• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
The Role of F-Box Proteins during Viral Infection
The Role of F-Box Proteins during Viral Infection

... phosphorylated IκBα and therefore maintaining NFκB in its inhibited state. The expression of the rotavirus protein NSP1 is sufficient to induce this effect [42]. The strategy of interferon inhibition is also adopted by other viruses. The Human immunodeficiency virus type-1 (HIV-1) Vpu protein binds ...
Proteomics methods for subcellular proteome analysis
Proteomics methods for subcellular proteome analysis

... thereby increasing the reproducibility while being costeffective and time-effective. However, such kits are often limited with regard to what organelles can be enriched. Free flow electrophoresis is a highly versatile technology that was introduced nearly 50 years ago for the separation of a wide va ...
as Powerpoint presentation
as Powerpoint presentation

... This process is similar in mitochondria and in many bacteria. Phosphorylation of ADP to ATP is catalysed by a membrane-bound ATP synthase (also called ATPase). The energy for this is provided by the oxidation of NADH2 by oxygen, catalysed by an electron transport chain. This sequence of redox reacti ...
Sequence Architecture Downstream of the
Sequence Architecture Downstream of the

... Jackson, 1994). It was also correlated with a high frequency of Ala as the corresponding amino acid at the second position in vertebrate (Grunert and Jackson, 1994) and plant (Luehrsen and Walbot, 1994) proteins. However, the advantage, if any, of an Ala next to the initiator Met has not been report ...
Sample Questions 1 - U of L Class Index
Sample Questions 1 - U of L Class Index

... the column. Thus, smaller solutes are retarded relative to larger solutes which do not enter the pores. (27) The unknown protein must be exposed to conditions that (1) disrupt quaternary structure and (2) maintain quaternary structure. SDS-PAGE in the presence of reducing agent (2-mercaptoethanol) w ...
Leukaemia Section del(11)(q23q23) MLL/CBL t(11;11)(q23;q23) MLL/CBL Atlas of Genetics and Cytogenetics
Leukaemia Section del(11)(q23q23) MLL/CBL t(11;11)(q23;q23) MLL/CBL Atlas of Genetics and Cytogenetics

... expression in undifferentiated cells. Major regulator of hematopoiesis and embryonic development; role in cell cycle regulation. ...
RNA Interference of Signal Peptide-binding Protein SRP54 Elicits
RNA Interference of Signal Peptide-binding Protein SRP54 Elicits

... (5). SRP then targets the nascent chain-ribosome complex to the ER membrane by interacting with a membrane-bound SRP receptor. After this docking event that is GTP-dependent, the translocation of the polypeptide takes place co-translationally through the protein pore, the translocon (6, 7). The well ...
ppt
ppt

... because translocation does not add an amino acid; rather, it ends the chain. ...
Slide 1
Slide 1

... because translocation does not add an amino acid; rather, it ends the chain. ...
LABORATORY Exercise Protein Structure
LABORATORY Exercise Protein Structure

... This Secondary Structure consists of alpha helices and/or beta sheets. Proteins commonly contain a combination of alpha helices and beta sheets. In fact, proteins can be thought of as a series of alpha helices and beta sheets, joined by loops of less regular protein structure. ...
Global absolute quantification reveals tight regulation of protein
Global absolute quantification reveals tight regulation of protein

... ing studies have revealed cellular heterogeneity and stochastic gene expression at the single-cell level, which are overseen in analyses on cell populations. Such single cell variations can be caused by differences in cell-cycle phase, developmental stage, local signaling concentrations, transcripti ...
lecture07_13
lecture07_13

... Finding the p53 binding motif in a set of p53 target sequences which are ranked according to binding affinity >affinity = 5.962 ACAAAAGCGUGAACACUUCCACAUGAAAUUCGUUUUUUGUCCUUUUUUUUCUCUUCUUUUUCUCUCCUGUUUCU >affinity = 5.937 AAUAAAAAUAGAUAUAAUAGAUGGCACCGCUCUUCACGCCCGAAAGUUGGACAUUUUAAAUUUUAAUUCUCAUGA > ...
Metabolism of erythrocytes
Metabolism of erythrocytes

... Red blood cells adopt a sickle shape in a consequence of the forming haemoglobin S fibers The high incidence of sickle-cell disease coincides with a high incidence of malaria Individuals heterozygous in haemoglobin S have a higher resistance to malaria; the malarial parasite spends a portion of its ...
Does Plant Cell Death Require Toxin Entry?
Does Plant Cell Death Require Toxin Entry?

