![Peer-reviewed Article PDF](http://s1.studyres.com/store/data/015283245_1-1e05a7c01e2df6cf98450f3e0c5f3464-300x300.png)
Peer-reviewed Article PDF
... interference (RNAi) used by eukaryotic cells; both use short RNA sequences to guide the destruction of foreign nucleic acids by enzymes. [11] However, these two systems employ entirely different sets of proteins. No homology has been found between CRISPR/Cas and RNAi [8,12]. Although the alternating ...
... interference (RNAi) used by eukaryotic cells; both use short RNA sequences to guide the destruction of foreign nucleic acids by enzymes. [11] However, these two systems employ entirely different sets of proteins. No homology has been found between CRISPR/Cas and RNAi [8,12]. Although the alternating ...
الشريحة 1
... suspended in a gel. • The microscopic particles attach to one another forming tunnels that act as a sieve to separate the molecules. • Small molecules can move faster than large molecules. ...
... suspended in a gel. • The microscopic particles attach to one another forming tunnels that act as a sieve to separate the molecules. • Small molecules can move faster than large molecules. ...
Assessment by Molecular Dynamics Simulations of the Structural
... zinc finger domains in their C-terminal regions (Figure 1). Structurally, a Cys2-His2 zinc finger is a bba motif stabilized by chelation of a zinc ion between the thiolate groups of a pair of cysteine residues from the b-sheet and the imidazole rings of a pair of histidine residues from the a-helix. ...
... zinc finger domains in their C-terminal regions (Figure 1). Structurally, a Cys2-His2 zinc finger is a bba motif stabilized by chelation of a zinc ion between the thiolate groups of a pair of cysteine residues from the b-sheet and the imidazole rings of a pair of histidine residues from the a-helix. ...
Molecular markers in Brassica Rapa
... Carotenoid analysis by HPLC All of the inner leafy tissues of OC and YE cultivars except for the external leaves (two or three layers) with chlorophyll were ground using an electric blender, freeze-dried, and then stored at −70 °C until use. The method to extract the carotenoids was based on the pro ...
... Carotenoid analysis by HPLC All of the inner leafy tissues of OC and YE cultivars except for the external leaves (two or three layers) with chlorophyll were ground using an electric blender, freeze-dried, and then stored at −70 °C until use. The method to extract the carotenoids was based on the pro ...
Obligate phototrophy in cyanobacteria: more than a lack of sugar
... criteria, their (in)capacity of heterotrophic growth on glucose and when known of glucose uptake, and a G+C content as close as possible to that of Synechocystis PCC6803 [15,16]. Total DNA from these cells was digested, in parallel or simultaneously, by EcoRI or HaeII, and hybridized with the Synech ...
... criteria, their (in)capacity of heterotrophic growth on glucose and when known of glucose uptake, and a G+C content as close as possible to that of Synechocystis PCC6803 [15,16]. Total DNA from these cells was digested, in parallel or simultaneously, by EcoRI or HaeII, and hybridized with the Synech ...
Transfer of genetic material between the chloroplast and nucleus
... nuclear genome data reported that the plant nuclear genome is in equilibrium between frequent integration and rapid elimination of the chloroplast genome and that the pericentromeric regions play a significant role in facilitating the chloroplast–nuclear DNA flux. This equilibrium between integratio ...
... nuclear genome data reported that the plant nuclear genome is in equilibrium between frequent integration and rapid elimination of the chloroplast genome and that the pericentromeric regions play a significant role in facilitating the chloroplast–nuclear DNA flux. This equilibrium between integratio ...
Distortion of quantitative genomic and expression
... regarding reproducibility of these techniques have been raised by cross-validation studies in different laboratories (1–5). Strategies to mitigate variability in the results obtained from replicate studies have focused on standardizing technical factors, such as array production, RNA synthesis, labe ...
