Download Protein Synthesis Project - Lin

Protein Synthesis Project
Name____________________________
Date_____________________________
Messenger RNA molecule part:
UUUUCUUAUCUUCGUACUGUUGGU
CGUGGUUAUACUUCUGUUGGUUUU
Construct a chart using the following directions:
1. Decode the above strand of m-RNA using the decoder below.
UUU= Phenylaline
GGU= Glycine
UAU= Tyrosine
CUU= Leucine
ACU= Threonine
UCU= Serine
CGU= Argenine
GUU= Valine
Write out the resulting t-RNA in the space
below, remember A-U and C-G.
t-RNA :
________________________________________________________________________
_____
________________________________________________________________________
_____
2. Now divide the t-RNA into its codons by separating them with a vertical line.
3. Using the amino acid chart found above, determine the name of the
amino acid that each codon codes for m-RNA. Write the abbreviation of the amino acids,
in their proper order, in the area below.
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
4. How many molecules of water are lost in the process of creating this entire protein? (
dehydration synthesis). _________.
5. Name the enzymes needed for the following processes to occur:
a). t-RNA activation _________________________________________________
b). m-RNA startup __________________________________________________
c). termination of protein synthesis ______________________________________
6. Explain how the proper amino acid is attached to their correct t-RNA molecule.
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
________________________________________________________________________
_____
7. How many amino acids does this complete protein contain? _____________.
©2000 Troy High School Biology