Chapters 18, 19, 20, 27) Virus, bacteria, gene expression
... Capsid – protein coat Capsomeres- small units that make up the capsid Viral envelope – - Are derived from membranes of host cells: as a virus is brought into a cell, it brings part of the host cell membrane in through endocytosis - May cloak the capsids of viruses found in animals Viral genomes ma ...
... Capsid – protein coat Capsomeres- small units that make up the capsid Viral envelope – - Are derived from membranes of host cells: as a virus is brought into a cell, it brings part of the host cell membrane in through endocytosis - May cloak the capsids of viruses found in animals Viral genomes ma ...
Biosafety - The University of Iowa
... These deletions render the vector replication deficient. In addition, vectors may have a partial or complete E3 deletion. Helper-dependent adenoviral vector (hdAd5) HdAd5 or "gutless" vectors are devoid of all viral coding sequences, except for the cis-acting sequences required for vector propagatio ...
... These deletions render the vector replication deficient. In addition, vectors may have a partial or complete E3 deletion. Helper-dependent adenoviral vector (hdAd5) HdAd5 or "gutless" vectors are devoid of all viral coding sequences, except for the cis-acting sequences required for vector propagatio ...
KlenTherm™ DNA Polymerase
... from a gene construct in E.coli, translation initiates at Met236, bypassing the 5'-3' exonuclease domain of the DNA polymerase encoding gene. This deletion leaves a highly active and even more heat-stable DNA polymerase activity. Repeated exposure to 98oC does not seem to diminish the enzyme activit ...
... from a gene construct in E.coli, translation initiates at Met236, bypassing the 5'-3' exonuclease domain of the DNA polymerase encoding gene. This deletion leaves a highly active and even more heat-stable DNA polymerase activity. Repeated exposure to 98oC does not seem to diminish the enzyme activit ...
Life: The Science of Biology, 8e
... The Genetics of Viruses and Prokaryotes - How is gene expression regulated in prokaryotes? The trp Operon: a repressible system (part 1) ...
... The Genetics of Viruses and Prokaryotes - How is gene expression regulated in prokaryotes? The trp Operon: a repressible system (part 1) ...
The Genetics of Viruses and Bacteria Chapter 18 PowerPoint Lectures for
... • Some viruses have structures have membranous envelopes that help them infect hosts • These viral envelopes surround the capsids of influenza viruses and many other viruses found in animals • Viral envelopes, which are derived from the host cell’s membrane, contain a combination of viral and host ...
... • Some viruses have structures have membranous envelopes that help them infect hosts • These viral envelopes surround the capsids of influenza viruses and many other viruses found in animals • Viral envelopes, which are derived from the host cell’s membrane, contain a combination of viral and host ...
video slide - Morgan Community College
... • Some viruses have structures have membranous envelopes that help them infect hosts • These viral envelopes surround the capsids of influenza viruses and many other viruses found in animals • Viral envelopes, which are derived from the host cell’s membrane, contain a combination of viral and host ...
... • Some viruses have structures have membranous envelopes that help them infect hosts • These viral envelopes surround the capsids of influenza viruses and many other viruses found in animals • Viral envelopes, which are derived from the host cell’s membrane, contain a combination of viral and host ...
Transposable Elements
... Viral retrotransposons look a little like retroviruses—but are NOT the same ! ...
... Viral retrotransposons look a little like retroviruses—but are NOT the same ! ...
chapter 16
... replacing it with DNA nucleotides that it adds one by one to 3’ end of third fragment. Replacement of last RNA nucleotide with DNA leaves the sugar-phosphate backbone with a free 3’ end DNA ligase binds 3’ end of the second fragment to the 5’ end of the first fragment ...
... replacing it with DNA nucleotides that it adds one by one to 3’ end of third fragment. Replacement of last RNA nucleotide with DNA leaves the sugar-phosphate backbone with a free 3’ end DNA ligase binds 3’ end of the second fragment to the 5’ end of the first fragment ...
microbesanddiseases
... then the body will learn to produce antibodies to attack that microbe, and so will be immune to that disease in the future. This is called vaccination. We say the person has been immunised against the disease. The dead microbes that are put into the body are called ...
... then the body will learn to produce antibodies to attack that microbe, and so will be immune to that disease in the future. This is called vaccination. We say the person has been immunised against the disease. The dead microbes that are put into the body are called ...
Location and Characterization of the Bovine Herpesvirus Type 2
... Apart from the disease caused by BHV-2 this virus is also of interest as it is one of the few nonhuman herpesviruses whose D N A bears nucleotide sequence homology with the HSV-1 genome (Sterz et al., 1973/74). A direct comparison made between the BHV-2 TK gene nucleotide sequence and that of the HS ...
... Apart from the disease caused by BHV-2 this virus is also of interest as it is one of the few nonhuman herpesviruses whose D N A bears nucleotide sequence homology with the HSV-1 genome (Sterz et al., 1973/74). A direct comparison made between the BHV-2 TK gene nucleotide sequence and that of the HS ...
Exam 1 Practice Answers
... Two 21bp dsDNA molecules are shown below. Which molecule will have the higher Tm if they were each placed in separate solutions with the same salt concentration. Briefly explain your answer. (10 points) DNA molecule A: 5’ ATAGCGTAGCTGTCGTATCGC 3’ 3’ TATCGCATCGACAGCATAGCG 5’ DNA molecule B: 5’ GCGTAG ...
