• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Two Components of the RNA-Directed DNA Methylation Pathway
Two Components of the RNA-Directed DNA Methylation Pathway

... Data Availability: The whole-genome bisulfite sequencing and RNA sequencing data have been deposited in the Gene Expression Omnibus (GEO) database (accession no. GSE80370). All other relevant data are contained in the paper and its Supporting Information files. Funding: This work was supported by th ...
Introduction - Stellenbosch University
Introduction - Stellenbosch University

... • The is no prescribed handbook, but I will follow Pevsner closely • Lecture notes will generally be available on SUNLearn the day before a lecture Jonathan Pevsner Bioinformatics and Functional Genomics 3rd Edition Wiley-Blackwell ...
ARTICLES - Weizmann Institute of Science
ARTICLES - Weizmann Institute of Science

... Eran Segal1, Yvonne Fondufe-Mittendorf2, Lingyi Chen2, AnnChristine Thåström2, Yair Field1, Irene K. Moore2, Ji-Ping Z. Wang3 & Jonathan Widom2 Eukaryotic genomes are packaged into nucleosome particles that occlude the DNA from interacting with most DNA binding proteins. Nucleosomes have higher af ...
arXiv:0708.2724v1 [cond-mat.other] 20 Aug 2007
arXiv:0708.2724v1 [cond-mat.other] 20 Aug 2007

... have one trait in common: they employ nanoscale probes to examine the structural or electronic signatures of individual DNA bases. That is, they rely on physical differences between the bases. This is a major departure from existing sequencing paradigms which rely on chemical techniques and physical ...
Molecular Biology and Applied Genetics
Molecular Biology and Applied Genetics

... process that are studying in vivo, but it doesn’t necessarily tell how direct that role is. Biochemistry, by contrast, tells what a factor can do in vitro, but it doesn’t necessarily mean that it does it in vivo. The genetic and biochemical approaches tell you different things: Genetics ...
A Novel CpG Island Set Identifies Tissue-Specific
A Novel CpG Island Set Identifies Tissue-Specific

... was digested with MseI (TTAA) [20] and fractionated over the CXXC column (Figure 1B). The reasoning behind use of Mse1 [20] was to cut AT-rich bulk genomic DNA into small fragments (predicted average ¼ 123 bp), but to leave CGIs relatively intact (predicted average ¼ 625 bp). As bulk genomic DNA has ...
Etude du régime alimentaire des carnivores par des techniques
Etude du régime alimentaire des carnivores par des techniques

... elusive carnivores, which are difficult to observe. However, these large carnivores are keystone species that influence the ecosystem through trophic cascades and maintain biodiversity. Thus, precise knowledge of their diet is a prerequisite for designing conservation strategies of these endangered ...
Molecular Identification of Nematodes Manual
Molecular Identification of Nematodes Manual

... *I have found the PCR process to be fairly forgiving when it has been optimized for a particular DNA template/primer pair—amounts/ concentrations used do not have to be exact. *If there is only a small volume (i.e., less than about 15ul) left in any of your reagent tubes (except Taq), especially if ...
Inhibition of RNA Synthesis by Anthracycline Analogs
Inhibition of RNA Synthesis by Anthracycline Analogs

... and inactivate its template function essential for nucleic acid synthesis. Recently, several structural analogs of these antineoplastic agents have been synthesized and some of them were shown to be considerably more effective against experimental tumors than the parent compounds. The majority of re ...
Human DNA Ligase IV and the Ligase IV/XRCC4 Complex: Analysis
Human DNA Ligase IV and the Ligase IV/XRCC4 Complex: Analysis

... ligation does not occur, is this due to the inherent fidelity of the ligase, or is it a consequence of a robust competing mismatched nick-editing activity? Because human DNA ligase IV repairs double strand breaks (DSBs) within multiple contexts where a capacity for mismatched nick ligation could pot ...
Rh phenotype prediction by DNA typing and its
Rh phenotype prediction by DNA typing and its

... 1995; van den Veyver & Moise, 1996; Aubin et al., 1997). No consensus has yet been achieved as to which polymorphism may be most reliable for testing of any given population. RH and particularly RHD DNA typing is much confounded by the presence of two highly homologous genes, RHCE and RHD, and the c ...
DNA
DNA

... Formation of new individual by a combination of two haploid sex cells (gametes). Fertilization – combination of genetic information from two separate cells that have one half the original genetic information Gametes for fertilization usually come from separate parents ...
Specialized Transduction by Bacteriophage P22 in Salmonella typhimurium: Genetic and Physical Structure of the Transducing Genomes and the Prophage Attachment Site.
Specialized Transduction by Bacteriophage P22 in Salmonella typhimurium: Genetic and Physical Structure of the Transducing Genomes and the Prophage Attachment Site.

