• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
PCAN: phenotype consensus analysis to support
PCAN: phenotype consensus analysis to support

... (PCAN); an indirect phenotype-based method that quantifies the consensus similarity of genetic disorders linked to the mechanism of a putative disease causing gene. PCAN makes use of widely adopted knowledge resources for protein-protein interactions (STRING [16]) and signaling pathways (Reactome [1 ...
Interspecies Bacterial Conjugation by Plasmids from Marine
Interspecies Bacterial Conjugation by Plasmids from Marine

... were originally exogenously isolated from marine bacterial communities. Eleven of the 19 different eubacterial recipients formed transconjugants, including a species only distantly related to the donor, Planctomyces maris. The results imply that interspecies gene transfer mediated by conjugation is ...
Eds., N. Hamamura, S. Suzuki, S. Mendo, C. M. Barroso,... © by TERRAPUB, 2010.
Eds., N. Hamamura, S. Suzuki, S. Mendo, C. M. Barroso,... © by TERRAPUB, 2010.

... Bacillus megaterium MB1. The mer operon encoded by TnMERI1 has merR, merT, merP, merA and merB gene, which code for metal specific activatorrepressor, transporting, extra cellular metal ion binding, mercuric reductase and organomercurial lyase, respectively. These genetic elements provide us tremend ...
Primer Design
Primer Design

... In the later rounds most of the DNA is target gene only, and includes the previous primer sequences. Remember that primers are incorporated into the amplified genes! ...
Mapping avirulence genes in the rice blast fungus Magnaporthe grisea
Mapping avirulence genes in the rice blast fungus Magnaporthe grisea

... cultivar race specificity and its variability. Breeding for resistance has shown that a large number of rice cultivars have major genes conferring complete resistance towards specific races of the rice blast fungus (Ou 1985, Kiyosawa et al., 1986). This cultivar specificity is controlled on the path ...
Characteristics of a Laboratory Strain of Coleomegilla maculata with
Characteristics of a Laboratory Strain of Coleomegilla maculata with

... The ye/10sp strain was analyzed using classical Mendelian breeding and documented by digital image collection. Insects were maintained as previously described [2] [3]. Individual insects were isolated for reciprocal straincrosses, and putative heterozygous first generation offspring (F1) crosses wer ...
Near Neutrality, Rate Heterogeneity, and Linkage Govern
Near Neutrality, Rate Heterogeneity, and Linkage Govern

... 1999), bouts of adaptive evolution (McVean 2001), or mutational hot spots (Galtier et al. 2006). Nonetheless, the necessary enzymes for recombination are present in the mitochondria, and a few paternal mitochondria do penetrate the egg during fertilization (Thygarajan et al. 1996). Recombination is ...
Algorithm to extract REP sequences Pattern
Algorithm to extract REP sequences Pattern

... CGCGGCGGCGCCCTATAAAACCCAGCGGCGCGACGCGCCA ...
2. Sex-linked genes have unique patterns of inheritance
2. Sex-linked genes have unique patterns of inheritance

... chromosomes, only one X chromosome is active and one X chromosome condenses into a compact object, a Barr body •  involves the attachment of methyl (CH3) groups to cytosine nucleotides on the X chromosome (inactivates most of its genes). •  After Barr body formation, all descendent cells have the ...
RNA-Seq Tutorial - Gene Codes Corporation
RNA-Seq Tutorial - Gene Codes Corporation

... The  next  thing  you  will  need  to  do  is  filter  down  the  number  of  genes  to  a  more  reasonable   number  for  CodeLinker’s  analyses  to  work  with.  You  are  going  to  use  the  (IBIS)  Integrated   Bayesian  Inference  System  to  create  a  gene  list  of  the  most  important  g ...
Temporal genomic evolution of bird sex chromosomes
Temporal genomic evolution of bird sex chromosomes

Presentation: Computation to Solve Problems
Presentation: Computation to Solve Problems

Educator`s Guide - American Museum of Natural History
Educator`s Guide - American Museum of Natural History

Molecular studies on an ancient gene encoding
Molecular studies on an ancient gene encoding

