs from the same tissue), obtaining a 42by-42 symmetric matrix of pairwise distances. The distance betwe ...
Quantitative RT-PCR
Quantitative RT-PCR

... templates. If there is difficulty in the amplification, it may be very helpful to test different [Mg2+]. Titrate the [Mg2+] from 0.5 mM to 5 mM and run the PCR to determine the optimal [Mg2+]. 3. Preparation of Internal Control RNA Template The aim is to make a small internal deletion in the cDNA be ...
Steroid hormone receptor homologs in development
Steroid hormone receptor homologs in development

... proach, the receptor was shown to bind retinoic acid with high affinity (Brand et al. 1988; Benbrook et al. 1988). The structure of the two receptors are very similar (90% in the ligand-binding domain), but the B form of the receptor transactivates at a slightly lower concentration of RA (Brand et a ...
Paper Plasmid 2 - dublin.k12.ca.us
Paper Plasmid 2 - dublin.k12.ca.us

... restriction sites and genes found on the plasmid. A restriction map may also be drawn for the Cell DNA. Discuss how RE can be used to insert the DNA of interest from Cell DNA into the plasmid. d. Find which RE can be used to cut both Cell DNA and plasmid so that the Cell DNA's gene of interest can b ...
Synthese der Oligonukleotide
Synthese der Oligonukleotide

... certain analyte reaches a critical limit. This mechanism of riboswitches is in fact used by nature. A few years ago it was by R. R. Breaker (Yale university) discovered that the mRNA of proteins involved in the biosynthesis of vitamins such as thiamine, or vitamin B12, recognizes the vitamin and cha ...
5   end
5 end

... Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings ...
2-Oxoacid dehydrogenase multienzyme complexes
2-Oxoacid dehydrogenase multienzyme complexes

... immediately upstream of the coding region (Jolley et al., 1996). Moreover, N. N. Vettakkorumakankav and K. J. Stevenson (personal communication) noticed that the 76 upstream bases of their published sequence contained part of an ORF that showed high similarity to the E2 component of bacterial and eu ...
< 1 ... 49 50 51 52 53 54 55 56 57 ... 295 >

Promoter (genetics)



In genetics, a promoter is a region of DNA that initiates transcription of a particular gene. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5' region of the sense strand).Promoters can be about 100–1000 base pairs long.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report