Physiological and Molecular Plant Pathology (2001) 59, 33-43
... PR-10 protein family [18] and the serine residue in position 112 essential for IgE binding [33] are present in all members of the APa and APb subclasses. Similarly, the amino-acid sequences of AP1 to AP4 located between positions 89 and 120 share 88 % similarity with the PR10 family signature patter ...
... PR-10 protein family [18] and the serine residue in position 112 essential for IgE binding [33] are present in all members of the APa and APb subclasses. Similarly, the amino-acid sequences of AP1 to AP4 located between positions 89 and 120 share 88 % similarity with the PR10 family signature patter ...
SUNLIBB Work Packages, Aims and Achievements
... The aim of WP2 is to generate transcriptomic data for genes involved in secondary cell wall biosynthesis in maize, miscanthus and sugarcane. A better understanding of cell wall biosynthesis will allow the tailoring of lignocellulosic biomass for more efficient conversion into Biobased products. For ...
... The aim of WP2 is to generate transcriptomic data for genes involved in secondary cell wall biosynthesis in maize, miscanthus and sugarcane. A better understanding of cell wall biosynthesis will allow the tailoring of lignocellulosic biomass for more efficient conversion into Biobased products. For ...
Specialized techniques for site-directed mutagenesis in cyanobacteria
... inserted without generating any apparent phenotype. These loci have been developed as targeting sites for cloned genes. Any DNA of interest can be inserted into the S. elongatus NS sequences on a plasmid introduced into the cyanobacterium and, by homologous recombination, moved into the cyanobacteri ...
... inserted without generating any apparent phenotype. These loci have been developed as targeting sites for cloned genes. Any DNA of interest can be inserted into the S. elongatus NS sequences on a plasmid introduced into the cyanobacterium and, by homologous recombination, moved into the cyanobacteri ...
Advances in Environmental Biology Zahra Maryami, Arash Fazeli, Ali-Ashraf Mehrabi
... The main component in wheat flour is starch, which is formed of two type’s glucose polymers: amylose and amylopectin [1,2], amylose is the linear amylose (23-35%) and amylopectin is the highly branched amylopectin (68-75%) to the total starch [3]. The ratio of polymers is important as it affects pro ...
... The main component in wheat flour is starch, which is formed of two type’s glucose polymers: amylose and amylopectin [1,2], amylose is the linear amylose (23-35%) and amylopectin is the highly branched amylopectin (68-75%) to the total starch [3]. The ratio of polymers is important as it affects pro ...
Microsoft Word - Mapping-Traits-in-Dogs
... continues to gain new insights from the amazing morphological differences seen across the canine species, including many that give clues about human biology and disease." Until now, relatively little was known about the genes influencing the length, growth pattern and texture of the coats of dogs. T ...
... continues to gain new insights from the amazing morphological differences seen across the canine species, including many that give clues about human biology and disease." Until now, relatively little was known about the genes influencing the length, growth pattern and texture of the coats of dogs. T ...
DNA Diversity in Sex-Linked and Autosomal Genes of the Plant
... all of these processes may have led to Y chromosomes gradually accumulating deleterious mutations, such that Y-linked genes have become less and less functional. A further consequence of these processes is reduction of the effective population size of Y-linked genes, which should therefore have redu ...
... all of these processes may have led to Y chromosomes gradually accumulating deleterious mutations, such that Y-linked genes have become less and less functional. A further consequence of these processes is reduction of the effective population size of Y-linked genes, which should therefore have redu ...
Canadian Journal of Microbiology
... was chosen for this study. The above-ground parts of 50 Crocus plants (stems and flowers) were collected in March 2002 at the edge of a mixed natural forest at about 760 m height in upper Austria. The forest was composed primarily of indigenous tree species, including broadleaf and needle leaf trees ...
... was chosen for this study. The above-ground parts of 50 Crocus plants (stems and flowers) were collected in March 2002 at the edge of a mixed natural forest at about 760 m height in upper Austria. The forest was composed primarily of indigenous tree species, including broadleaf and needle leaf trees ...
Endosymbiosis Theory
... the nucleus formed. Fist of all, phylogenetic evidence (Figure 5) supports that all mitochondrial genomes are descended from a common protomitochondrial ancestor. In another word, mitochondria originated only once in evolution. Second, what was the host organism? The existence of a group of eukaryot ...
