• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Localization of the P1 protein of potato Y potyvirus in association
Localization of the P1 protein of potato Y potyvirus in association

... by SDS–PAGE on a 10 % gel. After electrophoresis, proteins were transferred to Immobilon-P membrane, and the Western blot detection of the P1 protein was done as described above. In the Western blots, a protein with a relative molecular mass of 31 kDa was detected in the samples prepared from infect ...
Novel surface layer protein genes in Bacillus
Novel surface layer protein genes in Bacillus

... 1228 aa. The ORF starts with ATG and is preceded by a typical ribosome-binding site (GGAGG) with a distance of 13 bp between the middle A of this sequence and the start codon. Two putative promoter sequences were identified at 106 nt (TTGACA, 235) and 83 nt (TATACT, 210) upstream of the start codon, ...
Differential expression of vasa homologue gene in the germ cells
Differential expression of vasa homologue gene in the germ cells

... RT-PCR was used to determine the tissue distribution of tilapia vas mRNA. An ampli®ed product of tilapia vas was seen only when testis and ovary RNAs were used. No ampli®ed products were detected in either brain, spleen, liver, heart or kidney (data not shown). In situ hybridization was used to dete ...


... The moistened filters were placed on agar plates of the same medium that had been overlayed with l-2 ml of liquid medium. Droplets of conidial suspension from each strain to be tested were then spotted on the filters. The inoculated filters were incubated for 24 h at 30° C. The filters were then air ...
GeneCensus - Gerstein Lab Publications
GeneCensus - Gerstein Lab Publications

... organisms included in the tree server provide for diverse phylogenetic comparisons. They encompass all three kingdoms of life (Eukarya, Bacteria, Archaea), diverse environments (normal to extreme), and a wide range of genome sizes (0.6-97Mbp). The architecture of the tree server is two-dimensional. ...
Table 3S
Table 3S

... operon encodes the enzyme for synthesis of citrulline which is converted to Arg by the products of the argGH genes (Belitsky, 2002). The yqiXYZ operon encodes a high affinity Arg transport system (Sekowska et al., 2001).The cysH operon together with cysK encodes enzymes for the synthesis of Cys fro ...
Lecture 21: Structure of Prokaryotic Cells
Lecture 21: Structure of Prokaryotic Cells

... the inner most of mitochondria and it contains ribosome, DNA, RNA, enzymes to run kreb cycle and other proteins. Mitochondrial DNA is circular and it has full machinery to synthesize its own RNA (mRNA, rRNA and t-RNA) and proteins. A number of difference exist between mitochondrial DNA and DNA prese ...
Nucleotide sequence of the 3h-terminal two
Nucleotide sequence of the 3h-terminal two

... 1997) is located in an independent lineage from the aphidtransmissible (BYV, CTV and BYSV) and whitefly-transmissible (LIYV) closteroviruses (Fig. 2 a). However, GLRaV-3 was not placed on the same branch as LChV, the other mealybugtransmissible closterovirus (Jelkmann et al., 1997). Rather, LChV was ...
Nucleotide sequence of the 3h-terminal two
Nucleotide sequence of the 3h-terminal two

... 1997) is located in an independent lineage from the aphidtransmissible (BYV, CTV and BYSV) and whitefly-transmissible (LIYV) closteroviruses (Fig. 2 a). However, GLRaV-3 was not placed on the same branch as LChV, the other mealybugtransmissible closterovirus (Jelkmann et al., 1997). Rather, LChV was ...
search1
search1

... The sequence query can be a nucleotide sequence or an amino acid sequence. But … we can translate the query sequence! The search is performed against a nucleotide or amino acid database. But … we can use translated databases! (e.g., trEMBL) All types of searches are possible. ...
Journal of Steroid Biochemistry and Molecular Biology Cloning of
Journal of Steroid Biochemistry and Molecular Biology Cloning of

... proton transfer between the oxidized and reduced intermediates (tyrosine, lysine) [12,16]. In this study we have shown that putative ch11HSD1 shares the conserved motifs of the SDR superfamily and that the model of tertiary structure corresponds well to the human11HSD1 enzyme, whose X-ray coordinate ...
Cardiac Energy Dependence on Glucose Increases
Cardiac Energy Dependence on Glucose Increases

... elucidate the cardiac cellular response to increased glucose use in a genetic model of inactivated FA oxidation. Methods and Results-—Metabolomics analysis identified 60 metabolites altered in Acsl1H/ hearts, including 6 related to glucose metabolism and 11 to cysteine and glutathione pathways. Con ...
Genetic Engineering Applications
Genetic Engineering Applications