... regarding reproducibility of these techniques have been raised by cross-validation studies in different laboratories (1–5). Strategies to mitigate variability in the results obtained from replicate studies have focused on standardizing technical factors, such as array production, RNA synthesis, labe ...
Table S2
... Pds1: Inhibits the onset of anaphase by binding and sequestering the Esp1 protease that cleaves the cohesin complexes that hold sister chromatids together. Binding of Pds1 to Esp1 was reported to depend in Cdc28 phosphorylation[53] Sic1: Inhibitor of Clb-Cdc28. Phosphorylation of Sic1 by Cln-Cdc28 a ...
... Pds1: Inhibits the onset of anaphase by binding and sequestering the Esp1 protease that cleaves the cohesin complexes that hold sister chromatids together. Binding of Pds1 to Esp1 was reported to depend in Cdc28 phosphorylation[53] Sic1: Inhibitor of Clb-Cdc28. Phosphorylation of Sic1 by Cln-Cdc28 a ...
Gene silencing in mammalian cells and the spread of DNA
... expression. In mammalian cells, gene silencing is most often associated with hypermethylation of the promoter region and a closed chromatin conformation (Robertson and Jones, 2000; Rountree et al., 2001; Baylin et al., 2001; Jones and Wolffe, 1999). Chromatin conformation is controlled to a large ex ...
... expression. In mammalian cells, gene silencing is most often associated with hypermethylation of the promoter region and a closed chromatin conformation (Robertson and Jones, 2000; Rountree et al., 2001; Baylin et al., 2001; Jones and Wolffe, 1999). Chromatin conformation is controlled to a large ex ...
Molecular approaches for bacterial azoreductases
... Molecular cloning of the gene encoding azoreductase enzyme followed by protein purification is likely to be crucial for further characterization and application of this enzyme (Suzuki et al., 2001; Wang et al., 2007; Ryan et al., 2010a; Wang et al., 2010; Mendes et al., 2011a). Physiochemical proper ...
... Molecular cloning of the gene encoding azoreductase enzyme followed by protein purification is likely to be crucial for further characterization and application of this enzyme (Suzuki et al., 2001; Wang et al., 2007; Ryan et al., 2010a; Wang et al., 2010; Mendes et al., 2011a). Physiochemical proper ...
Identiflcation and typing of grapevine phytoplasma amplified by graft
... 1993). In recent years, phytoplasma have mostly been diagnosed by polymerase chain reaction (PCR) with "universal" primers carrying phytoplasma-conserved sequences of the 16S ribosomal DNA (AHRENS and SEEMüLLER 1992; LEE etal. 1993; NAMBA etal. 1993 b; RASIN 1994; MAIXNER et al. 1995). These univers ...
... 1993). In recent years, phytoplasma have mostly been diagnosed by polymerase chain reaction (PCR) with "universal" primers carrying phytoplasma-conserved sequences of the 16S ribosomal DNA (AHRENS and SEEMüLLER 1992; LEE etal. 1993; NAMBA etal. 1993 b; RASIN 1994; MAIXNER et al. 1995). These univers ...
supporting information
... The epitopes (epitope clusters) of each of the five known major encephalitogenic target myelin proteins in MS were selected according to the following criteria: reports of preferential reactivity by MS T-cells, and/or encephalitogenic potential in laboratory animals, and/or according to bioinformati ...
... The epitopes (epitope clusters) of each of the five known major encephalitogenic target myelin proteins in MS were selected according to the following criteria: reports of preferential reactivity by MS T-cells, and/or encephalitogenic potential in laboratory animals, and/or according to bioinformati ...
Gene Section RAD52 (RAD52 homolog (S. cerevisiae)) Atlas of Genetics and Cytogenetics
... Malkova A, Ivanov EL, Haber JE. Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc Natl Acad Sci U S A. ...
