Genetics Images/plasmids.jpg - KSU Faculty Member websites
... How these circular helices get from cell to cell depends on whether they are viral or plasmid. If they are viral they code for extracellular packaging layers so that they can float through the environment and attach to another appropriate cell. If it is plasmid DNA, then there are genes coding for c ...
... How these circular helices get from cell to cell depends on whether they are viral or plasmid. If they are viral they code for extracellular packaging layers so that they can float through the environment and attach to another appropriate cell. If it is plasmid DNA, then there are genes coding for c ...
Chapter 10 Protein Synthesis
... In 1953, James D. Watson and Francis Crick deduced the secondary structure of DNA, using – X-ray crystallography data of DNA from the work of Rosalind Franklin and Maurice Wilkins and ...
... In 1953, James D. Watson and Francis Crick deduced the secondary structure of DNA, using – X-ray crystallography data of DNA from the work of Rosalind Franklin and Maurice Wilkins and ...
Cloning a Gene for Over-expression and Purification
... ATG start codon present on the pET translation vectors.PflM A C-terminal His•Tag® sequence is availApaB isI(674) able. Unique sites are shown on the circle map. Note that the sequence numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expressi ...
... ATG start codon present on the pET translation vectors.PflM A C-terminal His•Tag® sequence is availApaB isI(674) able. Unique sites are shown on the circle map. Note that the sequence numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expressi ...
Characterization of two rice DNA methyltransferases
... recommended by the manufacturer. First strand cDNA was synthesized at 42EC for 1 h using the adapter supplied with the kit (5'-(A)12CCTATAGTGAGTCGTATTAATTCTGTGCTCGC) and RNA (2 Fg) from mature leaves as the template. A 1 Fl of reverse transcription reaction was subsequently used in 35 cycles of PCR ...
... recommended by the manufacturer. First strand cDNA was synthesized at 42EC for 1 h using the adapter supplied with the kit (5'-(A)12CCTATAGTGAGTCGTATTAATTCTGTGCTCGC) and RNA (2 Fg) from mature leaves as the template. A 1 Fl of reverse transcription reaction was subsequently used in 35 cycles of PCR ...
A small organic compound enhances the religation reaction of
... The 3D structure of the topotecan–enzyme–DNA ternary complex has shown that topotecan mimics a DNA base-pair and binds at the site of DNA cleavage by intercalating between the upstream ( − 1) and downstream ( + 1) base-pairs [6] interacting also with the enzyme, acting as an interfacial uncompetitiv ...
... The 3D structure of the topotecan–enzyme–DNA ternary complex has shown that topotecan mimics a DNA base-pair and binds at the site of DNA cleavage by intercalating between the upstream ( − 1) and downstream ( + 1) base-pairs [6] interacting also with the enzyme, acting as an interfacial uncompetitiv ...
Prolonged organ retention and safety of plasmid DNA
... resulted from the highly phagocytic activities of the reticuloendothelial system mainly present in the liver. Moreover, it was demonstrated that prior administration of polyanions caused a substantial reduction in the hepatic uptake of naked DNA. Given that scavenger receptors recognize a wide range ...
... resulted from the highly phagocytic activities of the reticuloendothelial system mainly present in the liver. Moreover, it was demonstrated that prior administration of polyanions caused a substantial reduction in the hepatic uptake of naked DNA. Given that scavenger receptors recognize a wide range ...
Bacterial Classification
... – Used fruit flies because they had a shorter generation time than peas – Discovered sex-linkage – Students developed techniques of mapping genes on chromosomes ...
... – Used fruit flies because they had a shorter generation time than peas – Discovered sex-linkage – Students developed techniques of mapping genes on chromosomes ...
A Brief History of PCR - Bio-Rad
... achievement of modern molecular biology, Kary B. Mullis developed the polymerase chain reaction (PCR) in 1983. PCR allows the rapid synthesis of designated fragments of DNA. Using the technique, over one billion copies can be synthesized in a matter of hours. PCR is valuable to scientists by assisti ...