... had isolated resembled P22Tc-10. Thus, we wondered if P22Tc-10 were a special case. The electron microscopy of P22Tc-10 DNA seemed to confirm this notion: TYE,CHANand BOTSTEIN(1974) found that the ends of the Tc-10 insertion contained an inverted repeat which was apparently identical to the inverted ...
Harvey ras (H-ras) Point Mutations Are Induced by 4
Harvey ras (H-ras) Point Mutations Are Induced by 4

... DMBA, and the promoter, TPA (12, 13). Continuous exposure of squamous cells to DMBA and TPA induced H-ras mutations on chromosome 7 in greater than 90% of mice (14). H-ras appeared to be activated by specific mutations which can be affected by the initiating carcinogen (15). Since tumors do not deve ...
Nucleic Acids - Farmasi Unand
Nucleic Acids - Farmasi Unand

... step process into tetrahvdrofolates (FH4) by the action of the enzyme dihydrofolate reductase (DHFR). Tetrahydrofolic acid is an essential cofactor in the biosynthesis of purines and thymine. which are required for DNA synthesis. prof. aza ...
Eds., N. Hamamura, S. Suzuki, S. Mendo, C. M. Barroso,... © by TERRAPUB, 2010.
Eds., N. Hamamura, S. Suzuki, S. Mendo, C. M. Barroso,... © by TERRAPUB, 2010.

... Organization (IMO), some countries are still using it (Rudel, 2003). European ...
Formosa haliotis sp. nov., a brown-alga
Formosa haliotis sp. nov., a brown-alga

... DNA–DNA hybridizations were performed between isolates LMG 28520T and LMG 28522 and the type strains of their nearest phylogenetic neighbours (F. algae LMG 28216T and F. arctica LMG 28318T). Hybridizations were performed under stringent conditions in a solution containing 50 % (v/v) formamide at 35 ...
Biology and Chemistry Primers - WWU Computer Science Faculty
Biology and Chemistry Primers - WWU Computer Science Faculty

... symphony. Nature. 2006 May 11;441(7090):143-5. ...
Maintenance of genomic integrity by p53: complementary
Maintenance of genomic integrity by p53: complementary

... themselves, and the role p53 plays in their activation are far less clear. Furthermore, it is still not known, whether and how p53 directly participates in DNA repair processes, despite some evidence pointing to this possibility. Last but not least, a possible role of p53 in the control of genomic i ...
The RNAs of RNA-directed DNA methylation
The RNAs of RNA-directed DNA methylation

... (reviewed in [29]). Pol IV and Pol V are each composed of twelve subunits, and mass spectrometry analyses revealed that these subunits are either identical to, or paralogous to, the twelve subunits of Pol II [28,81], indicating that Pols IV and V evolved as specialized forms of Pol II (see also [33, ...
Phylogenomics of type II DNA topoisomerases
Phylogenomics of type II DNA topoisomerases

... molecules via the formation of transient single- or doublestrand breaks. These breaks are characterised by a phosphotyrosine bond either at the 30 end or the 50 end of the broken DNA strands. This covalent linkage allows DNA topoisomerases to store the energy of the cleavage reaction that will be us ...
Prediction and investigation of novel proteins in DNA double
Prediction and investigation of novel proteins in DNA double

... ligation of the broken ends of DNA. The process of NHEJ involves three main protein complexes: Yku70/Yku80 initiates and stabilizes the DNA ends, Mre11/Rad50/Xrs2 brings broken ends to close proximity and Dnl4/Lif1/Nej1 ligates the DNA ends. Protein-protein interaction (PPI) has been utilized in fun ...
Ribotyping of Clostridium perfringens from industrially produced
Ribotyping of Clostridium perfringens from industrially produced

... testing, preferably after a period of a few months. Second, the discriminatory power of a method is an estimate of its ability to differentiate between two unrelated strains (Hunter 1990; Swaminathan and Matar 1993). The acceptable level of discrimination depends on a number of factors, but an index ...
Base-pair neutral homozygotes can be discriminated by calibrated
Base-pair neutral homozygotes can be discriminated by calibrated

... ATATATATAAATATAATA-C3-30 . The sequence of the high calibrator was 50 -GCGCGGCCGGCACTGACC CGAGACTCTGAGCGGCTGCTGGAGGTGCGGAA GCGGAGGGGCGGG-C3-30 . These oligonucleotides, and their reverse complements, were included at 0.05 mM in each amplification reaction. Importantly, all calibrators were blocked on ...
DNA METHODS FOR HLA TYPING A WORKBOOK FOR - ASHI-U
DNA METHODS FOR HLA TYPING A WORKBOOK FOR - ASHI-U

... lower than the example shown above? What would be the melting temperature of the 18 base pair sequence if it was made up of only G-C pairs? Only A-T pairs? ...
< 1 2 3 4 5 6 7 8 ... 417 >

United Kingdom National DNA Database

The United Kingdom National DNA Database (NDNAD; officially the UK National Criminal Intelligence DNA Database) is a national DNA Database that was set up in 1995. As of the end of 2005, it carried the profiles of around 3.1 million people. In March 2012 the database contained an estimated 5,950,612 individuals. The database, which grows by 30,000 samples each month, is populated by samples recovered from crime scenes and taken from police suspects and, in England and Wales, anyone arrested and detained at a police station.Only patterns of short tandem repeats are stored in the NDNAD – not a person's full genomic sequence. Currently the ten loci of the SGM+ system are analysed, resulting in a string of 20 numbers, being two allele repeats from each of the ten loci. Amelogenin is used for a rapid test of a donor's sex.However, individuals' skin or blood samples are also kept permanently linked to the database and can contain complete genetic information. Because DNA is inherited, the database can also be used to indirectly identify many others in the population related to a database subject. Stored samples can also degrade and become useless, particularly those taken with dry brushes and swabs.The UK NDNAD is run by the Home Office, after transferring from the custodianship of the National Policing Improvement Agency (NPIA) on 1 October 2012. A major expansion to include all known active offenders was funded between April 2000 and March 2005 at a cost of over £300 million.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report