... Two 21bp dsDNA molecules are shown below. Which molecule will have the higher Tm if they were each placed in separate solutions with the same salt concentration. Briefly explain your answer. (10 points) DNA molecule A: 5’ ATAGCGTAGCTGTCGTATCGC 3’ 3’ TATCGCATCGACAGCATAGCG 5’ DNA molecule B: 5’ GCGTAG ...
DNA Replication
... 1. Double stranded DNA that has been labeled with radioactive 14C is used as the template for replication. Replication is carried out in a medium containing only unlabeled nucleotides. After two rounds of replication, what percent of double stranded DNA molecules are radioactive? A) 25% B) 50% ...
... 1. Double stranded DNA that has been labeled with radioactive 14C is used as the template for replication. Replication is carried out in a medium containing only unlabeled nucleotides. After two rounds of replication, what percent of double stranded DNA molecules are radioactive? A) 25% B) 50% ...
DNA Replication
... 1. Double stranded DNA that has been labeled with radioactive 14C is used as the template for replication. Replication is carried out in a medium containing only unlabeled nucleotides. After two rounds of replication, what percent of double stranded DNA molecules are radioactive? A) 25% B) 50% C) 7 ...
... 1. Double stranded DNA that has been labeled with radioactive 14C is used as the template for replication. Replication is carried out in a medium containing only unlabeled nucleotides. After two rounds of replication, what percent of double stranded DNA molecules are radioactive? A) 25% B) 50% C) 7 ...
Table of Contents
... X-ray crystallography provides structural data for any protein that can be crystallized NMR spectroscopy is used to study the structures of small proteins Gel retardation identifies DNA fragments that bind to proteins ...
... X-ray crystallography provides structural data for any protein that can be crystallized NMR spectroscopy is used to study the structures of small proteins Gel retardation identifies DNA fragments that bind to proteins ...
7.014 Problem Set 3 Solutions
... After acing the 7.014 Quiz 1, you take a well-deserved break and go “looking for Baker House.” Somewhere in the tunnels you stumble on a device you have never seen before, and start playing with its dials. It turns out to be a time- and reality-transporting device. It lands you in the office of the ...
... After acing the 7.014 Quiz 1, you take a well-deserved break and go “looking for Baker House.” Somewhere in the tunnels you stumble on a device you have never seen before, and start playing with its dials. It turns out to be a time- and reality-transporting device. It lands you in the office of the ...
7.014 Problem Set 3 Solutions
... After acing the 7.014 Quiz 1, you take a well-deserved break and go “looking for Baker House.” Somewhere in the tunnels you stumble on a device you have never seen before, and start playing with its dials. It turns out to be a time- and reality-transporting device. It lands you in the office of the ...
... After acing the 7.014 Quiz 1, you take a well-deserved break and go “looking for Baker House.” Somewhere in the tunnels you stumble on a device you have never seen before, and start playing with its dials. It turns out to be a time- and reality-transporting device. It lands you in the office of the ...
ppt - Science with Ms. Wood!
... What is the difference between these two domains? Refer to p. 173 Holtzclaw “A Comparison of the three domains of Life” ...
... What is the difference between these two domains? Refer to p. 173 Holtzclaw “A Comparison of the three domains of Life” ...
GFI MailSecurity
... “As email is the number one route for malicious traffic onto networks, and as any second of downtime disrupts our ability to provide our services to clients, our primary criterion in judging mail security packages was quality at any price. GFI MailSecurity’s vendor-neutral architecture allows us to ...
... “As email is the number one route for malicious traffic onto networks, and as any second of downtime disrupts our ability to provide our services to clients, our primary criterion in judging mail security packages was quality at any price. GFI MailSecurity’s vendor-neutral architecture allows us to ...
Principles of Virology
... • Viral DNA replication always requires synthesis of at least one viral protein, sometimes many (hence always delayed after infection) • Simple viruses require more host proteins - genetic economy • Complex viruses encode many, but not all proteins required for replication ...
... • Viral DNA replication always requires synthesis of at least one viral protein, sometimes many (hence always delayed after infection) • Simple viruses require more host proteins - genetic economy • Complex viruses encode many, but not all proteins required for replication ...
video slide
... Tobacco mosaic disease stunts growth of tobacco plants and gives their leaves a mosaic coloration ...
... Tobacco mosaic disease stunts growth of tobacco plants and gives their leaves a mosaic coloration ...
DNA virus
A DNA virus is a virus that has DNA as its genetic material and replicates using a DNA-dependent DNA polymerase. The nucleic acid is usually double-stranded DNA (dsDNA) but may also be single-stranded DNA (ssDNA). DNA viruses belong to either Group I or Group II of the Baltimore classification system for viruses. Single-stranded DNA is usually expanded to double-stranded in infected cells. Although Group VII viruses such as hepatitis B contain a DNA genome, they are not considered DNA viruses according to the Baltimore classification, but rather reverse transcribing viruses because they replicate through an RNA intermediate. Notable diseases like smallpox, herpes, and chickenpox are caused by such DNA viruses.