... achievement of modern molecular biology, Kary B. Mullis developed the polymerase chain reaction (PCR) in 1983. PCR allows the rapid synthesis of designated fragments of DNA. Using the technique, over one billion copies can be synthesized in a matter of hours. PCR is valuable to scientists by assisti ...
Chapter 12 Recombinant DNA Technology Key Concepts
... Chapter 14. However, the plasmids that are routinely used as vectors are those that carry genes for drug resistance. The drug-resistance genes are useful because the drug-resistant phenotype can be used to select not only for cells transformed by plasmids, but also for vectors containing recombinant ...
... Chapter 14. However, the plasmids that are routinely used as vectors are those that carry genes for drug resistance. The drug-resistance genes are useful because the drug-resistant phenotype can be used to select not only for cells transformed by plasmids, but also for vectors containing recombinant ...
The replication of DNA
... placement of sliding camp on DNA. These enzyme couple ATP binding and hydrolysis to the placement of sliding clamp around primer template junction, every time that this junction is present in the cell. The clamp loaders also remove the slide clamp from DNA once all of the enzymes that interact with ...
... placement of sliding camp on DNA. These enzyme couple ATP binding and hydrolysis to the placement of sliding clamp around primer template junction, every time that this junction is present in the cell. The clamp loaders also remove the slide clamp from DNA once all of the enzymes that interact with ...
10 Useful RNA Facts
... 2. Each RNA molecule typically is a single strand, consisting of a relatively short chain of nucleotides. RNA can be shaped like a single helix, a straight molecule, or may be bet or twisted upon itself. DNA, in comparison, is double-stranded and consists of a very long chain of nucleotides. ...
... 2. Each RNA molecule typically is a single strand, consisting of a relatively short chain of nucleotides. RNA can be shaped like a single helix, a straight molecule, or may be bet or twisted upon itself. DNA, in comparison, is double-stranded and consists of a very long chain of nucleotides. ...
Jamboree Poster
... -Reporter: lacZ, part I732017 (blue/white screening on X-gal) • If DNA is damaged extensively, then transcription of β-gal • Essentially a reporter-gene assay ...
... -Reporter: lacZ, part I732017 (blue/white screening on X-gal) • If DNA is damaged extensively, then transcription of β-gal • Essentially a reporter-gene assay ...
Finding Regulatory Sites - TAMU Computer Science Faculty Pages
... between the states. Each state represents a modeled feature. Although the structure of the HMM is pre-determined, it is necessary to provide estimates of other parameters (such as transition probabilities) via a set of training examples. ...
... between the states. Each state represents a modeled feature. Although the structure of the HMM is pre-determined, it is necessary to provide estimates of other parameters (such as transition probabilities) via a set of training examples. ...
E.coli
... 1. The analysis of genome organization and the identification of genes, particularly in organisms with large genome sizes (human DNA is 3 109 bp, for example) is difficult to use plasmid and bacteriophage vectors, since the relatively small size capacity of these vectors for cloned DNA means tha ...
... 1. The analysis of genome organization and the identification of genes, particularly in organisms with large genome sizes (human DNA is 3 109 bp, for example) is difficult to use plasmid and bacteriophage vectors, since the relatively small size capacity of these vectors for cloned DNA means tha ...
Lesson Plan
... Display to the class a length of spaghetti. Inform them that DNA is a long linear molecule. If the DNA from one cell was the diameter of the spaghetti, it would be long enough to go around the entire planet Earth. ...
... Display to the class a length of spaghetti. Inform them that DNA is a long linear molecule. If the DNA from one cell was the diameter of the spaghetti, it would be long enough to go around the entire planet Earth. ...
Transposable elements
... Encode proteins that (1) move DNA directly to a new position or (2) replicate DNA and integrate replicated DNA elsewhere in the genome (prokaryotes and eukaryotes). ...