... the nucleus formed. Fist of all, phylogenetic evidence (Figure 5) supports that all mitochondrial genomes are descended from a common protomitochondrial ancestor. In another word, mitochondria originated only once in evolution. Second, what was the host organism? The existence of a group of eukaryot ...
Lophotrochozoan relationships and parasites. A snap-shot
... Dreissena (Conn et al., 1996). Parasitic species are also found within polychaetes, as members of the Oenonidae, which live part of there life in the coelom of other annelids (Rouse & Pleijel, 2001). Other cases of parasitism have been reported from Chrysopetalidae, Nautiliniellidae, Nereididae, and ...
... Dreissena (Conn et al., 1996). Parasitic species are also found within polychaetes, as members of the Oenonidae, which live part of there life in the coelom of other annelids (Rouse & Pleijel, 2001). Other cases of parasitism have been reported from Chrysopetalidae, Nautiliniellidae, Nereididae, and ...
Hox Genes - Wyoming Scholars Repository
... can be replicated in humans, and so to this day Drosophila is still one of the most popular model organisms for researchers. Though Thomas Hunt Morgan was unable to identify which genes controlled for the body plan, decades later three scientists would complete his work. In 1995 Edward B. Lewis, Chr ...
... can be replicated in humans, and so to this day Drosophila is still one of the most popular model organisms for researchers. Though Thomas Hunt Morgan was unable to identify which genes controlled for the body plan, decades later three scientists would complete his work. In 1995 Edward B. Lewis, Chr ...
08_chapter 1
... 1.2.2.2. Inversion and inverted transposition hypothesis There are two independent publIcations suggesting genome wide inversions are responsible for the establishment of parity in chromosomes (Albrecht-Buehler, 2006; Okamura et at., 2007). Albrecht-Buehler (2006) has viewed Chargaffs 2 nd parity as ...
... 1.2.2.2. Inversion and inverted transposition hypothesis There are two independent publIcations suggesting genome wide inversions are responsible for the establishment of parity in chromosomes (Albrecht-Buehler, 2006; Okamura et at., 2007). Albrecht-Buehler (2006) has viewed Chargaffs 2 nd parity as ...
Amplified fragment length polymorphism (AFLP)
... (Vos et al., 1995) have emerged. Because AFLP technique permits inspection of polymorphism at a large number of loci distributed throughout a plant genome, within a very short period of time and requires very small amount of DNA, it provides new opportunities for mapping and gene tagging in plants w ...
... (Vos et al., 1995) have emerged. Because AFLP technique permits inspection of polymorphism at a large number of loci distributed throughout a plant genome, within a very short period of time and requires very small amount of DNA, it provides new opportunities for mapping and gene tagging in plants w ...
Studying copy number variations using a nanofluidic platform
... (panels). Digital array has been routinely used by us to quantitate DNA samples of unknown concentration and, especially, cDNA samples whose concentrations of the sequences of interest are hard to determine otherwise. Specific Target Amplification separates the linked copies of a target gene When du ...
... (panels). Digital array has been routinely used by us to quantitate DNA samples of unknown concentration and, especially, cDNA samples whose concentrations of the sequences of interest are hard to determine otherwise. Specific Target Amplification separates the linked copies of a target gene When du ...
glycan associated protein of Legionella (PpiA)
... PCR amplification. A 523 bp fragment encoding solely PpiA13 was amplified by polymerase chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and ...
... PCR amplification. A 523 bp fragment encoding solely PpiA13 was amplified by polymerase chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and ...
Saccharopolyspora erythraea that are involved
... lying between eryAZ and eryK had an EryB phenotype. The EryC mutants, on the other hand, accumulate 3-aL-mycarosyl-erythronolide B, and convert erythromycin D (or later intermediates) to erythromycin A. These mutants cannot synthesize desosamine and/or are unable to attach it the macrolactone ring. ...
... lying between eryAZ and eryK had an EryB phenotype. The EryC mutants, on the other hand, accumulate 3-aL-mycarosyl-erythronolide B, and convert erythromycin D (or later intermediates) to erythromycin A. These mutants cannot synthesize desosamine and/or are unable to attach it the macrolactone ring. ...
