
annotation and analysis of newly discovered mycobacteriophage
... contained a 3 nucleotide center region that were non palindromic that may imply a stem loop structure in the RNA of firecracker (fig. 7). The motif also overlapped with a repeat of the sequence “TGGGGGTGTTCGGTTTCCGAACAG”, that occurs 22 times in the genome. This sequence is specifically located betw ...
... contained a 3 nucleotide center region that were non palindromic that may imply a stem loop structure in the RNA of firecracker (fig. 7). The motif also overlapped with a repeat of the sequence “TGGGGGTGTTCGGTTTCCGAACAG”, that occurs 22 times in the genome. This sequence is specifically located betw ...
Genome organization of Magnaporthe grisea
... RFLP markers A cosmid library of genomic DNA from strain 2539 cloned in pMLF1 (Leong et al. 1994) was assayed by colony hybridization with MAGGY internal regions as probes (Farman et al. 1997b), and 57 MAGGY-hybridizing clones were identified in approximately 3500 cosmids screened. The cosmid DNAs w ...
... RFLP markers A cosmid library of genomic DNA from strain 2539 cloned in pMLF1 (Leong et al. 1994) was assayed by colony hybridization with MAGGY internal regions as probes (Farman et al. 1997b), and 57 MAGGY-hybridizing clones were identified in approximately 3500 cosmids screened. The cosmid DNAs w ...
Diagnostic protocol for
... Aliquots of 25 µl of each bacterial preparation or plant samples to be tested are pipetted onto the windows of a plastic-coated multiwindow microscope slide, allowed to air-dry and gently heat-fixed over a flame. Separate slides are set up for each test bacterium and also, positive and negative con ...
... Aliquots of 25 µl of each bacterial preparation or plant samples to be tested are pipetted onto the windows of a plastic-coated multiwindow microscope slide, allowed to air-dry and gently heat-fixed over a flame. Separate slides are set up for each test bacterium and also, positive and negative con ...
Novel Blocked-Cleavable Primers for Quantitative Detection of
... Single nucleotide polymorphisms (SNPs) are common and often correlate with important biological traits. The ability to accurately discriminate between different alleles is critical for modern diagnostics. A mismatch at or near the RNA base has a large effect on the ability of RNase H2 to cleave a bl ...
... Single nucleotide polymorphisms (SNPs) are common and often correlate with important biological traits. The ability to accurately discriminate between different alleles is critical for modern diagnostics. A mismatch at or near the RNA base has a large effect on the ability of RNase H2 to cleave a bl ...
Conformational Changes in HIV-1 Reverse Transcriptase Induced
... the free enzyme [16]. Associated with the hinge movement of the p66 thumb, the p66 connection and RNase H domains move away relative to the fingers subdomain with 13˚ and 15˚ rotations, respectively, compared with the corresponding positions in the free enzyme [16]. The position of the p66 fingers s ...
... the free enzyme [16]. Associated with the hinge movement of the p66 thumb, the p66 connection and RNase H domains move away relative to the fingers subdomain with 13˚ and 15˚ rotations, respectively, compared with the corresponding positions in the free enzyme [16]. The position of the p66 fingers s ...
Development of Zinc Finger Domains for Recognition of the 5
... gests that DNA binding is predominantly achieved by the interaction of amino acid residues of the ␣-helix in positions ⫺1, 3, and 6 with the 3⬘, middle, and 5⬘ nucleotides of a 3-bp DNA subsite, respectively (11, 12). Positions 1, 2, and 5 of the ␣-helix make direct or water-mediated contacts with t ...
... gests that DNA binding is predominantly achieved by the interaction of amino acid residues of the ␣-helix in positions ⫺1, 3, and 6 with the 3⬘, middle, and 5⬘ nucleotides of a 3-bp DNA subsite, respectively (11, 12). Positions 1, 2, and 5 of the ␣-helix make direct or water-mediated contacts with t ...
Nucleosides, Nucleotides,Nucleic Acids
... Several HIV proteins are present in the same polypeptide chain and must be separated from each other in order to act. Protease inhibitors prevent formation of HIV proteins by preventing hydrolysis of polypeptide that incorporates them. ...
... Several HIV proteins are present in the same polypeptide chain and must be separated from each other in order to act. Protease inhibitors prevent formation of HIV proteins by preventing hydrolysis of polypeptide that incorporates them. ...
Screening Mutant Libraries of Fungal Laccases in the Presence of
... was inoculated with standard (parent type), and 1 well (H1) was not inoculated (control). Plates were wrapped in parafilm (to prevent evaporation) and incubated at 30 °C and 210 rpm (Micromagmix shaker, Ovan, Spain). After 45 h, 160 µL of expression medium was added to each well, and the plates were ...
