Thesis - KI Open Archive
... provides a ready source of cells, since this tissue is normally discarded after delivery. Stromal cells were isolated from different parts of the term placenta, specifically chorionic villi, umbilical cord, and the fetal membranes. DSCs isolated from the fetal membranes had a consistent immunosuppre ...
... provides a ready source of cells, since this tissue is normally discarded after delivery. Stromal cells were isolated from different parts of the term placenta, specifically chorionic villi, umbilical cord, and the fetal membranes. DSCs isolated from the fetal membranes had a consistent immunosuppre ...
A novel EVI1 gene family, MEL1, lacking a PR domain (MEL1S) is
... The PRDI-BF1-RIZ1 homologous (PR) domain is a newly recognized amino-terminal module1 and was first noted for the homologous 100–amino acid region shared between positive regulatory domain I binding factor 1 (PRDI-BF1) (PRDM1)2 and retinoblastoma-interacting zinc finger protein (RIZ) (PRDM2).1 PR do ...
... The PRDI-BF1-RIZ1 homologous (PR) domain is a newly recognized amino-terminal module1 and was first noted for the homologous 100–amino acid region shared between positive regulatory domain I binding factor 1 (PRDI-BF1) (PRDM1)2 and retinoblastoma-interacting zinc finger protein (RIZ) (PRDM2).1 PR do ...
- Iranian Journal of Immunology
... allogeneic transplantations. Recently, mesenchymal stem cells (MSCs) are considered as effective therapeutic cells in transplantation due to their immunomodulatory activities (1-6). These multi-potent stem cells have self-renewal ability and are capable of migrating and engrafting at the sites of in ...
... allogeneic transplantations. Recently, mesenchymal stem cells (MSCs) are considered as effective therapeutic cells in transplantation due to their immunomodulatory activities (1-6). These multi-potent stem cells have self-renewal ability and are capable of migrating and engrafting at the sites of in ...
Histone Deacetylase 4 Antibody
... members, HDAC-1, 2, 3, and 8, each of which contains a deacetylase domain exhibiting from 45 to 93% identity in amino acid sequence. Class II of the HDAC family comprises HDAC-4, 5, 6, and 7, the molecular weights of which are all about twofold larger than those of the class I members, and the deace ...
... members, HDAC-1, 2, 3, and 8, each of which contains a deacetylase domain exhibiting from 45 to 93% identity in amino acid sequence. Class II of the HDAC family comprises HDAC-4, 5, 6, and 7, the molecular weights of which are all about twofold larger than those of the class I members, and the deace ...
- Nottingham ePrints
... and production of reactive oxygen species; they also produce H2O2 and peroxynitrite. The resultant superoxide radicals damage T cells, reducing their number, inhibiting the T cell receptor complex and inhibiting cell-mediated immune functions [8,15,19,21]. They induce the development of Tregs and T ...
... and production of reactive oxygen species; they also produce H2O2 and peroxynitrite. The resultant superoxide radicals damage T cells, reducing their number, inhibiting the T cell receptor complex and inhibiting cell-mediated immune functions [8,15,19,21]. They induce the development of Tregs and T ...
Novel therapeutic targets in primary biliary cirrhosis
... If we are to move beyond current therapy, and those agents currently under evaluation, what are the opportunities for new target development, and how do they fit into our understanding of the stages of disease pathogenesis? PBC is undoubtedly a disease with an autoimmune component; abundant human an ...
... If we are to move beyond current therapy, and those agents currently under evaluation, what are the opportunities for new target development, and how do they fit into our understanding of the stages of disease pathogenesis? PBC is undoubtedly a disease with an autoimmune component; abundant human an ...
CD8 -Mediated Survival and Differentiation of CD8 Memory T Cell
... However, the factors that permit selective survival of these T cells are not well established. We show that homodimeric ␣ chains of the CD8 molecule (CD8␣␣) are transiently induced on a selected subset of CD8␣⫹ T cells upon antigenic stimulation. These CD8␣␣ molecules promote the survival and diffe ...
... However, the factors that permit selective survival of these T cells are not well established. We show that homodimeric ␣ chains of the CD8 molecule (CD8␣␣) are transiently induced on a selected subset of CD8␣⫹ T cells upon antigenic stimulation. These CD8␣␣ molecules promote the survival and diffe ...
Expression of vascular endothelial growth factor
... phobic signal sequence, would consist of 120 (VEGF2), 164 (VEGF-1) or 188 (VEGF-3) amino acid residues (Fig. 2). The direct protein sequence analysis of the amino-terminal end of the putative murine VEGF (Plouet et al., 1989) is in agreement with the sequence obtained from the cDNA clones. However, ...