Mining medical data using multiple corpora
... The first idea was to access automatically GenBank entries corresponding to genes from Transcriptomics server thanks to AccNum. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory ...
... The first idea was to access automatically GenBank entries corresponding to genes from Transcriptomics server thanks to AccNum. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory ...
Characterization of PIR1, a GATA family transcription factor involved
... 2008). Analysis of the Postia genome has revealed a poor repertoire of cellulase encoding genes, placing iron-based chemistry and iron regulation as crucial elements in cellulose degradation by this fungus (Martinez et al., 2009). Lignocellulose breakdown by white-rot and brown-rot fungi differs mar ...
... 2008). Analysis of the Postia genome has revealed a poor repertoire of cellulase encoding genes, placing iron-based chemistry and iron regulation as crucial elements in cellulose degradation by this fungus (Martinez et al., 2009). Lignocellulose breakdown by white-rot and brown-rot fungi differs mar ...
Recognition of an organism from fragments of its complete genome
... genome and considered three kinds of length sequences. After calculating the correlation dimensions and Hurst exponents, it was found that one can get more information from this model than that of the fractal Cantor pattern. Some results on the classification and evolution relationship of bacteria w ...
... genome and considered three kinds of length sequences. After calculating the correlation dimensions and Hurst exponents, it was found that one can get more information from this model than that of the fractal Cantor pattern. Some results on the classification and evolution relationship of bacteria w ...
Multiple Mechanisms Contribute to Lateral Transfer of an
... laterally transferred into hosts that do not support its replication, the opd cluster appears to integrate into the host chromosome, either through transposition or through site-specific integration. The data presented in this study help to explain the existence of identical opd genes among soil bact ...
... laterally transferred into hosts that do not support its replication, the opd cluster appears to integrate into the host chromosome, either through transposition or through site-specific integration. The data presented in this study help to explain the existence of identical opd genes among soil bact ...
Evolutionary relationships of the Tas2r receptor gene families in
... conservation in mouse than in human and suggest a classification in five groups that may reflect a specialization in their functional activity to detect bitter compounds. Tas2r genes are organized in clusters in both mouse and human genomes and an analysis of these clusters and phylogenetic analyses ...
... conservation in mouse than in human and suggest a classification in five groups that may reflect a specialization in their functional activity to detect bitter compounds. Tas2r genes are organized in clusters in both mouse and human genomes and an analysis of these clusters and phylogenetic analyses ...
The sequence of a gene encoding convicilin from pea
... pea seeds, in addition to legumin and vicilin [1]. It can be purified from both legumin and vicilin, and it consists solely of polypeptides of Mr approx. 71 000. It does not thus contain polypeptides found in either of the two major storage proteins [2]. On the other hand, convicilin is antigenicall ...
... pea seeds, in addition to legumin and vicilin [1]. It can be purified from both legumin and vicilin, and it consists solely of polypeptides of Mr approx. 71 000. It does not thus contain polypeptides found in either of the two major storage proteins [2]. On the other hand, convicilin is antigenicall ...
Factors Affecting synonymous codon Usage Bias in chloroplast
... genes shared particularly different features of codon usage and evolutionary constraints. In the future, Further research on a comparative analysis of codon bias and factors in shaping the codon usage patterns among mitochondrion, chloroplast and nuclear genes may help clarify the relationship betwe ...
... genes shared particularly different features of codon usage and evolutionary constraints. In the future, Further research on a comparative analysis of codon bias and factors in shaping the codon usage patterns among mitochondrion, chloroplast and nuclear genes may help clarify the relationship betwe ...
Forum in Plant Diseases: Rhizomania and Cercospora Leaf Spot
... discussion took place at the end of the presentations. Dr. Ron Pitblado initiated the presentations with discussion on a weather model that incorporates both temperature and leaf wetness th'lt has been used in other crops and is now being used to detennine CLS fungicide application initiation and in ...
... discussion took place at the end of the presentations. Dr. Ron Pitblado initiated the presentations with discussion on a weather model that incorporates both temperature and leaf wetness th'lt has been used in other crops and is now being used to detennine CLS fungicide application initiation and in ...