... Plant pathogen causing the disease tan spot of sensitive wheat species Crop losses estimated up to 50% in susceptible ...
Production of final product
Production of final product

... Some enzyme reactions produce light and this can be measured to detect product formation - Radiometric assays : measure the incorporation of radioactivity into substrates or its release from substrates. Most frequently used radioactive isotopes : 14C, 32P, 35S, Fe57 and 125I. ...
File
File

... around water (Hydrophilic), some hate water and hide from it (Hydrophobic), and for some, it doesn’t matter as much. Proteins do not exist as a string of amino acids, but must fold into a 3 dimensional (3D) shape to function. These folded proteins exist in a water environment. Proteins fold based on ...
QTL analysis of yield traits in an advanced backcross
QTL analysis of yield traits in an advanced backcross

... 413 bp ORF, starting with an initiating codon at 238 bp and ending with a stop codon at 1 650 bp (accession number FJ768729). The predicted protein product of AhKASⅠ comprises 470 amino acids with the calculated molecular mass of 49.958 9 kD and a pI of 8.46. Prediction of subcellular location sugge ...
From: Methods in Molecular Biology, vol. 408
From: Methods in Molecular Biology, vol. 408

... atoms and backbone Ramachandran angles fluctuate significantly over time. An ID region can be as short as a few amino acid residues, or it can propagate through the long disordered loops, ends, domains, or even through entire proteins (13). In the authors’ view, an IDP is a protein that contains at ...
Sourdough_Starter_
Sourdough_Starter_

The Bcl-3 oncoprotein acts as a bridging factor between NF
The Bcl-3 oncoprotein acts as a bridging factor between NF

... followed by Pirin and Tip60. Thus, expression of Jab1, Tip60 or Pirin enhance association of Bcl-3 with p50 dimers, suggesting a functional interaction. Tip60 enhances Bcl-3-p50 mediated transcriptional activation through an NF-kB binding site The fact that Bcl-3 interacting proteins are either enga ...
Impact of clostridial glucosylating toxins on the
Impact of clostridial glucosylating toxins on the

Corn Bt 176 - Biotechnology Philippines
Corn Bt 176 - Biotechnology Philippines

... Bt- 176 Corn and all corn lines/hybrids derived from this event contain the Cry1Ab coding sequence from Bacillus thuringiensis var kurstaki strain HD-1 (Btk). The Cry1Ab gene encodes for the production of crystal proteins. These crystal proteins are effective as insecticides after ingestion by speci ...
Stitching proteins into membranes, not sew simple
Stitching proteins into membranes, not sew simple

... N-terminal to the hydrophobic core may inhibit SAI insertion and promote integration in the opposite orientation (Denzer et al., 1995). This is likely a result of folded domains not being compatible with transfer through the translocon pore into the ER lumen for steric reasons. The inability to tran ...
How will Hemoglobin Affect the Winner of this Year`s Super Bowl
How will Hemoglobin Affect the Winner of this Year`s Super Bowl

... around water (Hydrophilic), some hate water and hide from it (Hydrophobic), and for some, it doesn’t matter as much. Proteins do not exist as a string of amino acids, but must fold into a 3 dimensional (3D) shape to function. These folded proteins exist in a water environment. Proteins fold based on ...
Unusual Prokaryotic Envelope Cyanobacterial Cell Walls
Unusual Prokaryotic Envelope Cyanobacterial Cell Walls

... widespread feature of cyanobacterial porins, as the complete sequence of Synechocystis sp. strain PCC 6803 (87) encodes six homologues of SomA and SomB, all with highly conserved SLH domains (49). Sequence alignments of this and other SLH domains show similarities between the cyanobacterial porins a ...
< 1 ... 162 163 164 165 166 167 168 169 170 ... 399 >

Magnesium transporter

This page links directly from the magnesium in biological systems page.Magnesium transporters are proteins that transport magnesium across the cell membrane. All forms of life require magnesium, yet the molecular mechanisms of Mg2+ uptake from the environment and the distribution of this vital element within the organism are only slowly being elucidated.In bacteria, Mg2+ is probably mainly supplied by the CorA protein and, where the CorA protein is absent, by the MgtE protein. In yeast the initial uptake is via the Alr1p and Alr2p proteins, but at this stage the only internal Mg2+ distributing protein identified is Mrs2p. Within the protozoa only one Mg2+ transporter (XntAp) has been identified. In metazoa, Mrs2p and MgtE homologues have been identified, along with two novel Mg2+ transport systems TRPM6/TRPM7 and PCLN-1. Finally, in plants, a family of Mrs2p homologues has been identified along with another novel protein, AtMHX.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report