... phobic signal sequence, would consist of 120 (VEGF2), 164 (VEGF-1) or 188 (VEGF-3) amino acid residues (Fig. 2). The direct protein sequence analysis of the amino-terminal end of the putative murine VEGF (Plouet et al., 1989) is in agreement with the sequence obtained from the cDNA clones. However, ...
Unit 1 Exam
... Cellular respiration takes place in all cells so that energy can be released for use in life functions. ...
... Cellular respiration takes place in all cells so that energy can be released for use in life functions. ...
Th2 Cytokines Down-Regulate TLR Expression and Function
... TLR2 and TLR4 ligands, and inhibitory molecules such as Tollinteracting protein have been shown to further restrict TLR signaling in IECs (5). Dysregulated TLR signaling in IECs may also be an important pathogenic factor in the development of chronic intestinal inflammation (12). Breaks within the i ...
... TLR2 and TLR4 ligands, and inhibitory molecules such as Tollinteracting protein have been shown to further restrict TLR signaling in IECs (5). Dysregulated TLR signaling in IECs may also be an important pathogenic factor in the development of chronic intestinal inflammation (12). Breaks within the i ...
Sinusoid-lining cells are novel myeloid- endothelial innate cells that form splenic
... diversified antigen receptors that mediate slow but specific protection8. A third category of immune effector cells includes lymphocytes that blur the conventional boundaries between the innate and adaptive immune systems. These “in-betweeners” include T cells, NKT cells, B-1 cells and MZ B cells ...
... diversified antigen receptors that mediate slow but specific protection8. A third category of immune effector cells includes lymphocytes that blur the conventional boundaries between the innate and adaptive immune systems. These “in-betweeners” include T cells, NKT cells, B-1 cells and MZ B cells ...
The heparin-binding domain confers diverse functions of VEGF
... disulfide bonds which dominate the fold. In addition, a single α-helix is located in the C-terminal subdomain, where it is packed against the β-sheet. The charge of this overall highly basic domain (pI ∼11) is distributed rather unevenly across the surface, with a surplus of positively or negatively ...
... disulfide bonds which dominate the fold. In addition, a single α-helix is located in the C-terminal subdomain, where it is packed against the β-sheet. The charge of this overall highly basic domain (pI ∼11) is distributed rather unevenly across the surface, with a surplus of positively or negatively ...
HIV-1 IMMUNE RESPONSES INDUCED BY NATURAL INFECTION
... Since its discovery over 25 years ago, more than 60 million people have been infected with HIV‐1, and more than 20 million have died from AIDS related disease. There are several explanations as to why HIV‐1/AIDS has spread to become a world wide pandemic. The onset of AIDS is caused ...
... Since its discovery over 25 years ago, more than 60 million people have been infected with HIV‐1, and more than 20 million have died from AIDS related disease. There are several explanations as to why HIV‐1/AIDS has spread to become a world wide pandemic. The onset of AIDS is caused ...
Optimization of peripheral blood mononuclear cell
... delays, over the course of recovery from a respiratory infection. Another study, SMAF-001, was conducted with SMA patients and carriers were conducted at a Phase 1 clinical study unit. In healthy volunteers there were up to 10 fold differences in SMN protein levels between individuals, and in the sa ...
... delays, over the course of recovery from a respiratory infection. Another study, SMAF-001, was conducted with SMA patients and carriers were conducted at a Phase 1 clinical study unit. In healthy volunteers there were up to 10 fold differences in SMN protein levels between individuals, and in the sa ...
Chapter 1: Masters Thesis Literature Review
... advantages and disadvantages. The murine model is by far the most commonly used within research and during early drug testing. Most mice are able to tolerate fairly high bacterial loads for an extended period of time, leading to a chronic state of infection rather than the low bacterial load latent ...
... advantages and disadvantages. The murine model is by far the most commonly used within research and during early drug testing. Most mice are able to tolerate fairly high bacterial loads for an extended period of time, leading to a chronic state of infection rather than the low bacterial load latent ...
Mucosal inflammation in idiopathic bronchiectasis: cellular and molecular mechanisms REVIEW
... elements, namely infection, inflammation and enzymatic actions, which interact with each other, have been implicated in the pathophysiology of bronchiectasis. Some recent observations indicate that airway inflammation in bronchiectasis comes from a deregulated cytokine network independent of bacteri ...
... elements, namely infection, inflammation and enzymatic actions, which interact with each other, have been implicated in the pathophysiology of bronchiectasis. Some recent observations indicate that airway inflammation in bronchiectasis comes from a deregulated cytokine network independent of bacteri ...
Antibodies Targeting Hsa and PadA Prevent Platelet - Serval
... Labs, Ipswich, MA) according to the manufacturer’s instructions. Forward primers hsa-fw2 (TAAGCATATTACAAAAATGCC) and padA-fw2 (TAAGCATATTACAAAAATGCC) and reverse primers hsa-rv2 (CGTA CTAATCTGAAGATCTTTAAC) and padA-rv2 (TTCCAAGGTATCAG AAAG) were used to delete the LysA2 coding region from pHsa-LysA2 ...