... Eukaryotic genes, as well as a small number of prokaryotic and organellar genes, have long intervening unexpressed sequences (introns) dividing the coding sequence into pieces (exons). The existence of introns in contemporary genomes has led to several mechanistic and historical questions. The debat ...
Tassia 1 Benthic Macrofauna Abundance Along a Transect from
Tassia 1 Benthic Macrofauna Abundance Along a Transect from

... Unfortunately, studying deep-sea systems proves difficult. Instead, understanding shallow-water benthic macrofauna communities can provide us insight into the questions to be asked for deep-sea systems. Previous studies have shown physical and biotic factors, such as slope, tide distance, detrital i ...
Yeast whole-genome analysis of conserved regulatory motifs
Yeast whole-genome analysis of conserved regulatory motifs

... • Additional intriguing stories found, to be explored ...
03_SAC_pseudogenes_final_pap
03_SAC_pseudogenes_final_pap

... number of combinations between the number of distance matrixes and clustering algorithms. Supervised methods represent an alternative to unsupervised microarray data analysis because it takes a different approach in which previous knowledge about which genes are related each to another. By having a ...
Evolution of DNA Sequencing - Journal of the College of Physicians
Evolution of DNA Sequencing - Journal of the College of Physicians

... Sanger and coworkers introduced DNA sequencing in 1970s for the first time. It principally relied on termination of growing nucleotide chain when a dideoxythymidine triphosphate (ddTTP) was inserted in it. Detection of terminated sequences was done radiographically on Polyacrylamide Gel Electrophore ...
The bacterial two-hybrid system based on adenylate cyclase
The bacterial two-hybrid system based on adenylate cyclase

... Fusion to T25 or T18 can mis-fold the protein of interest, make it unstable, or disallow its interaction with its partner. Using an indirect measure to determine protein interactions has constrains as the signaling cascade is complicated and the output is not only regulated by cAMP. BACTH is compose ...
Testing enhancers predicted by high constraint
Testing enhancers predicted by high constraint

... transcriptional enhancer activity may be one of the predominant functions of non-coding genomic regions under extreme constraint throughout vertebrate evolution. We categorized all 75 identified enhancers by their general anatomical patterns of expression using an existing standardized nomenclature2 ...
Bicoid mRNA - bthsresearch
Bicoid mRNA - bthsresearch

... segments ...
Nematode genome evolution
Nematode genome evolution

... species have been studied, but nematodes display a lot of karyotypic variation (Špakulová and Casanova, 2004). The lowest haploid number is n=1 in Parascaris univalens, but very high counts are seen in polyploid species in the Tylenchomorpha. For example, the race of Meloidogyne hapla being sequence ...
Significance of bacterial identification by molecular
Significance of bacterial identification by molecular

Pulmonary Arterial Hypertension Panel Indication
Pulmonary Arterial Hypertension Panel Indication

... ABCA3, CAV1, KCNK3, and KCNA5. Pulmonary hypertension is one of the pulmonary vascular manifestations of hereditary hemorrhagic telangiectasia (HHT). Genes associated with HHT (ENG, ACVRL1, SMAD4, GDF2) are included in this panel. PAH has an autosomal dominant pattern of inheritance. The average pen ...
Document
Document

... fragmentation. Crossing over and chromosome fragmentation require the recruitment of proteins that mediate the transfer of genetic information (Hamiliton et al., 2006). Proteins are needed for the translocation of DNA and the hydrolysis of phosphodiester bonds during crossing over and chromosome fra ...
< 1 ... 95 96 97 98 99 100 101 102 103 ... 342 >

Pathogenomics

Pathogen infections are among the leading causes of infirmity and mortality among humans and other animals in the world. Until recently, it has been difficult to compile information to understand the generation of pathogen virulence factors as well as pathogen behaviour in a host environment. The study of Pathogenomics attempts to utilize genomic and metagenomics data gathered from high through-put technologies (e.g. sequencing or DNA microarrays), to understand microbe diversity and interaction as well as host-microbe interactions involved in disease states. The bulk of pathogenomics research concerns itself with pathogens that affect human health; however, studies also exist for plant and animal infecting microbes.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report