... was inoculated with standard (parent type), and 1 well (H1) was not inoculated (control). Plates were wrapped in parafilm (to prevent evaporation) and incubated at 30 °C and 210 rpm (Micromagmix shaker, Ovan, Spain). After 45 h, 160 µL of expression medium was added to each well, and the plates were ...
Restriction Fragment Length Polymorphism of hsp70
... 23. Perry MD, Moran LA: Isolation of a mouse heat-shock gene (hsp68) by recombinational screening. Gene 1987;51:227-236 24. Hedrich HJ: Linkage map of the laboratory rat (Rattus norvegicus). ...
... 23. Perry MD, Moran LA: Isolation of a mouse heat-shock gene (hsp68) by recombinational screening. Gene 1987;51:227-236 24. Hedrich HJ: Linkage map of the laboratory rat (Rattus norvegicus). ...
A natural chimeric yeast containing genetic material from three species
... sequences of Saccharomyces sp. CID 1 and Saccharomyces sp. I F 0 1802 were identical. Also, the ATP9 sequences from S. pastorianus and S. bayanus were identical, while the sequences of other Saccharomyces species were different (Fig. 2). The data on the coding regions of the A TP8 and A TP9 genes su ...
... sequences of Saccharomyces sp. CID 1 and Saccharomyces sp. I F 0 1802 were identical. Also, the ATP9 sequences from S. pastorianus and S. bayanus were identical, while the sequences of other Saccharomyces species were different (Fig. 2). The data on the coding regions of the A TP8 and A TP9 genes su ...
Unusual mutations in high functioning fragile X males
... expansions. Owing to complete selection of all available signals of repeats between 45 and 300, this sample is probably representative of premutations and full mutations in the given size interval. Expansion size was measured as CGG repeat index27 given by the difference in size (base pairs) of norm ...
... expansions. Owing to complete selection of all available signals of repeats between 45 and 300, this sample is probably representative of premutations and full mutations in the given size interval. Expansion size was measured as CGG repeat index27 given by the difference in size (base pairs) of norm ...
CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE
... • If eye color is located only on the X chromosome, then females (XX) carry two copies of the gene, while males (XY) have only one. • Since the mutant allele is recessive, a white-eyed female must have that allele on both X chromosomes which was impossible for F2 females in Morgan's experiment. • A ...
... • If eye color is located only on the X chromosome, then females (XX) carry two copies of the gene, while males (XY) have only one. • Since the mutant allele is recessive, a white-eyed female must have that allele on both X chromosomes which was impossible for F2 females in Morgan's experiment. • A ...
results and discussion discussion
... Henne et al., 2000). Other workers constructed large insert libraries that could be used to identify entire metabolic pathways and other biomolecules (Brady et al., 2001; Gillespie et al., 2002; Rondon et al., 2000). The recovered metagenomic DNA from pond microbial community sample was partially di ...
... Henne et al., 2000). Other workers constructed large insert libraries that could be used to identify entire metabolic pathways and other biomolecules (Brady et al., 2001; Gillespie et al., 2002; Rondon et al., 2000). The recovered metagenomic DNA from pond microbial community sample was partially di ...
Coordination of replication and transcription along a Drosophila
... arrays of cDNAs have demonstrated a correlation between time of replication and the probability that a specific gene is expressed, it remained to be determined what step(s) in the replication initiation process are influenced by transcription. Similarly, because the prior studies lacked contiguous i ...
... arrays of cDNAs have demonstrated a correlation between time of replication and the probability that a specific gene is expressed, it remained to be determined what step(s) in the replication initiation process are influenced by transcription. Similarly, because the prior studies lacked contiguous i ...
Site-Directed Mutagenesis Using Oligonucleotide
... PCRs have to be done to generate functional targeting constructs. In the next step, the PCR product is used to transform bacteria expressing λ Red proteins. Homologous recombination results in insertion of the cassette at the precise position determined by the homology extensions (Fig. 1). Transform ...
... PCRs have to be done to generate functional targeting constructs. In the next step, the PCR product is used to transform bacteria expressing λ Red proteins. Homologous recombination results in insertion of the cassette at the precise position determined by the homology extensions (Fig. 1). Transform ...
PDF - Oxford Academic
... of the Lbc varieties. Available amino acid sequence data suggest that in this case the determined DNA sequence corresponds to Lbc^. However, this assignment is not conclusive since amino acid sequence analysis has not yet been completed on homogenous Lbc varieties (Whittaker, R.G., personal communic ...
... of the Lbc varieties. Available amino acid sequence data suggest that in this case the determined DNA sequence corresponds to Lbc^. However, this assignment is not conclusive since amino acid sequence analysis has not yet been completed on homogenous Lbc varieties (Whittaker, R.G., personal communic ...