... Personal Identification No individual is exactly like any other genetically—except for identical twins, who share the same genome. Chromosomes contain many regions with repeated DNA sequences that do not code for proteins. These vary from person to person. Here, one sample has 12 repeats between gen ...
MEICPS: substitution mutations to engineer intracellular protein
MEICPS: substitution mutations to engineer intracellular protein

... global structural features and location in the intracellular environment determine the in vivo stability of proteins (Rogers et al., 1986; Rechsteiner and Rogers, 1996). From our earlier analysis of sequence data of a set of stable proteins (in vivo half-life ≥16 h) versus less stable proteins (in v ...
Sequence Analysis of the DNA Encoding the Eco RI Endonuclease
Sequence Analysis of the DNA Encoding the Eco RI Endonuclease

... In some cases, frequently selected codons are recogIn the accompanying paper, Newman et al. (10) report a nized by minor tRNA species. A spontaneous mutation sequence analysis of the Eco RI genes contained in pMB4. a in the endonuclease gene was isolated. Serine replaces derivative of pMBl which det ...
Real Time of PCR - KSU Faculty Member websites
Real Time of PCR - KSU Faculty Member websites

... There are two other types of real-time PCR methods, the molecular beacon method and the SYBR® Green method. The molecular beacon method utilizes a reporter probe that is wrapped around into a hairpin. It also has a quencher dye that must be in close contact to the reporter to work. An important diff ...
Acquisition of 1,000 eubacterial genes physiologically transformed a
Acquisition of 1,000 eubacterial genes physiologically transformed a

... involves the Wood–Ljungdahl (acetyl-CoA) pathway of CO2 fixation (5–7). In contrast, Haloarchaea are obligate heterotrophs that typically use O2 as the terminal acceptor of their electron transport chain, although many can also use alternative electron acceptors such as nitrate in addition to light h ...
Primary Sequence of Ovomucoid Messenger RNA as Determined
Primary Sequence of Ovomucoid Messenger RNA as Determined

... was used to transform E. colf K strain RRI (4), as described in Materials and Methods. All bacterial transfers were carried out in a certified laminar flow hood in a P-3 physical containment facility . (These experiments were approved at P-3, EKI containment in accordance with the Revised Guidelines ...
Multiple Sequence Alignment
Multiple Sequence Alignment

... 103 ACAGGTCAAGCATTTTCGATGCCAAGGCTGGATTGCATTGCATTGAGCGA ...
Plant Journal
Plant Journal

... The NIM1/NPR1 gene product has also been reported to play a role in an inducible defense response called induced systemic resistance (ISR), which is activated in Arabidopsis plants after exposure of roots to certain non-pathogenic rhizobacteria (van Loon et al., 1998). Unlike SAR, induction of ISR d ...
Flexibility in energy metabolism supports hypoxia tolerance in
Flexibility in energy metabolism supports hypoxia tolerance in

... Genetic screen found gene required for tolerance 1 Hypoxia tolerance gene was successfully transferred to mammalian cells 2 human ...
PowerPoint Presentation - AGRI-MIS
PowerPoint Presentation - AGRI-MIS

... xylem cells w/ increased numbers smaller and more lignified Tobacco w/ low auxin: larger and less-lignified xylem cells ...
Biofuel phyto-forensics case resolved through PCR
Biofuel phyto-forensics case resolved through PCR

... Gel electrophoresis is a technique that is used to separate DNA fragments based on their size (number of bases). In this exercise, you will separate, by size, the DNA strands made during the PCR simulation. Because DNA is a negatively charged molecule, it will always move toward the positive end of ...
Fibrous proteins
Fibrous proteins

... Have a strong tendency to bind oxygen. Free iron can form of highly reactive oxygen species such as hydroxyl radicals that can damage DNA and other macromolecules. Therefore, iron used in cells is bound in forms that sequester it and/or make it less reactive. ...
molecular_general_theory_complete
molecular_general_theory_complete

... DNA replication is the process of duplicating the DNA sequence in the parent strand to produce an exact replica (daughter strand). Replication is semi-conservative: each one of the two parental strands serves as a template for the new strand synthesis; therefore, duplicated double helices contain on ...
< 1 ... 102 103 104 105 106 107 108 109 110 ... 509 >

Silencer (genetics)

  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report