... Encode proteins that (1) move DNA directly to a new position or (2) replicate DNA and integrate replicated DNA elsewhere in the genome (prokaryotes and eukaryotes). ...
Structure of B-DNA with Cations Tethered in the Major Groove†
... has been covalently modified by the tethering of four cationic charges. This modified version of the DDD, called here the DDD4+, is composed of [d(CGCGAAXXCGCG)]2, where X is effectively a thymine residue linked at the 5 position to an n-propyl-amine. The structure was determined from crystals soake ...
... has been covalently modified by the tethering of four cationic charges. This modified version of the DDD, called here the DDD4+, is composed of [d(CGCGAAXXCGCG)]2, where X is effectively a thymine residue linked at the 5 position to an n-propyl-amine. The structure was determined from crystals soake ...
Gene Section JUNB (jun B proto-oncogene) Atlas of Genetics and Cytogenetics
... JUND) that can dimerize with one another, or with members of Fos and ATF families, to form AP-1 transcription factor. Comparing with JUN, the transactivation activity of JUNB is much weaker. Due to the small differences on the amino acid sequences in the basic DNA bindind domain, and leucine zipper ...
... JUND) that can dimerize with one another, or with members of Fos and ATF families, to form AP-1 transcription factor. Comparing with JUN, the transactivation activity of JUNB is much weaker. Due to the small differences on the amino acid sequences in the basic DNA bindind domain, and leucine zipper ...
PDF995, Job 12
... rbs located on the insert (TRANSC), and (3) expression as a translational fusion depending on both the promoter and the rbs of the vector (DEP) (Fig. 1). Intuitively, it can be understood that the occurrence of a functional translational fusion is very rare and, consequently, the chance of discoveri ...
... rbs located on the insert (TRANSC), and (3) expression as a translational fusion depending on both the promoter and the rbs of the vector (DEP) (Fig. 1). Intuitively, it can be understood that the occurrence of a functional translational fusion is very rare and, consequently, the chance of discoveri ...
9/17/08 Transcript I
... Chain Elongation - slide 26 The chain elongation, involves the core polymerase with no sigma factor involved. Polymerase is very accurate, only about 1 error in 10,000 bases. That may seem high, but its not because many transcripts are made from each individual gene, so these errors can occur in ...
... Chain Elongation - slide 26 The chain elongation, involves the core polymerase with no sigma factor involved. Polymerase is very accurate, only about 1 error in 10,000 bases. That may seem high, but its not because many transcripts are made from each individual gene, so these errors can occur in ...
Molecular cloning
Molecular cloning is a set of experimental methods in molecular biology that are used to assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word cloning refers to the fact that the method involves the replication of one molecule to produce a population of cells with identical DNA molecules. Molecular cloning generally uses DNA sequences from two different organisms: the species that is the source of the DNA to be cloned, and the species that will serve as the living host for replication of the recombinant DNA. Molecular cloning methods are central to many contemporary areas of modern biology and medicine.In a conventional molecular cloning experiment, the DNA to be cloned is obtained from an organism of interest, then treated with enzymes in the test tube to generate smaller DNA fragments. Subsequently, these fragments are then combined with vector DNA to generate recombinant DNA molecules. The recombinant DNA is then introduced into a host organism (typically an easy-to-grow, benign, laboratory strain of E. coli bacteria). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. Because they contain foreign DNA fragments, these are transgenic or genetically modified microorganisms (GMO). This process takes advantage of the fact that a single bacterial cell can be induced to take up and replicate a single recombinant DNA molecule. This single cell can then be expanded exponentially to generate a large amount of bacteria, each of which contain copies of the original recombinant molecule. Thus, both the resulting bacterial population, and the recombinant DNA molecule, are commonly referred to as ""clones"". Strictly speaking, recombinant DNA refers to DNA molecules, while molecular cloning refers to the experimental methods used to assemble them.