An assessment of factors affecting the likelihood
... may therefore also be active in bacteria. Others are under control of plant promoters which may be non-functional in bacteria. Since most plant transgenes lack introns, there may be few constraints, other than codon usage, to the expression of plant transgenes in bacterial recipients, if transferred ...
... may therefore also be active in bacteria. Others are under control of plant promoters which may be non-functional in bacteria. Since most plant transgenes lack introns, there may be few constraints, other than codon usage, to the expression of plant transgenes in bacterial recipients, if transferred ...
Use of lac regulatory elements for gene expression in
... and valine) and also catalyses the conversion of pyruvate to α-acetolactate, with high affinity for pyruvate. Then, α-acetolactate can be decarboxylated to diacetyl, an important compound providing a characteristic flavour of many fermented milk products. In order to increase the production of α-ace ...
... and valine) and also catalyses the conversion of pyruvate to α-acetolactate, with high affinity for pyruvate. Then, α-acetolactate can be decarboxylated to diacetyl, an important compound providing a characteristic flavour of many fermented milk products. In order to increase the production of α-ace ...
Molecular Diagnostics in Clinical Microbiology
... In the last two decades, strategies based on nucleic acid amplification techniques (NAATs) have taken an irreversible position in the diagnostic field of infectious diseases. Pathogens can be detected in qualitative and quantitative NAAT strategies by selection of species-specific nucleic acid targe ...
... In the last two decades, strategies based on nucleic acid amplification techniques (NAATs) have taken an irreversible position in the diagnostic field of infectious diseases. Pathogens can be detected in qualitative and quantitative NAAT strategies by selection of species-specific nucleic acid targe ...
Chapter 11 Transcription and RNA Processing
... • Introns in tRNA precursors are removed by the concerted action of a splicing endonuclease and ligase, whereas introns in some rRNA precursors are spliced out autocatalytically—with no catalytic protein ...
... • Introns in tRNA precursors are removed by the concerted action of a splicing endonuclease and ligase, whereas introns in some rRNA precursors are spliced out autocatalytically—with no catalytic protein ...
Real time PCR based determination of gene copy numbers in
... requires large amounts of genomic DNA. In addition, restriction site loss during ...
... requires large amounts of genomic DNA. In addition, restriction site loss during ...
Cloning and functional characterization of temperature responsive
... Background: Ricinus communis L. (Castor bean) is an oilseed crop widely grown for vegetable oil and renewable bio‐products for pharmaceutical and industrial purposes. However, castor oil production does not meet the increase of its world consumption due to the use of cultivars with ...
... Background: Ricinus communis L. (Castor bean) is an oilseed crop widely grown for vegetable oil and renewable bio‐products for pharmaceutical and industrial purposes. However, castor oil production does not meet the increase of its world consumption due to the use of cultivars with ...
Directions for Use Ready One-Step RT-PCR Kit
... streamlined since the loading buffer and visualization dye are included. The user supplies the primers and DNase-treated template RNA. Ready One-Step RT-PCR Kit includes 1 tube each of Ready One-Step Reverse Transcriptase and Ready One-Step RT-PCR Mix, 2X. Ready OneStep Reverse Transcriptase consist ...
... streamlined since the loading buffer and visualization dye are included. The user supplies the primers and DNase-treated template RNA. Ready One-Step RT-PCR Kit includes 1 tube each of Ready One-Step Reverse Transcriptase and Ready One-Step RT-PCR Mix, 2X. Ready OneStep Reverse Transcriptase consist ...
Molecular cloning
Molecular cloning is a set of experimental methods in molecular biology that are used to assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word cloning refers to the fact that the method involves the replication of one molecule to produce a population of cells with identical DNA molecules. Molecular cloning generally uses DNA sequences from two different organisms: the species that is the source of the DNA to be cloned, and the species that will serve as the living host for replication of the recombinant DNA. Molecular cloning methods are central to many contemporary areas of modern biology and medicine.In a conventional molecular cloning experiment, the DNA to be cloned is obtained from an organism of interest, then treated with enzymes in the test tube to generate smaller DNA fragments. Subsequently, these fragments are then combined with vector DNA to generate recombinant DNA molecules. The recombinant DNA is then introduced into a host organism (typically an easy-to-grow, benign, laboratory strain of E. coli bacteria). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. Because they contain foreign DNA fragments, these are transgenic or genetically modified microorganisms (GMO). This process takes advantage of the fact that a single bacterial cell can be induced to take up and replicate a single recombinant DNA molecule. This single cell can then be expanded exponentially to generate a large amount of bacteria, each of which contain copies of the original recombinant molecule. Thus, both the resulting bacterial population, and the recombinant DNA molecule, are commonly referred to as ""clones"". Strictly speaking, recombinant DNA refers to DNA molecules, while molecular cloning refers to the experimental methods used to assemble them.