... Malkova A, Ivanov EL, Haber JE. Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc Natl Acad Sci U S A. ...
mitochondrial dysfunction and treatment strategies
... DNA replication is the process where novel DNA molecules are synthesized from deoxyribonucleoside triphosphates (dNTPs), using one strand as template. The two strands of the DNA double helix unwind with the help of helicases and form a replication fork (two single stranded templates) that each serve ...
... DNA replication is the process where novel DNA molecules are synthesized from deoxyribonucleoside triphosphates (dNTPs), using one strand as template. The two strands of the DNA double helix unwind with the help of helicases and form a replication fork (two single stranded templates) that each serve ...
Lampbrush Chromosomes of the Chicken
... from adult laying hens have been used in these studies. Fortuitously, LBC loops appear to be at their maximum extension in oocytes of this size range. By the time oocytes reach 'x,3-mm diam, the LBC stage begins to decline and both chromosomes and loops begin to contract. In making chicken LBC prepa ...
... from adult laying hens have been used in these studies. Fortuitously, LBC loops appear to be at their maximum extension in oocytes of this size range. By the time oocytes reach 'x,3-mm diam, the LBC stage begins to decline and both chromosomes and loops begin to contract. In making chicken LBC prepa ...
Supplementary Materials and methods (doc 154K)
... detect small differences in fitness. The exact initial proportions were confirmed via flow cytometry (see conditions below). Mixtures were diluted 200-fold in fresh LB and competed for 16 hours at 37°C with no agitation (~7 generations). Again, the final proportion was measured by flow cytometry. Th ...
... detect small differences in fitness. The exact initial proportions were confirmed via flow cytometry (see conditions below). Mixtures were diluted 200-fold in fresh LB and competed for 16 hours at 37°C with no agitation (~7 generations). Again, the final proportion was measured by flow cytometry. Th ...
Classification of nucleic acids structures by means of the
... nitrogenated bases. As an example, the presence of several tracks containing guanines can favor the formation of G-quadruplex structures [7, 8], whereas the presence of several tracks containing cytosines can favor the formation of i-motif structures at pH values near 5 -6 [9]. It is interesting to ...
... nitrogenated bases. As an example, the presence of several tracks containing guanines can favor the formation of G-quadruplex structures [7, 8], whereas the presence of several tracks containing cytosines can favor the formation of i-motif structures at pH values near 5 -6 [9]. It is interesting to ...
Molecular Analysis of the Coprinus cinereus Mating Type A Factor
... DAY(1 960, 1963b) that the least two closely linked subunits, termed (Y and B. T h e functions of(Y and B appear redundantbecause genetic analysis has shown that an allelic difference at only a single subunit is sufficient for compatibility at A. Because the subunits themselves have many allelic for ...
... DAY(1 960, 1963b) that the least two closely linked subunits, termed (Y and B. T h e functions of(Y and B appear redundantbecause genetic analysis has shown that an allelic difference at only a single subunit is sufficient for compatibility at A. Because the subunits themselves have many allelic for ...
Do nonasterid holoparasitic flowering plants have plastid genomes?
... Past work involving the plastid genome (plastome) of holoparasitic plants has been confined to Scrophulariaceae (or Orobanchaceae) which have truncated plastomes owing to loss of photosynthetic and other genes. Nonasterid holoparasites from Balanophoraceae (Corynaea), Hydnoraceae (Hydnora) and Cytin ...
... Past work involving the plastid genome (plastome) of holoparasitic plants has been confined to Scrophulariaceae (or Orobanchaceae) which have truncated plastomes owing to loss of photosynthetic and other genes. Nonasterid holoparasites from Balanophoraceae (Corynaea), Hydnoraceae (Hydnora) and Cytin ...
DNA Specificity of the Bicoid Activator Protein Is Determined by
... Results are given in units of 8-galactosidase activity. Experimental conditions are described in the legend to Table 1. Target plasmids (see Figure 2) were all pLR1 Al derivatives and produced no detectable background activity, except for the Antp class binding site target plasmid which regularly pr ...
