Download Expressing Genetic Information

BSCS
Unit 2, Chapter 9
Expressing Genetic Information
1. Study the scanning electron micrograph of human
chromosomes during mitosis. Locate the chromatids and
centromere. Now, study the fine detail of the chromatin.
How would you describe it?
2. What is stored in the chromatin, the genetic material of
DNA?
3. Genes are discrete units of DNA that act in a certain way.
What is that way?
4. Compare and contrast DNA with RNA.
5. What is the genetic code?
6. What is the Human Genome Project?
7. What percentage of RNA is rRNA? Why is it so high?
8. Using DNA, RNA and proteins, write a simple chemical
equation with these words that indicates the flow of
information in the expression of genetic information.
9. What are the four nucleotides involved in DNA and RNA?
10. In the chart below, pick out the start and stop codons.
Write their 3 amino acid sequence (e.g., AAA)
11. What is a codon? What does each codon code for?
12. Determine the name of the amino acids from the
following codons:
AUG – UUA – GCU – CCG – UUU – GGA – UGA
13. How many different amino acids are there? How many
different codons are there?
14. What does this suggest to you?
15. Study Figure 9.3 in your book on p. 236. Explain the
interactions of all three types of RNA.
16. What is the importance of proteins?
17. Read the Biological Challenge on p. 239.
18. Do cells express their genes at all times? Why is this
important?
19. What is the role of E. coli in our intestines?
20. What is the role of transcription in the cell?
21. Describe the process.
22. Transcribe the DNA sequence below.
AGCCTAAGAATTCGCCAGACTGA
23. What are molecular motors? What is their significance?
24. What are the three stages of transcription called? What
happens in each stage? Where does it take place?
25. Describe the steps of RNA processing. Where does it
take place?
26. Differentiate between introns and exons.
27. What are the cap and poly-A tail of the processed mRNA
molecule?
28. Describe the process of translation. Where does it take
place? What RNA’s are involved?
29. What are the three stages of translation?
30. What happens to the completed protein?
31. Read Focus On p. 253. What is the role of proteosomes?
32. What happens if errors are made during translation?
33. What is a frame shift?
34. What is a signal sequence and what is its significance in
protein synthesis?
35. What is a charged tRNA? What is its role in translation?
36. Define virus, bacteriophage. What is their relationship?
37. What are all viruses made up of? Are they considered to
be organisms? Why or why not?
38. Compare and contrast the lytic and lysogenic cycles of
bacteriophages.
39. Research the HIV that causes AIDS. What role does
reverse transcriptase play in its life cycle?
40. Why are antibiotics ineffective against viruses?
41. List and describe several diseases caused by virsuses.