... Labs, Ipswich, MA) according to the manufacturer’s instructions. Forward primers hsa-fw2 (TAAGCATATTACAAAAATGCC) and padA-fw2 (TAAGCATATTACAAAAATGCC) and reverse primers hsa-rv2 (CGTA CTAATCTGAAGATCTTTAAC) and padA-rv2 (TTCCAAGGTATCAG AAAG) were used to delete the LysA2 coding region from pHsa-LysA2 ...
Strimvelis, Common name - autologous CD34+ - EMA
... incidence ranging from 0.22 to 0.68 per 100,000 live births, or less than 50 children per year in the United States (US) and European Union (EU) combined. The EMA have recognised the importance of supporting development of new treatments for Rare Diseases through its alliance with EURORDIS and throu ...
... incidence ranging from 0.22 to 0.68 per 100,000 live births, or less than 50 children per year in the United States (US) and European Union (EU) combined. The EMA have recognised the importance of supporting development of new treatments for Rare Diseases through its alliance with EURORDIS and throu ...
Elucidating Host-Pathogen Interactions Based on Post
... specific interactions that differ significantly from the behavior of the individual species. Bacterial co-cultures or mixed populations find numerous benefits (1) they are commonly employed in the biotechnology industry such as in waste water treatment (Tijhuis et al., 1994), biogas plants (Klocke e ...
... specific interactions that differ significantly from the behavior of the individual species. Bacterial co-cultures or mixed populations find numerous benefits (1) they are commonly employed in the biotechnology industry such as in waste water treatment (Tijhuis et al., 1994), biogas plants (Klocke e ...
Pathways Molecule-Dependent and
... Abi G. Aleyas,* Junu A. George,2* Young Woo Han,2* M. M. Rahman,* Seon Ju Kim,* Sang Bae Han,† Byung Sam Kim,‡ Koanhoi Kim,§ and Seong Kug Eo3* ...
... Abi G. Aleyas,* Junu A. George,2* Young Woo Han,2* M. M. Rahman,* Seon Ju Kim,* Sang Bae Han,† Byung Sam Kim,‡ Koanhoi Kim,§ and Seong Kug Eo3* ...
Local immune regulation in human pregnancy Charlotte Gustafsson
... During pregnancy, the woman carries a fetus partly foreign to her immune system, because of the expression of paternal antigens. Despite this, the fetus is normally tolerated and not rejected, as is often the case with organs in allogeneic transplantations. Systemic changes in maternal blood occur d ...
... During pregnancy, the woman carries a fetus partly foreign to her immune system, because of the expression of paternal antigens. Despite this, the fetus is normally tolerated and not rejected, as is often the case with organs in allogeneic transplantations. Systemic changes in maternal blood occur d ...
... Anti-Borrelia burgdorferi immunoglobulin seroprevalence in pulmonary sarcoidosis: a negative report H. Martens*, B. Zöllner**, G. Zissel*, D. Burdon*, M. Schlaak*, J. Müller-Quernheim* Anti-Borrelia burgdorferi immunoglobulin seroprevalence in pulmonary sarcoidosis: a negative report. H. Martens, B. ...
Polyclonal B cell response
Polyclonal B cell response is a natural mode of immune response exhibited by the adaptive immune system of mammals. It ensures that a single antigen is recognized and attacked through its overlapping parts, called epitopes, by multiple clones of B cell.In the course of normal immune response, parts of pathogens (e.g. bacteria) are recognized by the immune system as foreign (non-self), and eliminated or effectively neutralized to reduce their potential damage. Such a recognizable substance is called an antigen. The immune system may respond in multiple ways to an antigen; a key feature of this response is the production of antibodies by B cells (or B lymphocytes) involving an arm of the immune system known as humoral immunity. The antibodies are soluble and do not require direct cell-to-cell contact between the pathogen and the B-cell to function.Antigens can be large and complex substances, and any single antibody can only bind to a small, specific area on the antigen. Consequently, an effective immune response often involves the production of many different antibodies by many different B cells against the same antigen. Hence the term ""polyclonal"", which derives from the words poly, meaning many, and clones (""Klon""=Greek for sprout or twig); a clone is a group of cells arising from a common ""mother"" cell. The antibodies thus produced in a polyclonal response are known as polyclonal antibodies. The heterogeneous polyclonal antibodies are distinct from monoclonal antibody molecules, which are identical and react against a single epitope only, i.e., are more specific.Although the polyclonal response confers advantages on the immune system, in particular, greater probability of reacting against pathogens, it also increases chances of developing certain autoimmune diseases resulting from the reaction of the immune system against native molecules produced within the host.