... Results are given in units of 8-galactosidase activity. Experimental conditions are described in the legend to Table 1. Target plasmids (see Figure 2) were all pLR1 Al derivatives and produced no detectable background activity, except for the Antp class binding site target plasmid which regularly pr ...
Chapter 18: Gene Mutation and DNA Repair
... a. A change in a single base pair in the DNA. b. A mutation that does not change the amino acid sequence of the polypeptide. c. The addition or deletion of one or two nucleotides. d. A change that alters a single amino acid in the polypeptide. e. A physical change in the structure of the chromosome. ...
... a. A change in a single base pair in the DNA. b. A mutation that does not change the amino acid sequence of the polypeptide. c. The addition or deletion of one or two nucleotides. d. A change that alters a single amino acid in the polypeptide. e. A physical change in the structure of the chromosome. ...
Eds., N. Hamamura, S. Suzuki, S. Mendo, C. M. Barroso,... © by TERRAPUB, 2010.
... PCR was carried out in 50 µl reaction mixture consisting of 3.0 mM MgCl2, 0.3 pmol of each oligonucleotide (Table 1), 0.2 mM of each dATP, dCTP, dGTP, and dTTP, 1 × green GoTaq®Flexi Buffer (Promega, USA), 1 U GoTaq® DNA polymerase (Promega, USA), 10–100 ng plasmid DNA of clone 69. Twenty-five ampli ...
... PCR was carried out in 50 µl reaction mixture consisting of 3.0 mM MgCl2, 0.3 pmol of each oligonucleotide (Table 1), 0.2 mM of each dATP, dCTP, dGTP, and dTTP, 1 × green GoTaq®Flexi Buffer (Promega, USA), 1 U GoTaq® DNA polymerase (Promega, USA), 10–100 ng plasmid DNA of clone 69. Twenty-five ampli ...
annotation and analysis of newly discovered mycobacteriophage
... contained a 3 nucleotide center region that were non palindromic that may imply a stem loop structure in the RNA of firecracker (fig. 7). The motif also overlapped with a repeat of the sequence “TGGGGGTGTTCGGTTTCCGAACAG”, that occurs 22 times in the genome. This sequence is specifically located betw ...
... contained a 3 nucleotide center region that were non palindromic that may imply a stem loop structure in the RNA of firecracker (fig. 7). The motif also overlapped with a repeat of the sequence “TGGGGGTGTTCGGTTTCCGAACAG”, that occurs 22 times in the genome. This sequence is specifically located betw ...
Molecular cloning
Molecular cloning is a set of experimental methods in molecular biology that are used to assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word cloning refers to the fact that the method involves the replication of one molecule to produce a population of cells with identical DNA molecules. Molecular cloning generally uses DNA sequences from two different organisms: the species that is the source of the DNA to be cloned, and the species that will serve as the living host for replication of the recombinant DNA. Molecular cloning methods are central to many contemporary areas of modern biology and medicine.In a conventional molecular cloning experiment, the DNA to be cloned is obtained from an organism of interest, then treated with enzymes in the test tube to generate smaller DNA fragments. Subsequently, these fragments are then combined with vector DNA to generate recombinant DNA molecules. The recombinant DNA is then introduced into a host organism (typically an easy-to-grow, benign, laboratory strain of E. coli bacteria). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. Because they contain foreign DNA fragments, these are transgenic or genetically modified microorganisms (GMO). This process takes advantage of the fact that a single bacterial cell can be induced to take up and replicate a single recombinant DNA molecule. This single cell can then be expanded exponentially to generate a large amount of bacteria, each of which contain copies of the original recombinant molecule. Thus, both the resulting bacterial population, and the recombinant DNA molecule, are commonly referred to as ""clones"". Strictly speaking, recombinant DNA refers to DNA molecules, while molecular cloning refers to the experimental methods used to assemble them.